Taylor et al. 1 GIGANTEA is required for robust circadian rhythms in wheat. 1 Laura J. Taylor1, Gareth Steed1, Gabriela Pingarron-Cardenas1, Lukas Wittern1, Matthew A. Hannah2,† 2 and Alex A. R. Webb1,*,† 3 † These authors contributed equally to this work and share the last authorship 4 1 Department of Plant Sciences, University of Cambridge, Cambridge, UK, CB2 3EA 5 2 BASF, BASF Belgium Coordination Center CommV, Technologiepark 101, 9052 Gent Zwijnaarde, 6 Belgium 7 *Corresponding Authors 8 Alex Webb: aarw2@cam.ac.uk, Matthew Hannah: matthew.hannah@basf.com 9 Contact: 10 Laura Taylor: laurataylor1994.lt@gmail.com 11 Gareth Steed: gareth_steed@hotmail.co.uk 12 Gabriela Pingarron-Cardenas: gp519@cam.ac.uk 13 Lukas Wittern: lukaswittern@gmail.com 14 15 16 17 18 19 Number of tables: 2 20 Number of figures: 6 21 Word count: 4269 22 Supplementary tables: 2 23 Supplementary figures: 8 24 25 GIGANTEA is required for circadian oscillations in wheat. Highlight 26 GIGANTEA is required for robust circadian oscillations in wheat and regulates heading, most likely 27 through a PHOTOPERIOD-1-dependent pathway. 28 Abstract 29 GIGANTEA (GI) is a plant-specific protein that functions in many physiological processes and signalling 30 networks. In Arabidopsis, GI has a central role in circadian oscillators regulating the abundance of 31 ZEITLUPE and TIMING OF CAB EXPRESSION 1 proteins and is essential for photoperiodic regulation 32 of flowering. We have investigated how ortholgues of this component of Arabidopsis circadian 33 oscillators contributes to circadian rhythms and yield traits, including heading (flowering) in wheat. We 34 find that GI is a core component of wheat circadian oscillators that is necessary to maintain robust 35 oscillations in chlorophyll fluorescence and circadian oscillator transcript abundance. Predicted lack of 36 functional GI results in later flowering in wheat in both long days and short days in controlled 37 environment conditions. Our results support and extend previous work which suggests that the 38 pathways by which photoperiodism regulates flowering are not fully conserved between Arabidopsis 39 and wheat. Understanding the molecular basis for photoperiodism in wheat is important for breeders 40 looking to manipulate flowering time and develop new elite, high yielding cultivars. 41 Key words: circadian, evening complex, flowering, gigantea, oscillations, wheat, 42 Abbreviations: 43 Chlorophyll fluorescence (CF) 44 CIRCADIAN CLOCK ASSOCIATED 1 (CCA1) 45 CONSTANS (CO) 46 Continuous light (LL) 47 FLAVIN BINDING KELCH REPEAT 1 (FKF1) 48 FLOWERING LOCUS T (FT) 49 GIGANTEA GI 50 Growth stage 55 (GS55) 51 Light dark (LD) 52 LONG ELONGATED HYPOCOTYL (LHY) 53 National Institute of Agricultural Botany (NIAB) 54 Taylor et al. 3 Non-photochemical quenching (NPQ) 55 Photoperiod 1 (PPD-1) 56 PSEUDO RESPONSE REGULATOR (PRR) 57 Relative Amplitud Error (RAE) 58 TIMING OF CAB EXPRESSION 1 (TOC1) 59 Wild type (WT segregant). 60 ZEITLUPE (ZTL) 61 GIGANTEA is required for circadian oscillations in wheat. Introduction 62 Circadian oscillators are endogenous timing mechanisms that act to time internal processes to daily 63 and seasonal cycles in their environment. In the model plant Arabidopsis, well defined transcription-64 translation feedback loops result in sequential expression of circadian oscillator genes across the 24-65 hour cycle. At dawn, CIRCADIAN CLOCK ASSOCIATED 1 (CCA1) and LONG ELONGATED 66 HYPOCOTYL (LHY) are expressed and repress the day phased PSEUDO RESPONSE REGULATOR 67 (PRR) genes (PRR7, PRR9 and TIMING OF CAB EXPRESSION 1, TOC1) (Harmer et al., 2000; Adams 68 et al., 2015). REVILLE (RVE)/ LIGHT NIGHT INDUCIBLE AND CLOCK REGULATED 1 (LNK1) 69 complex promotes PRR expression (Rawat et al., 2011; Xie et al., 2014), which feeds back to repress 70 CCA1/LHY (Nakamichi et al., 2010). The evening complex (EARLY FLOWERING 3/EARLY 71 FLOWERING 4/LUX ARRYTHMO) represses PRR expression at dusk (Dixon et al., 2011; Helfer et al., 72 2011; Nusinow et al., 2011). PRR action is further restricted to the light by ZEITLUPE (ZTL)-mediated 73 degradation of PRR proteins in the dark (Cha et al., 2017; Lee et al., 2019). Thus, CCA1/LHY repression 74 is lifted towards the new dawn and the cycle repeats. In Arabidopsis, proteins that might function as 75 scaffolds have profound effects on the circadian oscillator. For example, members of the WD40 repeat 76 family of scaffold proteins are essential for circadian rhythms (Airoldi et al., 2019). GIGANTEA (GI) is 77 another potential scaffold protein that is important in circadian timing. GI regulates ZTL stability and 78 activity through light-dependent binding and affects deubiquitination and also translational activity (Lee 79 et al., 2019). Mutations in GI have allele-specific effects on Arabidopsis circadian oscillators but are 80 mostly considered to result in faster running circadian oscillators and therefore shorter circadian periods 81 in constant conditions (Hsu and Harmer, 2014). The architecture of circadian oscillators is broadly 82 conserved across the plant kingdom, with alleles of circadian oscillator genes selected during 83 domestication and in breeding programs to enhance agriculturally important crop traits, such as 84 flowering time (McClung, 2021; Steed et al., 2021). However, we have found in wheat that transcripts 85 of ELF3, which encodes a putative scaffold protein, peak at dawn, rather than dusk as in Arabidopsis 86 (Wittern et al., 2023). Furthermore, wheat ELF3 proteins are unstable in the light (Alvarez et al., 2023). 87 These data suggest that there are differences in circadian oscillator structure and function in wheat 88 compared to Arabidopsis and warrant further investigation. 89 In Arabidopsis, mutations in GI also have profound effects on the photoperiodic flowering pathway due 90 to both its function in regulating circadian oscillators and more direct roles in regulating the floral 91 Taylor et al. 5 induction mechanisms (Fowler et al., 1999). In the external coincidence model of photoperiodism, 92 flowering is induced when external light is coincident with an appropriate phase of the circadian rhythm 93 (Bunning, 1960; Pittendrigh and Minis, 1964). GI connects circadian oscillators and the photoperiodic 94 flowering pathway, and along with FLAVIN BINDING KELCH REPEAT 1 (FKF1) and CONSTANS (CO) 95 are the molecular components which determine the light-sensitive and -insensitive phase of the 96 circadian cycle for the regulation of flowering (Suárez-López et al., 2001; Valverde et al., 2004; Sawa 97 et al., 2007). In long photoperiods, GI and FKF1 peak expression coincides in the late afternoon, forming 98 a complex which promotes CO expression. In Arabidopsis, if light is coincident with the accumulation 99 of CO transcripts, CO protein is stabilised to pass the threshold necessary to trigger FLOWERING 100 LOCUS T (FT) expression (Imaizumi et al., 2003; Sawa et al., 2007; Fornara et al., 2009). Arabidopsis 101 FT is a mobile signal which travels from the leaf to the apical meristem to trigger floral development 102 (Corbesier et al., 2007). In short photoperiods, FKF1 and GI maximal expression do not coincide, hence 103 CO repression is not lifted during the day and maximal CO accumulation occurs at night, outside of the 104 light sensitive phase of the rhythm (Sawa et al., 2007). Therefore, GI mutants such as gi-1 (premature 105 stop coding resulting in the loss of 171 of the C-terminal domain), gi-2 (causing the deletion of all but 106 142 amino acids of the N-terminal domain and addition of the 16 new amino acids in the C-terminal 107 domain) and T-DNA insertion line (gi-11, deletion in the 5’ half of GI caused by the insertion of the T-108 DNA) are late flowering in long photoperiods but have no, or minor delays to flowering when cultivated 109 in short photoperiods (Fowler et al., 1999; Park et al., 1999). 110 In wheat photoperiodic-dependent regulation of flowering is heavily dependent on Photoperiod 1 (PPD-111 1), an orthologue of Arabidopsis PRR3 or PRR7 (Turner et al., 2005; Beales et al., 2007; Wilhelm et 112 al., 2009). PPD-1 induces FT1 expression in leaves activating the transition to the reproductive stage 113 (Alvarez et al., 2023). Analyses of the tetraploid wheat loss of function Target Induced Local Lesions 114 In Genome (TILLING) lines containing stop codon and splice site mutations have demonstrated that 115 PPD-1 and CO1/CO2 act in separate but highly connected flowering pathways (Shaw et al., 2020). In 116 tetraploid wheat, light activation of PPD-1, mediated by phytochromes PHYB and PHYC, is facilitated 117 by ELF3, which represses the expression of PPD-1 by directly binding to its promoter (Alvarez et al., 118 2023). ELF3 controls the abundance of PPD-1 to regulate flowering somewhat independent of its role 119 in circadian oscillators in tetraploid wheat (Wittern et al., 2023). Tetraploid wheat plants carrying a 120 deletion in the promoter of the A homoeologue of PPD-1 (Ppd-1Aa) are photoperiod-insensitive (PI) 121 GIGANTEA is required for circadian oscillations in wheat. and are early heading under short photoperiods. In contrast, plants that carry the Ppd-1Ab allele are 122 photoperiod-sensitive heading later under short photoperiods (Alvarez et al., 2023). 123 In wheat GI regulates flowering, though the mechanisms are not yet resolved. Association studies using 124 wheat lines from diverse geographical regions found that polymorphisms in GI are associated with 125 earlier flowering (Rousset et al., 2011). In both wheat and barley, GI expression levels peak in the 126 afternoon in long and short photoperiods (Dunford et al., 2005; Zhao et al., 2005; Rees et al., 2022). 127 Wheat GI rescues the late flowering phenotype in Arabidopsis gi-2 with over-expression of the wheat 128 GI in Arabidopsis resulting in earlier flowering (Zhao et al., 2005). GI loss-of-function mutants in a 129 photoperiod-sensitive wheat background have delayed heading dates in both long and short 130 photoperiods. The stronger effects of GI on heading date in long photoperiods required PPD-1 or ELF3, 131 suggesting function in a common pathway (Li et al., 2024). 132 To investigate the relationship between the function of the circadian oscillator in the regulation of 133 heading, we isolated wheat TILLING lines which carry predicted non-functional alleles of the Durum 134 wheat orthologues of Arabidopsis GI. We demonstrate that GI is required for robust circadian 135 oscillations in Durum wheat. We then investigated whether GI functions in the Durum wheat 136 photoperiodic flowering pathway independent of normal PPD-1 function. Finally, we investigated if lack 137 of functional GI affects other aspects related to yield traits. 138 Materials and Methods 139 Isolation of GI TILLING mutant lines in tetraploid wheat 140 To investigate the role of GI in wheat, we isolated TILLING mutants in the tetraploid wheat variety T. 141 turgidum cv. Kronos. Two TILLING lines with premature stop codons within the A GI homoeologues 142 (GI-A, TraesCS3A02G116300, Kronos2019) and B GI homoeologues (GI-B, TraesCS3B02G135400, 143 Kronos2205) genes were obtained from the Germplasm Resource Unit (GRU), Norwich UK (Figure 1). 144 BLAST search of the sequenced Kronos TILLING lines for TtGI identified pairs of candidate lines with 145 deleterious mutations in each of the subgenomes for TtGI, which were obtained directly from Dr. 146 Cristobal Uauy (John Innes Centre, Norwich). Further candidates from tetraploid Kronos were identified 147 using a pre-publication version of the http://www.wheat-tilling.com website (Krasileva et al., 2017). 148 Kronos2019 contains a C to T SNP 6606 nucleotide base pairs (bp) from the start of the GI-A3 149 transcription start site (TSS) (position 3A:84190982 IWGSC Refseq V1.1). This SNP is situated within 150 Taylor et al. 7 the 12th exon of the first splice variant and the fourth exon of the second splice variant and is predicted 151 to result in the deletion of 356 amino acids (Fig. 1A). Kronos2205 contains a G to A SNP 6348 bp 152 downstream of the GI-B3 TSS (position 3B:117929486 IWGSC Refseq V1.1). This SNP is situated 153 within the 12th exon of the first two splice variants and the 11th exon of the third splice variant and is 154 predicted to result in the deletion of 403 amino acids (Fig. 1B). Abundance of TtGI at ZT12 and ZT15 is 155 not significantly different between the wild type genotypes, single and double mutants, with both 156 homologous expressing at the same level (Supplementary Fig. S1) . 157 Kronos TILLING lines were backcrossed four times to Kronos (Supplementary Fig. S2). The BC4 F1 158 heterozygous plants were self-crossed to produce BC4 F2 seed. BC4 F2 seeds were genotyped, and 159 seeds retained from plants which were homozygous for the Kronos2019 or Kronos2205 mutations. The 160 homozygous Kronos2019 (Ttgi-A3) and Kronos2205 (Ttgi-B3) lines were crossed, self-crossed and 161 plants homozygous for both Kronos2019 and Kronos2205 mutations (Ttgi-A3/gi-B3) were selected. To 162 control for possible background mutations, that are present in the TILLING populations, plants 163 homozygous for both wild type alleles were selected as mutant sibling wild type (WT segregant). Kronos 164 wild type line was selected as non-mutagenized wild type control. 165 Genotyping 166 Genotyping was performed by PCR followed by Sanger sequencing conducted by Source Bioscience 167 Ltd (UK). A Faststart Taq Polymerase Kit (Roche, UK) was used for PCR following the manufacturer’s 168 instructions. PCR conditions were as follows: 4 min at 95°C; 40 cycles of 30 s at 95°C, 30 s at 68°C/69°C 169 (Ttgi-A3 and Ttgi-B3 respectively), 60 s at 72°C; 10 min at 72°C. Primers used for the A homologue: 170 forward 5’ GCATCATCCCTCTACCATTTGA 3’ and reverse 5’ GTACAAGCTTCACCGTCGA 3’. 171 Primers used for the B homologue: forward 5’GTTGGTACCTCCTGGAACTACA 3’ and reverse 172 5’CATCCCATCTGTAGCACGAAGTA 3’. 173 Plant Growth conditions 174 Seeds were sown directly into modular trays containing a 5:1 mix of Levington M2 potting compost pre-175 treated with Intercept 70W (0.02 gL-1, Bayer) and fine vermiculite. Seeds were stratified for 48 hours at 176 4°C and then moved into a growth cabinet (PGR14, Conviron) or room (Conviron) fitted with broad 177 spectrum LED white light. If plants were to grow to maturity, seedlings were transplanted into 12 by 12 178 by 13 cm pots containing an identical soil mix after two weeks of growth. Plants were grown under 400 179 GIGANTEA is required for circadian oscillations in wheat. µmol m-2 s-1 PAR, 22°C white light/ 18°C dark in either long (16 hours light/ 8 hours dark) or short (8 180 hours light/ 16 hours dark) photoperiods. 181 Chlorophyll fluorescence measurements 182 Chlorophyll fluorescence (CF) measurements were performed as outlined in Wittern et al., (2023). A 183 five mm by five mm leaf fragment was placed into a well of a black 96 well plate (Greiner) containing 184 0.8% (w/v) bactoagar (BD), ½ MS (Duchefa Biochemie) and 0.5 uM 6-benzyl aminopurine (Sigma), 185 adjusted to pH5.7 using 0.5 M KOH (Sigma). 186 CF imaging and processing was performed using a CFImager and accompanying software 187 (Technologica Ltd., UK). CF images were captured using a Stingray F145B ASG camera (Allied Vison 188 Technologies, UK) through a RG665 long pass filter to exclude blue light from the LEDs. The 189 ‘continuous light’ protocol included the following steps: 40 minutes 100 µmol m-2s-1 of blue light, 800 ms 190 6172 µmol m-2s-1 saturating light pulse and 20 minutes of darkness. This protocol was repeated 120 191 times. The parameters Non-photochemical quenching (NPQ) and Fv/Fm (maximum potential quantum 192 efficiency of Photosystem II, PSII) were used for circadian analysis. Relative Amplitude Error (RAE) 193 calculation and period estimates were generated using Biodare2 (Zielinski et al., 2014). 194 Reverse-transcription quantitative PCR 195 The Ttgi-A3/gi-B3 and Kronos wild type lines were sown and grown in a growth room under long day 196 conditions (16 h L: 8 h D; 250 µmol m−2 s −1, 20 °C). TtGI expression was analysed from 14-day old 197 plants at TtGI peak expression, ZT12 and ZT15. For analysis of circadian oscillator transcript 198 abundance, samples were collected after 14 days of sowing from the first true leaf every 3 h for 96 h. 199 During the first 24 h, sampling was done under long day conditions (16 h L: 8 h D; 250 µmol m−2 s −1, 200 20 °C) and then the cabinet was switched to continuous white light (250 µmol m-2 s -1) and constant 201 temperature (20 °C). Flowering gene expression was analysed at the three-leaf growth stage (14 days 202 after sowing) leaves and in GS39 growth stage (flag leaf blade all visible) under long day conditions (16 203 h L: 8 h D; 250 µmol m−2 s −1, 20 °C). Sampling commenced at time 0 for 24 h every 3 h. 204 Total RNA was extracted from leaves using the RNeasy Plant Mini Kit (Qiagen, UK) with an on-column 205 DNAse digest (Qiagen, UK), concentration and quality was determined using the Nanodrop ND-1000 206 (Thermofischer scientific). cDNA was synthesized from 500 ng RNA using the RevertAid First Strand 207 cDNA synthesis kit (Thermo Scientific, UK). Three technical replicates of gene-specific products were 208 Taylor et al. 9 amplified in 10 µl reactions using QuantiNova SYBR Green PCR Kit (Quiagen) on a CFX384 Touch 209 Real-Time PCR detection system (Bio Rad). Transcript levels were determined relative to the 210 expression of two housekeeping genes, RP15, RPT5A and Ta22845 as described in Wittern et al., 211 (2023). Primer sequences are shown in Table 1. 212 213 Plant phenotyping (laboratory) 214 Growth stage 55 (GS55), i.e., when half of the ear emerged above flag leave ligule (Zadoks et al., 1974) 215 was recorded daily. The first tiller to reach GS55 (primary tiller) per plant was marked. Post senescence, 216 the height of each plant was measured using a meter rule and the total number of tillers and number of 217 productive tillers were counted. The primary head (head from primary tiller) was collected and the 218 length, spikelet number, seed number and seed weight recorded. Seed number and weight were then 219 determined for the whole plant. Seed number was counted by hand and seed weight measured using 220 a balance. 221 Field trial 222 Observational (1 m2) plots of Kronos, WT segregant, Ttgi-A3 and Ttgi-A3/gi-B3 lines were grown at 223 National Institute of Agricultural Botany (NIAB, Cambridge, UK) experimental farm during the 2020 field 224 season to provide preliminary data and bulk seed for a larger trial the following year. Environmental 225 data is included in Supplementary information. On the 9th of April 2021, Kronos, WT segregant, Ttgi-A3 226 and Ttgi-A3/gi-B3 yield plots (3.8m x 2m = 7.6 m2) were drilled at NIAB following a randomised block 227 design (Supplementary Fig. S3). The trial was flanked by two rows of Paragon to separate the GI field 228 experiment from other trials located at the site. Ttgi-B3 was not included due to insufficient number of 229 seed during the 2020 field season. 230 Five plants per plot were randomly tagged from the middle of each plot. The date each tagged plant 231 reached GS55 was recorded. Post senescence, the height of each tagged plant was measured using 232 a metre rule and the total number of tillers per tagged plant was counted. A representative head was 233 taken from each tagged plant and the length, spikelet number, grain number and grain weight were 234 recorded. Data was not recorded from Paragon control plants as the higher plant density and tillering 235 meant that the tags were no longer visible within the Paragon plots. On the 4th of September the plots 236 GIGANTEA is required for circadian oscillations in wheat. were harvested and the weight of grain plus the percentage grain moisture for each plot was determined 237 by the NIAB field team. 238 Statistics 239 All statistical analysis was performed using R. For CF datasets, significant differences between the 240 groups were tested for using an ANOVA followed by a post hoc Tukey test. Statistics for phenotypic 241 data collected from plants grown in the laboratory and tagged plants from the field were as follows. 242 Continuous variables (plant height, primary head length, weight of seed) were tested using an ANOVA 243 followed by a Post hoc Tukey. All continuous discrete variables (days till GS55, tiller number, seed 244 number, spikelet number) were tested using a Kruskal Wallis test followed by a post hoc Dunn test 245 adjusted for multiple comparisons. 246 Sequence analysis 247 TaGI genomic sequences and CDS were retrieved from the reference genome sequence (IWGSC 248 RefSeqv1.1) and submitted as query sequences to local Basic Local Alignment Search Tool (BLAST) 249 server to identify GI in wheat cultivar genomes released by the 10+ genomes project (Walkowiak et al., 250 2020) (Table S1). A reciprocal BLAST approach was used to confirm ambiguous results. Alignments 251 were created using CLC Genomics between the BLAST results, the genomic BLAST query sequence 252 (IWGSC RefSeqv1.1) the CDS and mRNA. SNPs and InDels within the CDS were manually annotated 253 and counted. 254 255 Results 256 TtGI is required for robust circadian rhythms under constant light. 257 To establish if GI contributes to the functioning of wheat circadian oscillators, we quantified circadian 258 rhythms in chlorophyll a fluorescence from Triticum turgidum cv. Kronos by measuring the period and 259 the relative amplitude error (measurement of the goodness of fit of the data to a cosine curve, RAE > 260 0.5 usually indicates a lack of circadian rhythms) (Fig. 2). Robust circadian oscillations of the chlorophyll 261 a fluorescence derived parameter reporting non-photochemical quenching (NPQ) were measured in 262 the recurrent parent and WT segregant lines (22.70 ± 0.27 hours, 23.30 ± 0.28 hours, respectively) (Fig. 263 2A and 2B, Supplementary Table S2). The measured periods were shorter than 24 h due to the high 264 Taylor et al. 11 blue light intensity illumination used in our CF apparatus, which accelerates circadian oscillators and 265 therefore shortens circadian period in constant conditions. Predicted loss of function of Ttgi-B3 had little 266 effect on circadian function (period 22.70 ± 0.22 hours, RAE 0.21 ± 0.01; Fig. 2F and 2G, Supplementary 267 Table S2). Whereas plants in which there was a loss of functional Ttgi-A3 had shorter period NPQ 268 circadian rhythms (period 21.30 ± 0.14 hours, RAE 0.26 ± 0.01 Fig. 2F and 2G; Supplementary Table 269 S2). The difference of period between single mutants was 1.40 hours. Mutation of both copies of GI 270 (Ttgi-A3/gi-B3) resulted in loss of robust circadian rhythms demonstrated by an RAE of 0.59 ± 0.05 (Fig. 271 2F and 2G, Supplementary Table S2). The double mutant led to higher variation of plants that are 272 rhythmic or arrhythmic. Here, 25% of the leaf fragments tested had a RAE < 0.5, indicating rhythmicity 273 with a period of approximately 18h. The high variability of RAE values and shorter period is also seen 274 in Arabidopsis gi-3 mutant lines (Mizoguchi et al., 2005). Assessment of another chlorophyll a RAE 275 parameter Fv/Fm (Supplementary Fig S4; Supplementary Table S2) resulted in the same conclusions 276 that loss of Ttgi-A3 shortens circadian period (Ttgi-A3 period 21.71 ± 0.11 hours RAE = 0.27 ± 0.02, 277 Ttgi-B3 period 22.05 ± 0.11 hours, RAE = 0.26 ± 0.02), with a difference in period of 0.75 hours, and 278 loss of both Ttgi-A3 and Ttgi-B3 abolishes robust circadian rhythms (RAE 0.52 ± 0.04; Supplementary 279 Fig S4.G; Supplementary Table S2). 280 281 Circadian oscillator transcript abundance is perturbed in Ttgi-A3/gi-B3 loss-of-function lines. 282 Having found that GI double mutants affect circadian rhythms in wheat we investigated how this might 283 occur by examining regulation of circadian oscillator transcript abundance in Ttgi-A3/gi-B3 in white light 284 dark (LD) and continuous white light (LL). Under LD, transcripts of TtLHY, TtTOC1, TtPRR73, TtLUX 285 and, TtGI oscillated robustly in the Kronos genotype and Ttgi-A3/gi-B3 (Fig. 3). In LD cycles in Kronos 286 there were robust cycles of circadian oscillator transcript abundance in both Kronos and Ttgi-A3/gi-B3, 287 (Fig. 3). The loss of functional GI resulted in a reduction in amplitude of TtGI and TtELF3, an increase 288 in amplitude of TtTOC1 and little effect on the other components (Fig.3). The slightly advanced wave 289 forms in LD in Ttgi-A3/gi-B3 suggested that loss of TtGI advances the entrained phase of circadian 290 oscillators in wheat (Fig. 3). This early phase phenotype advanced the timing of maximal expression of 291 TtLHY and TtTOC1 in Ttgi-A3/gi-B3 compared to Kronos (TtLHY ZT0 compared to ZT3, TtTOC1 ZT9-292 12 compared to ZT12) in LD (Fig. 3A and 3B), while phasing of peak transcript abundance of TtPRR73 293 (ZT6), TtGI (ZT9) and TtLUX (ZT12) was unaffected in Ttgi-A3/gi-B3 (Fig. 3C, 3E and 3F). In LD 294 GIGANTEA is required for circadian oscillations in wheat. conditions, there were no significant differences in TtPPD-1 peak transcript abundance between the 295 Ttgi-A3/gi-B3 and Kronos (Fig. 3D). 296 In the first true circadian cycle (beginning 24 hours after the transition to LL), peak transcript abundance 297 of TtLHY, TtTOC1, TtPRR73, TtLUX and TtGI was phased earlier in Ttgi-A3/gi-B3 than in Kronos 298 (denoted by orange stars). Oscillations of transcript abundance were detected in Kronos in the 299 subsequent LL cycles, albeit with reducing amplitude, whilst in Ttgi-A3/gi-B3 transcript abundance 300 tended to be less rhythmic (Fig. 3). Both TtPPD-1 and TtELF3 expression had undetectable rhythms in 301 prolonged LL in both Kronos and Ttgi-A3/gi-B3 (Fig. 3D and 3G), consistent with previous reports of 302 low amplitude rhythms of wheat ELF3 transcripts (Wittern et al., 2023). JTK cycle (Fig. 3.H) analysis 303 reported that TtGI, TtLHY, TtPPD-1 and TtTOC1 expression as rhythmic (BH. Q < 0.05) in LL, however 304 visual inspection suggests the rhythmic dynamics were not as robust, this was particularly evident for 305 TtLHY (Fig. 3A) and TtPRR73 (Fig. 3C). 306 307 TtGI is a mild promoter of flowering in long and short-day photoperiods. 308 Our data demonstrate that mutation of GI has affects wheat circadian oscillators. In Arabidopsis, GI 309 contributes to photoperiodism through its role in maintaining robust circadian rhythms and through the 310 regulation of FKF1 (Sawa et al., 2007). The TILLING population used in our studies carries the semi-311 dominant PPD1a allele which reduces the sensitivity of heading date to photoperiod, though the 312 mechanism by which this occurs are not currently understood. This gave us the opportunity to 313 investigate whether loss of GI function, and the associated effect on circadian oscillators can affect 314 heading date additively to the PPD-1-mediated photoperiod perception pathway. We grew Kronos, WT 315 segregant, Ttgi-A3, Ttgi-B3 and Ttgi-A3/gi-B3 lines in long and short photoperiods recording when each 316 plant reached the heading growth stage (GS55, half the ear emerged from the ligule), an easily 317 observed growth stage which is commonly used as a proxy for flowering time in wheat (Zadoks et al., 318 1974) 319 Under long photoperiod, heading time in the double mutant was later (59 ± 0.31 days) than either single 320 mutant (Ttgi-A3 54 ± 0.78 days, Ttgi-B3 51 ± 0.28 days) and even later than Kronos (51± 0.51) days 321 and WT segregant (54 ± 0.37 days) (Fig. 4A) demonstrating that the delayed flowering observed in the 322 double mutant is caused by the absence of a functional GI rather than background mutations. In short 323 Taylor et al. 13 photoperiods the Ttgi-3A/gi-3B double mutants reached GS55 10 days after Ttgi-A3 and WT segregant, 324 13 days after Ttgi-B3 and 14 days after Kronos (Fig. 4B) demonstrating an effecting on heading. These 325 results differ from Arabidopsis where GI mutants (gi-1-6) and T-DNA insertion line (gi-11) flower later in 326 long day and have minor delays in short day flowering (Fowler et al., 1999). Taken together these data 327 indicate that mutation of GI delays flowering in both long and short photoperiods, and that mutation of 328 either the copies of GI on the A or B genome alone are without effect, or very weak. 329 Flowering time is a key determinant of yield in wheat (Hyles et al., 2020). To investigate if Ttgi-A3/gi-B3 330 had an effect on yield, we quantified yield traits and measured the yield of each plant (total seed weight) 331 grown in long or short photoperiods (Fig. 4C and 4D). Predicted loss of functional TtGI had a greater 332 effect on yield and yield traits under short photoperiods compared to long photoperiods. Under long 333 photoperiods, seed yield was not significantly different between the genotypes, the mean yield per Ttgi-334 A3/gi-B3 plant was 8.55 ± 0.39 g compared to 8.56 ± 0.41 g in Kronos. The mean yield of each individual 335 Kronos plant grown in short photoperiods (3.13 ± 0.64 g) was significantly greater than Ttgi-A3/gi-B3 336 (0.92 ± 0.27 g), and Ttgi-B3 (0.99 ± 0.24 g), however there were no differences in seed weight between 337 the WT segregant line (1.76 ± 0.30 g) and the double mutant (Fig. 4C). The mean yield of the WT 338 segregant line was lower than in Kronos, this could be due to the presence of the mutations load in this 339 line and that short photoperiod conditions are less favourable for optimal growth. Under long 340 photoperiods, height, number and length of the primary head, number and weight of seeds did not 341 significantly differ (Supplementary Fig S5). Under short photoperiod height, number of tillers and length 342 of the primary head, were not statistically different between any of the lines, however, total seed 343 number, seed weight and number of seeds of the primary head were substantially lower in Ttgi-A3/gi-344 B3, Ttgi-A3, Ttgi-B3 compared to Kronos (Supplementary Fig S6). 345 346 Lack of functional TtGI did not have large effects on heading date and yield traits in the field. 347 We had established that Ttgi-A3/gi-B3 had a late heading phenotype in long and short photoperiods in 348 controlled environment conditions. Next, we wished to determine if this effect was observed under field 349 conditions. Wheat is a commercial crop, and it was therefore important to understand if the heading 350 date phenotype seen in the laboratory was observable in the field, where interactions with the 351 environment are more complex. 352 GIGANTEA is required for circadian oscillations in wheat. We performed a small field trial at the NIAB experimental farm in Cambridge, UK in the 2021 field 353 season (environmental information in Supplementary Data). Plots of Kronos, WT segregant and single 354 A mutant were grown (Ttgi-A3); single B mutant was not available at the time of the trial. Five plants 355 per plot were tagged (six plots per genotype) and the date each plant reached GS55 was recorded. 356 Ttgi-A3/gi-B3 reached GS55 only one day later than Kronos (Ttgi-A3/gi-B3 67 days, Kronos 68 days), 357 while there was no difference in heading date between the double mutant and the WT segregant line 358 (Fig. 5A), which could be because of the presence of background mutations within in the WT segregant 359 affecting flowering time. Therefore, whilst Kronos is not optimised for growth in UK field conditions, we 360 found that if GI affects heading in the field, the effects are modest and possibly overridden by other 361 regulators of flowering time, particularly in a PPD-A1a background. The mean weight of seeds at 15% 362 grain moisture (Kg) per head gathered from Ttgi-A3/gi-B3 (1.45 ± 0.08) plants was not significantly 363 different to Kronos (1.69 ± 0.08), the single A mutant (1.54 ± 0.09), or WT segregant (1.51 ± 0.07) (Fig. 364 5B). After the plants had fully senesced, morphological traits were measured, and a representative head 365 was taken from each tagged plant (Supplementary Fig S7). 366 367 Expression of flowering genes in the Ttgi-A3/gi-B3 line. 368 Having shown that GI is required for robust circadian rhythms, and that TtGI is a mild inducer of 369 flowering in long and short photoperiods in a PPD-A1a background, we then characterized the effect of 370 loss of function of TtGI on the transcription profile of several flowering regulatory genes. The absence 371 of TtGI did not have a major effect on the expression of flowering genes at either the three-leaf stage 372 nor GS39 (Fig. 6). Expression of TtPPD-1 was measured using common primers for both sub-genome 373 and sub-genome specific primers. At the three-leaf growth stage, there were two peaks of TtPPD1 374 abundance at ZT 3h and 12h in both genotypes, however, the phase in Ttgi-A3/gi-B3 was delayed for 375 approximately 3 hours and the amplitude of transcript abundance was slightly lower than in Kronos (Fig. 376 6A). TtFT1 abundance was low in both Ttgi-A3/gi-B3 mutant and Kronos but there was some evidence 377 for loss of GI derepressing TtFT1 at night (Fig. 6D). There were no differences in TtCO1 and TtCO2 378 expression between Ttgi-A3/gi-B3 and Kronos (Fig. 6E-6F). Similar results were observed in growth 379 stage GS39, TtPPD1 amplitude was lower in the double mutant than in the Kronos line, phasing at the 380 same time in both genotypes (Fig. 6G). No differences were detected on the expression of TtFT1, 381 Taylor et al. 15 TtCO1 and TtCO2 between Ttgi-A3/gi-B3 and Kronos (Fig. 6F- 6H). Overall, our results show that 382 mutation of TtGI does not affect the expression of photoperiodic flowering genes in wheat, contrary to 383 Arabidopsis, indicating that there is functional diverge between the two species. 384 In Arabidopsis, the phytohormone gibberellin (GA) is essential for development processes including 385 flowering and its signalling pathway is modulated by GI (Nohales et al., 2019). We therefore investigated 386 whether it was the same case in wheat by analysing the expression of two genes involved in GA 387 biosynthesis (TtGA20ox2 and TtGID1). There were no differences in expression in either 3-leaf growth 388 stage or GS39, between the wild type and the mutant line for any of the genes analysed (Supplementary 389 Fig. S8). 390 391 TtGI sequence is conserved across modern wheat varieties 392 Our data indicate that whilst GI is required for robust circadian function, the effects on flowering in our 393 conditions and the PPD-A1a background were modest. Variation within loci can have profound effects 394 on the contribution of alleles to flowering, and so we investigated whether there was evidence for 395 variation at GI loci, that could indicate that GI allelic variation might have been selected for its direct or 396 epistatic interaction with other selected loci in other backgrounds and varieties. We identified GI 397 orthologues in genome sequenced wheat cultivars important in modern breeding efforts (Avni et al., 398 2017; Walkowiak et al., 2020) (Supplementary Table S1) by performing a BLAST search using the 399 IWGSC Ref Seq V1.1 TaGI homoeologues as a query sequences. We then created alignments between 400 GI from the different wheat cultivars and IWGSC Refseq V1.1 to investigate variation in GI. Remarkably 401 low levels of variation were observed in GI across the different wheat cultivars (Table 2). No variation 402 existed in the GI-D coding sequences. Two SNPs within GI-A coding sequences were identified in the 403 wild emmer tetraploid Zavitan, but not in any bread wheat cultivars. Five GI-B allele groups were 404 identified within all varieties. The maximum number of non-synonymous SNPs in the GI B allele group 405 was two. Thus, we found little variation in GI sequence at coding sequence level across modern wheat 406 cultivars which can be exploited by breeders to manipulate flowering time and other circadian output 407 traits. However, further research on non-coding sequences is needed. 408 409 Discussion 410 GIGANTEA is required for circadian oscillations in wheat. TtGI is required for robust circadian oscillations in wheat. 411 Wheat circadian oscillators are perturbed in lines with predicted lack function copies of TtGI. Ttgi-A3/gi-412 B3 lines have no detectable rhythms of NPQ or Fv/Fm in constant conditions. Similarly, circadian 413 oscillator transcript abundance lost robust oscillations in LL. Mutation of one GI homoeologue (Ttgi-A3 414 or Ttgi-B3) had no effect on the robustness of circadian rhythms in CF. This demonstrates that similar 415 to our previous findings concerning TtELF3, one homoeologue of a circadian oscillator gene is sufficient 416 to maintain robust circadian rhythms (Steed et al., 2021; Wittern et al., 2023). Due to differences in 417 expression of circadian oscillator gene homoeologues it has been proposed that one dominant 418 homoeologue performs the majority of the biological function in the circadian oscillator (Rees et al., 419 2022). We found that levels of transcription of both homoeologues was similar, however mutation of the 420 GI A homoeologue had a greater effect on circadian period than mutation of the B GI homoeologue. 421 In Arabidopsis, GI contributes to the daily rhythms in ZTL activity (Cha et al., 2017; Lee et al., 2019). 422 Wheat has two orthologous genes to Arabidopsis ZTL (Calixto et al., 2015), however it is unknown 423 whether the two wheat ZTL orthologs are functionally redundant in wheat circadian oscillators. In 424 Brachypodium, GI and ZTL interact in a yeast two hybrid screen (Hong et al., 2010). Further work is 425 required to confirm the role of GI and ZTL in wheat at the molecular level. 426 427 TtGI is a promoter of flowering in wheat 428 To investigate the role of GI in photoperiodic flowering, we measured GS55 and yield parameters in 429 long, short photoperiod and in field conditions. Our study focuses on flowering time regulation 430 independent of PPD-1-dependent pathways because the Ttgi-A3/gi-B3 mutant was generated in a 431 PPD-A1a photoperiod-insensitive background. This allowed us to investigate the role of GI independent 432 of PPD but does means we have not been able to study genetic interactions between GI and PPD-1. 433 In both long and short photoperiods, Ttgi-A3/gi-B3 headed later than Kronos but few differences were 434 observed in the field indicating that TtGI is a mild promoter of flowering in wheat, in a PPD-A1a 435 background. In Arabidopsis, GI and FKF1 complex during the light period only during long days, 436 promoting CO expression in a photoperiod dependent manner (Fowler et al., 1999; Sawa et al., 2007). 437 This mechanism, plus targeting of CO for degradation by COP1 in the dark, accelerates flowering in 438 Arabidopsis in long days and forms the molecular basis of the external coincidence model. 439 Taylor et al. 17 A core principle of the external coincidence model is that there are light sensitive and insensitive phases 440 of the flowering promoting rhythm (Bunning, 1960). This can be demonstrated experimentally by treating 441 plants with skeleton photoperiods (Thomas and Vince-Prue, 1997; Roden et al., 2002). Flowering 442 occurred earliest in wheat plants when the light period was applied in the middle of the night (Pearce et 443 al., 2017), thus demonstrating that there are rhythms in light sensitivity in the wheat flowering pathway. 444 The circadian clock in wheat forms a complex network involving the interactions of various proteins and 445 genes that regulations photoperiodic flowering. ELF3 acts as a mediator between the light signalling 446 pathway and flowering in wheat by binding to PhyB and PhyC. Moreover, in photoperiodic regulation of 447 flowering, ELF3 regulates PPD-1 by binding directly to its promoter and repressing its expression 448 (Alvarez et al., 2023). TtCO1/CO2 and TtPPD1 operate in two distinct but highly connected systems, 449 PPD-1 represses expression of CO1 affecting the expression of FT1 (Shaw et al., 2020). According to 450 our gene expression data TtGI does not promote the expression of TtCO1 and TtCO2 under long day 451 photoperiod which indicates that TtGI does not directly regulate CO1/2. However, a recent study in a 452 photoperiod-sensitive line of Kronos carrying a Ppd-A1b allele found that gi mutants increase TtCO2 453 expression and that CO1 and CO2 physically interact with GI in Y2H (Li et al., 2024). In a photoperiod-454 sensitive Ppd-A1b allele carrying line of Kronos gi mutants headed early with a strong interaction with 455 photoperiod (Li et al., 2024). Our data support the conclusion that GI has little effect on heading date in 456 a PPD-A1a background (Li et al., 2024). Taken together these data suggest that TtGI regulates TtCO1/2 457 through a PPD-1-dependent pathway and that GI might differentially regulate flowering in wheat and 458 Arabidopsis. 459 460 Conclusion 461 We find that reduction of GI function, reduces robustness of circadian oscillations but had little effect on 462 flowering time in a PPD-A1a photoperiod-insensitive background. This and the recent finding that gi 463 mutants affect flowering in PPD-A1b photoperiodic backgrounds (Li et al., 2024) suggest that if the 464 circadian oscillator and GI do contribute to photoperiodism in wheat, it is likely to be mostly dependent 465 on PPD1. 466 467 468 GIGANTEA is required for circadian oscillations in wheat. Autor contributions 469 Conceptualization: Alex Webb, Mathew Hannah. 470 Data Curation: Laura Taylor, Gareth Steed, Lukas Wittern, Gabriela Pingarron-Cardenas 471 Formal analysis: Laura Taylor, Gareth Steed, Lukas Wittern, Gabriela Pingarron-Cardenas 472 Funding Acquisition: Alex Webb 473 Investigation: Alex Webb, Mathew Hannah, Laura Taylor, Gareth Steed, Lukas Wittern, Gabriela 474 Pingarron-Cardenas 475 Methodology: Laura Taylor, Gareth Steed, Lukas Wittern, Gabriela Pingarron-Cardenas 476 Project administration: Alex Webb, Matthew Hannah 477 Supervision: Alex Webb 478 Validation: Gabriela Pingarron-Cardenas 479 Visualization: Laura Taylor, Gareth Steed, Lukas Wittern, Gabriela Pingarron-Cardenas 480 Writing – original draft: Laura Taylor, Gareth Steed, Gabriela Pingarron-Cardenas 481 Writing – review & editing: Alex Webb, Mathew Hannah 482 483 Conflict of interest 484 Mathew Hannah is an employee of BASF. The authors declare no other competing interests. 485 Funding 486 The work described in this manuscript were supported by UKRI BBSRC grants BB/M011194/1, 487 BB/M015416/1, and BB/K011790/1 awarded to M.A.H. and A.A.R.W. GP-C is supported by UKRI 488 BBSRC grant BB/W001209/1 awarded to A.A.R.W. 489 Data availability 490 The data described in this study are available at https://doi.org/10.17863/CAM.107919 491 Acknowledgements 492 https://doi.org/10.17863/CAM.107919 Taylor et al. 19 We are indebted to Andy Greenland, Keith Gardner, Alison Bentley and other colleagues at NIAB for 493 their support of PhD projects linked to this work. In particular, Richard Horsnell, NIAB for his assistance 494 in growing and crossing of TILLING lines and the field team at NIAB for drilling, harvest and agronomy 495 of TtGI field trial. We thank Cristobal Uauy for pre-publication access to the Kronos TILLING data and 496 lines. 497 498 References 499 Adams S, Manfield I, Stockley P, Carré IA. 2015. Revised Morning Loops of the Arabidopsis 500 Circadian Clock Based on Analyses of Direct Regulatory Interactions. (NS Foulkes, Ed.). PLOS ONE 501 10, e0143943. 502 Airoldi CA, Hearn TJ, Brockington SF, Webb AAR, Glover BJ. 2019. TTG1 proteins regulate 503 circadian activity as well as epidermal cell fate and pigmentation. Nature Plants 5, 1145–1153. 504 Alvarez MA, Li C, Lin H, Joe A, Padilla M, Woods DP, Dubcovsky J. 2023. EARLY FLOWERING 3 505 interactions with PHYTOCHROME B and PHOTOPERIOD1 are critical for the photoperiodic 506 regulation of wheat heading time. PLoS genetics 19, e1010655. 507 Avni R, Nave M, Barad O, et al. 2017. Wild emmer genome architecture and diversity elucidate 508 wheat evolution and domestication. Science (New York, N.Y.) 357, 93–97. 509 Beales J, Turner A, Griffiths S, Snape JW, Laurie DA. 2007. A Pseudo-Response Regulator is 510 misexpressed in the photoperiod insensitive Ppd-D1a mutant of wheat (Triticum aestivum L.). 511 Theoretical and Applied Genetics 115, 721–733. 512 Borrill P, Ramirez-Gonzalez R, Uauy C. 2016. expVIP: a Customizable RNA-seq Data Analysis and 513 Visualization Platform. Plant Physiology 170, 2172–2186. 514 Bunning E. 1960. Circadian Rhythms and the Time Measurement in Photoperiodism. Cold Spring 515 Harbor Symposia on Quantitative Biology 25, 249–256. 516 Calixto CPG, Waugh R, Brown JWS. 2015. Evolutionary Relationships Among Barley and 517 Arabidopsis Core Circadian Clock and Clock-Associated Genes. Journal of Molecular Evolution 80, 518 108–119. 519 Cha J-Y, Kim J, Kim T-S, Zeng Q, Wang L, Lee SY, Kim W-Y, Somers DE. 2017. GIGANTEA is a 520 co-chaperone which facilitates maturation of ZEITLUPE in the Arabidopsis circadian clock. Nature 521 Communications 8, 3. 522 Corbesier L, Vincent C, Jang S, et al. 2007. FT Protein Movement Contributes to Long-Distance 523 Signaling in Floral Induction of Arabidopsis. Science 316, 1030–1033. 524 Dakhiya Y, Green RM. 2019. Thermal imaging as a noninvasive technique for analyzing circadian 525 rhythms in plants. The New Phytologist 224, 1685–1696. 526 Dixon LE, Knox K, Kozma-Bognar L, Southern MM, Pokhilko A, Millar AJ. 2011. Temporal 527 Repression of Core Circadian Genes Is Mediated through EARLY FLOWERING 3 in Arabidopsis. 528 Current Biology 21, 120–125. 529 GIGANTEA is required for circadian oscillations in wheat. Dunford RP, Griffiths S, Christodoulou V, Laurie DA. 2005. Characterisation of a barley (Hordeum 530 vulgare L.) homologue of the Arabidopsis flowering time regulator GIGANTEA. Theoretical and 531 Applied Genetics 110, 925–931. 532 Fornara F, Panigrahi KCS, Gissot L, Sauerbrunn N, Rühl M, Jarillo JA, Coupland G. 2009. 533 Arabidopsis DOF Transcription Factors Act Redundantly to Reduce CONSTANS Expression and Are 534 Essential for a Photoperiodic Flowering Response. Developmental Cell 17, 75–86. 535 Fowler S, Lee K, Onouchi H, Samach A, Richardson K, Morris B, Coupland G, Putterill J. 1999. 536 GIGANTEA: a circadian clock-controlled gene that regulates photoperiodic flowering in Arabidopsis 537 and encodes a protein with several possible membrane-spanning domains. The EMBO journal 18, 538 4679–4688. 539 Harmer SL, Hogenesch JB, Straume M, Chang H-S, Han B, Zhu T, Wang X, Kreps JA, Kay SA. 540 2000. Orchestrated Transcription of Key Pathways in Arabidopsis by the Circadian Clock. Science 541 290, 2110–2113. 542 Helfer A, Nusinow DA, Chow BY, Gehrke AR, Bulyk ML, Kay SA. 2011. LUX ARRHYTHMO 543 Encodes a Nighttime Repressor of Circadian Gene Expression in the Arabidopsis Core Clock. Current 544 Biology 21, 126–133. 545 Hong S-Y, Lee S, Seo PJ, Yang M-S, Park C-M. 2010. Identification and molecular characterization 546 of a Brachypodium distachyon GIGANTEA gene: functional conservation in monocot and dicot plants. 547 Plant Molecular Biology 72, 485–497. 548 Hsu PY, Harmer SL. 2014. Wheels within wheels: the plant circadian system. Trends in Plant 549 Science 19, 240–249. 550 Hyles J, Bloomfield MT, Hunt JR, Trethowan RM, Trevaskis B. 2020. Phenology and related traits 551 for wheat adaptation. Heredity 125, 417–430. 552 Imaizumi T, Tran HG, Swartz TE, Briggs WR, Kay SA. 2003. FKF1 is essential for photoperiodic-553 specific light signalling in Arabidopsis. Nature 426, 302–306. 554 Krasileva KV, Vasquez-Gross HA, Howell T, et al. 2017. Uncovering hidden variation in polyploid 555 wheat. Proceedings of the National Academy of Sciences 114. 556 Lee C-M, Li M-W, Feke A, Liu W, Saffer AM, Gendron JM. 2019. GIGANTEA recruits the UBP12 557 and UBP13 deubiquitylases to regulate accumulation of the ZTL photoreceptor complex. Nature 558 Communications 10, 3750. 559 Li C, Lin H, Debernardi JM, Zhang C, Dubcovsky J. 2024. GIGANTEA accelerates wheat heading 560 time through gene interactions converging on FLOWERING LOCUS T1. The Plant Journal: For Cell 561 and Molecular Biology doi: 10.1111/tpj.16622. 562 McClung CR. 2021. Circadian Clock Components Offer Targets for Crop Domestication and 563 Improvement. Genes 12, 374. 564 Mizoguchi T, Wright L, Fujiwara S, et al. 2005. Distinct Roles of GIGANTEA in Promoting Flowering 565 and Regulating Circadian Rhythms in Arabidopsis. The Plant Cell 17, 2255–2270. 566 Nakamichi N, Kiba T, Henriques R, Mizuno T, Chua N-H, Sakakibara H. 2010. PSEUDO-567 RESPONSE REGULATORS 9, 7, and 5 Are Transcriptional Repressors in the Arabidopsis Circadian 568 Clock. The Plant Cell 22, 594–605. 569 Nohales MA, Liu W, Duffy T, Nozue K, Sawa M, Pruneda-Paz JL, Maloof JN, Jacobsen SE, Kay 570 SA. 2019. Multi-level Modulation of Light Signaling by GIGANTEA Regulates Both the Output and 571 Pace of the Circadian Clock. Developmental Cell 49, 840-851.e8. 572 Taylor et al. 21 Nusinow DA, Helfer A, Hamilton EE, King JJ, Imaizumi T, Schultz TF, Farré EM, Kay SA. 2011. 573 The ELF4–ELF3–LUX complex links the circadian clock to diurnal control of hypocotyl growth. Nature 574 475, 398–402. 575 Nyikó T, Kerényi F, Szabadkai L, et al. 2013. Plant nonsense-mediated mRNA decay is controlled 576 by different autoregulatory circuits and can be induced by an EJC-like complex. Nucleic Acids 577 Research 41, 6715–6728. 578 Park DH, Somers DE, Kim YS, Choy YH, Lim HK, Soh MS, Kim HJ, Kay SA, Nam HG. 1999. 579 Control of circadian rhythms and photoperiodic flowering by the Arabidopsis GIGANTEA gene. 580 Science (New York, N.Y.) 285, 1579–1582. 581 Pearce S, Shaw LM, Lin H, Cotter JD, Li C, Dubcovsky J. 2017. Night-Break Experiments Shed 582 Light on the Photoperiod1-Mediated Flowering. Plant Physiology 174, 1139–1150. 583 Pittendrigh CS, Minis DH. 1964. The Entrainment of Circadian Oscillations by Light and Their Role 584 as Photoperiodic Clocks. The American Naturalist 98, 261–294. 585 Rawat R, Takahashi N, Hsu PY, Jones MA, Schwartz J, Salemi MR, Phinney BS, Harmer SL. 586 2011. REVEILLE8 and PSEUDO-REPONSE REGULATOR5 Form a Negative Feedback Loop within 587 the Arabidopsis Circadian Clock. (GP Copenhaver, Ed.). PLoS Genetics 7, e1001350. 588 Rees H, Rusholme-Pilcher R, Bailey P, et al. 2022. Circadian regulation of the transcriptome in a 589 complex polyploid crop. PLoS biology 20, e3001802. 590 Roden LC, Song H-R, Jackson S, Morris K, Carre IA. 2002. Floral responses to photoperiod are 591 correlated with the timing of rhythmic expression relative to dawn and dusk in Arabidopsis. 592 Proceedings of the National Academy of Sciences 99, 13313–13318. 593 Rousset M, Bonnin I, Remoué C, et al. 2011. Deciphering the genetics of flowering time by an 594 association study on candidate genes in bread wheat (Triticum aestivum L.). Theoretical and Applied 595 Genetics 123, 907–926. 596 Sawa M, Nusinow DA, Kay SA, Imaizumi T. 2007. FKF1 and GIGANTEA Complex Formation Is 597 Required for Day-Length Measurement in Arabidopsis. Science 318, 261–265. 598 Shaw LM, Li C, Woods DP, Alvarez MA, Lin H, Lau MY, Chen A, Dubcovsky J. 2020. Epistatic 599 interactions between PHOTOPERIOD1, CONSTANS1 and CONSTANS2 modulate the photoperiodic 600 response in wheat. (S Hake, Ed.). PLOS Genetics 16, e1008812. 601 Steed G, Ramirez DC, Hannah MA, Webb AAR. 2021. Chronoculture, harnessing the circadian 602 clock to improve crop yield and sustainability. Science 372, eabc9141. 603 Suárez-López P, Wheatley K, Robson F, Onouchi H, Valverde F, Coupland G. 2001. CONSTANS 604 mediates between the circadian clock and the control of flowering in Arabidopsis. Nature 410, 1116–605 1120. 606 Thomas B, Vince-Prue D. 1997. Photoperiodism in plants. San Diego: Academic Press. 607 Turner A, Beales J, Faure S, Dunford RP, Laurie DA. 2005. The Pseudo-Response Regulator Ppd-608 H1 Provides Adaptation to Photoperiod in Barley. Science 310, 1031–1034. 609 Valverde F, Mouradov A, Soppe W, Ravenscroft D, Samach A, Coupland G. 2004. Photoreceptor 610 Regulation of CONSTANS Protein in Photoperiodic Flowering. Science 303, 1003–1006. 611 Walkowiak S, Gao L, Monat C, et al. 2020. Multiple wheat genomes reveal global variation in 612 modern breeding. Nature 588, 277–283. 613 GIGANTEA is required for circadian oscillations in wheat. Wilhelm EP, Turner AS, Laurie DA. 2009. Photoperiod insensitive Ppd-A1a mutations in tetraploid 614 wheat (Triticum durum Desf.). Theoretical and Applied Genetics 118, 285–294. 615 Wittern L, Steed G, Taylor LJ, Ramirez DC, Pingarron-Cardenas G, Gardner K, Greenland A, 616 Hannah MA, Webb AAR. 2023. Wheat EARLY FLOWERING 3 affects heading date without 617 disrupting circadian oscillations. Plant Physiology 191, 1383–1403. 618 Xie Q, Wang P, Liu X, et al. 2014. LNK1 and LNK2 Are Transcriptional Coactivators in the 619 Arabidopsis Circadian Oscillator. The Plant Cell 26, 2843–2857. 620 Zadoks JC, Chang TT, Konzak CF. 1974. A decimal code for the growth stages of cereals. Weed 621 Research 14, 415–421. 622 Zhao XY, Liu MS, Li JR, Guan CM, Zhang XS. 2005. The wheat TaGI1, involved in photoperiodic 623 flowering, encodesan Arabidopsis GI ortholog. Plant Molecular Biology 58, 53–64. 624 Zielinski T, Moore AM, Troup E, Halliday KJ, Millar AJ. 2014. Strengths and Limitations of Period 625 Estimation Methods for Circadian Data. (S Yamazaki, Ed.). PLoS ONE 9, e96462. 626 627 Table Legends 628 Table 1. Primers used in this study. 629 Table 2. GI sequence is conserved across modern wheat varieties. Total number of SNPs within 630 the CDS of GI across cultivars important in modern breeding efforts. A SNP was recorded if the base 631 was different to IWGSC RefSeqv1.1. SNPs within the same codon were recorded individually. NS = 632 non-synonymous SNP, S= synonymous SNP. Allele groups are indicated by colour. Cultivars were 633 considered to share the same allele if the CDS were identical. Zativan is a tetraploid variety and so 634 lacks a D subgenome. Claire GI B analysis was not included due to poor sequence quality. 635 Figure legends 636 Fig. 1. Location of TILLING mutations in the GI-A3 and GI-B3 homeologues. Location of premature 637 stop codons (coloured bars) in (A) GI-A3 and (B) GI-B3 homoeologues (showing their respective splice 638 variants, genetic alterations resulting in an altered coding sequence). Bars represent exons with black 639 and white showing those that are translated and untranslated, respectively. Kronos2019 and 640 Kronos2205 are the original TILLING lines obtained from the GRU. Schematic was adapted from 641 EnsemblPlants database. 642 643 Fig. 2. Functional TtGI is necessary for maintaining robust circadian rhythms in chlorophyll 644 fluorescence. Mean of NPQ (± SEM, represented by the shaded ribbon) of Kronos (A), WT segregant 645 Taylor et al. 23 (B), Ttgi-B3 (C), Ttgi-A3 (D) and Ttgi-A3/gi-B3 (E) leaf fragments in constant light (n = > 10). White bars 646 represent the subjective day and grey bars represent the subjective night. (F) Circadian period (hours). 647 (G) Relative Error of Amplitude (RAE). A RAE value above 0.5 (indicated by the dashed line) is 648 considered arrhythmic. Period and RAE were calculated using Biodare2 for the CF parameter NPQ. 649 Significant differences (P < 0.05) calculated in R using the Kruskal–Wallis test followed by post-hoc 650 Dunn’s test. 651 Fig. 3. Functional TtGI is required for persistence of robust oscillations of circadian oscillator 652 transcript abundance in continuous light. (A–G) \Mean abundance (± SEM, represented by the 653 shaded ribbon) of circadian oscillator transcripts (n = 3-5) in Ttgi-A3/gi-B3 (yellow) and Kronos WT 654 (black). Transcript abundance (ΔΔCq) is relative to TtRP15 and TtRPT5A, (A) TtLHY, (B) TtTOC1, (C) 655 TtPRR73, (D) TtPPD1, (E) TtELF3, (F) TtLUX, and (G) TtGI. Orange stars indicate the peak of first true 656 circadian cycle in LL in Ttgi-A3/gi-B3. White bars represent light, dark grey bars represent darkness in 657 the last cycle before release into constant light. Light grey bars represent subjective night in constant 658 light. 659 Fig. 4. Flowering time is delayed in Ttgi-A3/gi-B3 in long- and short-photoperiods. Ttgi-A3/gi-B3, 660 Ttgi-A3, Ttgi-B3, WT segregant and Kronos were grown in long photoperiod (LD, 16 h light at 250 µmol 661 m−2 s−1 , 20°C: 8 h dark 16°C) and short photoperiod (LD, 8 h light at 250 µmol m−2 s−1, 20°C: 16 h dark 662 16°C). GS55 is used as reference for heading date and defined as days after sowing (DAS). (A) GS55 663 in long photoperiod (n = 12). (B) GS55 in short photoperiod (n=8). (C) Yield (total seed weight) under 664 long photoperiod (n = 12). (D) Yield (total seed weight) under short photoperiod (n = 8). Upper and 665 lower hinges represent the first and third quartiles (25th and 75th percentiles), the middle hinge 666 represents the median value, whiskers represent the third quartile + 1.5*interquartile range (IQR) and 667 the first quartile – 1.5*IQR, each dot represent individual replicates. Significant differences in heading 668 date were tested using a Kruskal Wallis test followed by a post hoc Dunn test, and yield differences 669 were tested using one-way ANOVA followed by Tukey’s test. The letters within each panel indicate 670 statistical difference, samples that share the same letter in that experiment are not significantly different. 671 Figure 5. Mutations of single TtGI homologues and double mutant have no effect on flowering 672 time in the field and yield. Kronos, WT segregant, Ttgi-A3 and Ttgi-A3/gi-B3 were grown in the field 673 at NIAB experimental farm in the 2021 field season. (A) Heading date as defined as days after sowing 674 to reach GS55. Data was pooled for all tagged plants of each genotype (n = 30). Significant differences 675 GIGANTEA is required for circadian oscillations in wheat. in heading date were tested using a Kruskal Wallis test followed by a post hoc Dunn test. (B) Yield at 676 15% grain moisture in representative heads in each genotype grown in the field (n = 6). Each jitter point 677 represents the total yield of an individual plot. Upper and lower hinges represent the first and third 678 quartiles (25th and 75th percentiles), the middle hinge represents the median value, whiskers represent 679 the third quartile + 1.5*interquartile range (IQR) and the first quartile – 1.5*IQR, each dot represent 680 individual replicates. Significant differences in heading date were tested using a Kruskal Wallis test 681 followed by a post hoc Dunn test, and yield differences were tested using one-way ANOVA followed by 682 Tukey’s test. Significant differences in yield were tested using ONE-WAY Anova followed by Tukey’s 683 test. The letters within each panel indicate statistical difference, samples that share the same letter in 684 that experiment are not significantly different. 685 Figure 6. Loss of function of TtGI did not affect the abundance of flowering transcripts. Transcript 686 abundance (mean ± SEM, represented by the shaded ribbon) of wheat genes involved in flowering in 687 Ttgi-A3/gi-B3 (yellow, n = 4-5) and Kronos WT (black, n = 4-5) grown under long day (16 h light at 250 688 µmol m−2 s−1, 20°C: 8 h dark 16°C). Once plants reached the 3-leaf stage or GS39, sampling of the first 689 true leaf commenced at time 0 to 24 hours, every 3 hours. White bars represent light and grey bars 690 represent darkness. (A-F) Mean abundance of flowering transcript at the 3-leaf growth stage. (G-L) 691 Mean abundance of flowering transcripts at the GS39 growth stage. Transcript abundance (ΔΔCq) is 692 relative to TtRP15 and TtRPT5A, (A-G) TtPPD1, (B-H) TtPPD1-A, (C-I) TtPPD1-B, (D-J) TtCO1, (E-K) 693 TtCO2 and (F-L) TtFT1 694 695 Supplementary data 696 Supplementary Figure S1. The expression of TtGI is consistent across both subgenomes with no 697 significant differences between the wild type genotypes and the double mutant. Ttgi-A3, Ttgi-B3, Ttgi-698 A3/gi-B3, Kronos and WT segregant (n = 4-5) grown under long day (16 h light at 250 µmol m−2 s−1, 699 20°C: 8 h dark 16°C). Expression of TtGI was measured relative to TtRPT5A and Ta22845 at ZT12 and 700 ZT15 (mean ± SEM). The letters within the panel indicate statistical difference, samples that share the 701 same letter in that experiment are not significantly different. 702 Supplementary Figure S2. Isolation of TILLING mutants in tetraploid wheat. Crossing scheme for the 703 creation of Ttgi single mutants (A), single mutant Ttgi-A3 and (B) single mutant Ttgi-B3. Wild type gene 704 Taylor et al. 25 is designated by a capital letter and mutated gene with lower letter. The TILLING lines GI Kronos2019 705 and Kronos2205 were crossed with Kronos background (F1). Four rounds of back crossing were 706 completed and plants heterozygous (Aa/Bb) for the mutation selected. BC4 F1 was self-crossed to 707 obtain BC4 F2, which was self-crossed again. Homozygous plants (aa and bb) for the mutation selected 708 for single subgenome genotype (Ttgi-A3 and Ttgi-B3, respectively) were selected. The single mutants 709 were crossed (BC4 F4) and the progeny was self-crossed. From which the double mutants and 710 background segregants Ttgi-A3/gi-B3 [aabb], WT segregant [AABB]) were selected. 711 Supplementary Figure S3. Overview of the field trial used to evaluate TtGI lines. A) Photograph of trial 712 at NIAB Barr Hill field site, Cambridge, U.K). Plots of Kronos GI lines (awned) and Paragon controls (no 713 awns) were flanked by Paragon plots to separate the GI experiment from other trials. B) Layout of trial 714 for 2021 field season. Six plots of each genotype were drilled in a randomized block design (Paragon 715 was not used for this analysis). Each genotype featured once in each row and a maximum of twice in 716 each column. 717 Supplementary Figure S4. The chlorophyll a parameter, Fv/Fm is also arrhythmic in Ttgi-A3/gi-B3 in 718 constant conditions (light and temperature) supporting data from NPQ parameter (Figure 2). Mean of 719 Fv/Fm (± SEM) of Kronos (A), WT Segregant (B), Ttgi-B3 (C), Ttgi-A3 (D) and Ttgi-A3/gi-B3 (E) (n= > 720 10). White bars represent the subjective day and grey bars represent the subjective night. (F) Circadian 721 period length (hours). (G) Relative Error of Amplitude (RAE). A RAE value above 0.5 (indicated by the 722 dashed line) is considered arrhythmic. Period and RAE of Fv/Fm were calculated using Biodare2. 723 Significant differences (P< 0.05) calculated in R using the Kruskal–Walli's test followed by post-hoc 724 Dunn’s test. (F) and (G) the letters within each panel indicate statistical difference, samples that share 725 the same letter in that experiment are not significantly different. 726 Supplementary Figure S5. TtGI lines and Kronos produced equivalent yields in controlled long 727 photoperiod. Kronos, WT segregant, Ttgi-A3, Ttgi-B3 and Ttgi-A3/gi-B3 plants were grown under long 728 photoperiod (LD, 16 h light at 250 µmol m−2 s−1, 20°C: 8 h dark 16°C). (A) Plant length. (B) Number of 729 tillers. (C) Length of the primary head. (D) Number of seeds per primary head. (E) Weight of seeds 730 produced by the primary head. (F) Total number of seeds produced by each plant. Each jitter point 731 represents an individual plant (n = 12). Significant differences were tested for using either an ANOVA 732 with a post hoc Tukey test (plant height, primary head length, weight of seeds) or Kruskal Wallis with a 733 GIGANTEA is required for circadian oscillations in wheat. post hoc Dunn test (tiller number, seed number). The letters within each panel indicate statistical 734 difference, samples that share the same letter in that experiment are not significantly different. 735 Supplementary Figure S6. Morphological traits were broadly similar between GI lines and Kronos 736 plants. Absence of a functional TtGI had a significantly reduced yield in controlled short photoperiod 737 compared to Kronos. Kronos, WT segregant, Ttgi-A3, Ttgi-B3 and Ttgi-A3/gi-B3 plants were grown 738 under short photoperiod (SD, 8 h light at 250 µmol m−2 s−1, 20°16: 16 h dark 16°C). (A) Plant length. 739 (B) Number of tillers. (C) Length of the primary head. (D) Number of seeds per primary head. (E) Weight 740 of seeds produced by the primary head. (F) Total number of seeds produced by each plant. Each jitter 741 point represents an individual plant (n = 8). Significant differences were tested for using either an 742 ANOVA with a post hoc Tukey test (plant height, primary head length, weight of seeds) or Kruskal 743 Walli's with a post hoc Dunn's test (tiller number, seed number). The letters within each panel indicate 744 statistical difference, samples that share the same letter in that experiment are not significantly different. 745 Supplementary Figure S7. Morphological and yield traits were similar between the TtGI lines and 746 Kronos in field conditions. Kronos, WT segregant, Ttgi-A3, Ttgi-B3 and Ttgi-A3/gi-B3 plants were grown 747 in NIAB experimental farm during the 2020 field season. (A) Height. (B) Length of primary head. (C) 748 Number of seeds of representative head. (D) Mean weight of seeds of representative head per plot. 749 Significant differences were tested for using either an ANOVA with a post hoc Tukey test (plant height, 750 primary head length, weight of seeds) or Kruskal Wallis with a post hoc Dunn test (seed number). The 751 letters within each panel indicate statistical difference, samples that share the same letter in that 752 experiment are not significantly different. 753 Supplementary Figure S8. Mutation of function of TtGI did not affect the abundance of transcripts 754 expression of genes involved in gibberellin synthesis. Ttgi-A3/gi-B3 (yellow, n = 4-5) and Kronos WT 755 (black, n= 4-5) grown under long day (16 h light at 250 µmol m−2 s−1, 20°C: 8 h dark 16°C). Once 756 plants reached 3-leaves or GS39, sampling of the first true leaf commenced at time 0 to 24 hours every 757 3 hours. White bars represent light and black bars represent darkness. (A-F) Mean abundance (± SEM, 758 represented by the shaded ribbon) of flowering at the 3-leaf growth stage. (G-L) Mean abundance (± 759 SEM, represented by the shaded ribbon) of flowering at the GS39 growth stage. Transcript abundance 760 (ΔΔCq) is relative to TtRP15 and TtRPT5A, (A-C) TtGID1, (B-D) TtGA20ox2 761 Taylor et al. 27 Supplementary Table S1. Wheat genome sequences sequenced by the wheat community (Avni et al., 762 2017; Walkowiak et al., 2020). Zativan (wild emmer, T. turgidum sub spp. dicoccoides) sequence 763 available from Avni et al. 2017. All other sequences available from www.10wheatgenomes.com 764 sequence portal and Ensembl Plants. Information for this table was gathered from 765 www.10wheatgenomes.com and Adamski et al., 2020. S= spring, F= facultative and W= winter growth 766 habit. 767 Supplementary Table S2. Ttgi-A3/gi-B3 is arrhythmic for chlorophyll a fluorescence. Ttgi-A3/gi-B3 is 768 arrhythmic for chlorophyll a fluorescence. Period and RAE (Average ± SEM) of NPQ and Fv/Fm 769 calculated using Biodare2 from Kronos, WT segregant, Ttgi-B3, Ttgi-A3 and Ttgi-A3/gi-B3 leaf 770 fragments in constant light (n = > 10). A RAE value above 0.5 is considered arrhythmic. 771 772 Figure 1 TtGI-A3.1 Kronos2205 (G/A) TtGI-B3.1 TtGI-B3.2 TtGI-B3.3 Kronos2019 (C/T) TtGI-A3.2 A) B) Figure 2 24 36 48 60 72 84 96 Time in hours (h) 24 36 48 60 72 84 96 Time in hours (h) 24 36 48 60 72 84 96 Time in hours (h) 24 36 48 60 72 84 96 Time in hours (h) 24 36 48 60 72 84 96 Time in hours (h) 0.26 0.24 0.22 0.20 0.18 0.16 0.14 N PQ N PQ Pe rio d (h ) R AE Kronos A) WT segregant B) 0.26 0.24 0.22 0.20 0.18 0.16 0.14 0.26 0.24 0.22 0.20 0.18 0.16 0.14 Ttgi-B3 Ttgi-A3 C) D) E) 0.26 0.24 0.22 0.20 0.18 0.16 0.14 Ttgi3A/gi-B3 a bb a b F) a b bcc bc Kronos WT segregant Ttgi-B3 Ttgi-A3 Ttgi-A3/gi-B3 Kronos WT segregant Ttgi-B3 Ttgi-A3 Ttgi-A3/gi-B3 G) 26 1.00 0.75 0.50 0.25 24 22 20 18 0.26 0.24 0.22 0.20 0.18 0.16 0.14 0 16.5 9 9 7.5 6 9 6 TtTOC1 TtPRR73 TtPPD-1 TtGI TtLUX TtELF3 Gene BH.Q Phase Amplitude Kronos Ttgi-A3-gi-B3 2.38E-09 7.70E-05 2.62E-07 0.5670 9.51E-09 1.72E-06 2.71E-04 2.34E-04 1.40E-03 2.34E-04 2.34E-04 0.088 1 0.1509 TtLHY TtTOC1 TtPRR73 TtPPD-1 TtGI TtLUX TtELF3 TtLHY 6 1.756 0.594 0.281 0.070 0.765 0.259 0.079 0.452 0.446 0.186 0.299 0.255 0.135 0.140 16.5 7.5 9 13.5 15 Kronos Ttgi-A3/gi-B3 6 5 4 3 2 1 0 12 24 36 48 60 72 84 96 TtTOC1 ZT (h) 2 1.5 1.0 0.5 TtLUX 0 12 24 36 48 60 72 84 96 ZT (h) 2.5 2.0 1.5 1.0 0.5 TtPPD1 0 12 24 36 48 60 72 84 96 ZT (h) 10 7.5 5 2.5 TtLHY 0 12 24 36 48 60 72 84 96 ZT (h) Tr an sc rip t A bu nd an ce 2.5 2.0 1.5 1.0 0.5 TtPRR73 0 12 24 36 48 60 72 84 96 ZT (h) Tr an sc rip t A bu nd an ce 4 3 2 1 TtGI 120 24 36 48 60 72 84 96 ZT (h) Tr an sc rip t A bu nd an ce 2.0 TtELF3 0 12 24 36 48 60 72 84 96 ZT (h) Tr an sc rip t A bu nd an ce 1.5 1.0 0.5 A) B) G) H) C) D) E) F) a bb c b aa a aa a ab ab b b a aa a a LD SD G S5 5 (D AS ) Yi el d (g ) 60 9 6 4 2 0 6 3 0 105 100 95 90 85 80 57 54 51 Kronos WT segregant Ttgi-B3 Ttgi-A3 Ttgi-A3/gi-B3 Kronos WT segregant Ttgi-B3 Ttgi-A3 Ttgi-A3/gi-B3 A) B) C) D) a aab b a a abb Field Field G S5 5 (D AS ) 72 25 22.5 20 17.5 15 70 68 66 64 Kronos WT segregant Ttgi-A3 Ttgi-A3/gi-B3 Kronos WT segregant Ttgi-3A Ttgi-A3/gi-B3 A) B) Kronos Ttgi-A3/gi-B3 0.5 0.4 0.3 0.2 0.1 0.8 1.5 1.0 0.5 0.6 0.4 0.2 TtPPD1 TtPPD1 0 3 6 9 12 15 18 21 24 ZT (h) 0.20 0.25 0.10 TtCO1 TtCO1 0 3 6 9 12 15 18 21 24 ZT (h) 0.05 0.04 0.03 0.02 0.01 0.05 0.04 0.03 0.02 0.01 0.08 0.06 0.04 0.02 TtCO2 TtCO2 0 3 6 9 12 15 18 21 24 ZT (h) 0 3 6 9 12 15 18 21 24 ZT (h) 0.5 0.4 0.3 0.2 0.1 TtPPD-A1 TtPPD-A1 0 3 6 9 12 15 18 21 24 ZT (h) 2 1.5 1 0.5 TtPPD-B1 TtPPD-B1 0 3 6 9 12 15 18 21 24 ZT (h) Tr an sc rip t A bu nd an ce 3 le av es G S3 9 0.20 0.15 0.10 0.05 1.25 7.25 5 2.5 1.00 0.75 0.50 0.25 0.25 TtFT1 TtFT1 0 3 6 9 12 15 18 21 24 ZT (h) 0 3 6 9 12 15 18 21 24 ZT (h) 0 3 6 9 12 15 18 21 24 ZT (h) 0 3 6 9 12 15 18 21 24 ZT (h) 0 3 6 9 12 15 18 21 24 ZT (h) 0 3 6 9 12 15 18 21 24 ZT (h) Tr an sc rip t A bu nd an ce Tr an sc rip t A bu nd an ce Tr an sc rip t A bu nd an ce A) B) G) H) I) J) K) L) C) D) E) F) Figure 5 Figure 6 Figure 3 Figure 4 Gene Sequence 5' - 3' TtLHY F: CCTGGAATTGGAGATGGAGA R: TGAGCATGGCTTCTGATTTG TtELF3 F: TCTCCAGATGATGTTGTCGGT R: CTCGAACACTTGGACAGCAAA TtFT1 F: TGAGGACCTTCTACACACTCG R: ACCGGGGATATCTGTCACAAG TtGI F: GGTAGGTGATAGACGGCACTT R: GTGCTACAGATGGGATGCTTG TtLUX F: ACAAGCGGTTCGTGGAGG R: CCTGCATCCGCTTGACGTA TtPpd-1 F: CCTGTGGACTGTCGATCTCAA R: CAAGGGATGGCAGCGATAATG TtPRR73 F: TCCCGAAGTTCCTCTCTTTCC R: AGCGGTAGTGGCAATGACA TtTOC1 F: GGCATGGCACTTCATTCAGTT R: GCACATTCATACCAGCAGGAC TtGID1 Li F: GGAGGAGGGGATCAAGATACAC R: CGATCTCCTCCATCACCTCG F: CTACGAGCCAATGGGGAG R: CCAGCAGCTCCATGATCCT TtGA20ox2 TtRP15 F: GCACACGTGCTTTGCAGATAAG R: GCCCTCAAGCTCAACCATAACT TtRPT5A F: GCTGGCTCGTTCAACTGATG R: GGACCAAGCGTTCTGATTACTC Ta22845 F: GCTGGCTCGTTCAACTGATG R: GGACCAAGCGTTCTGATTACTC TtGI F: GCTCTGGCATAAGCTTATTGCA R: TTCGCTGGTTGACTCTCCAC Table 1 DBASubgenome snssnssnsCultivar 003200Arina 002200CDC Stanley 003200Landmark 003200Cadenza 00NANA00Claire 003200Jagger 003200Julius 003200Lancer 002200Norin 61 003200Mace 001000P190962 003100Paragon 003100Robigus 003200SY Mattis 005111Zavitan 00402311Total No. SNPs 162Total No. alleles Table 2 Ttgi-A3 Ttgi-A3/gi-B3Ttgi-B3Kronos WT segregant Block/Column A) B) 1 2 3 4 5 1 Kronos Ttgi-A1 Ttgi-A1 Ttgi-A1 Ttgi-A1 Ttgi-A1 Ttgi-A1 Paragon 2 Ttgi-A1/Ttgi-B1 Ttgi-A1/Ttgi-B1 Ttgi-A1/Ttgi-B1 Paragon Kronos 3 Paragon Kronos 4 Kronos Paragon 5 Kronos Paragon 6 Paragon Kronos Ttgi-A1/Ttgi-B1 Ttgi-A1/Ttgi-B1 Ttgi-A1/Ttgi-B1 WT Segregant WT Segregant WT Segregant WT Segregant WT Segregant WT Segregant Block/Column 1 2 3 4 5 1 2 3 4 5 6 A) B) Kronos Kronos KronosA TILLING F1 (Aa) F1 Kronos2019 - Ttgi-A3 100 % Aa 50 % AA 50 % Aa 50 % AA 50 % Aa 50 % AA 50 % Aa BC1 F1 BC1 F1 X BC2 F1 BC3 F1 50 % AA 50 % Aa BC4 F1 25 % AA 25 % aa 50 % Aa BC4 F2 BC4 F2 BC4 F3 BC4 F2 X X BC2 F1Kronos X BC3 F1Kronos X BC4 F1BC4 F1 X X aa Kronos Kronos Kronos B TILLING (bb) F1 (Bb) F1 100 % Bb 50 % BB 50 % Bb 50 % BB 50 % Bb 50 % BB 50 % Bb BC1 F1 BC1 F1 X BC2 F1 BC3 F1 50 % BB 50 % Bb BC4 F1 25 % BB 25 % bb 50 % Bb BC4 F2 BC4 F2 BC4 F3 BC4 F2 X X BC2 F1Kronos X BC3 F1Kronos X BC4 F1BC4 F1 X X bb 75 % AaBb 6.25% AABB 6.25% aabb 6.25% aaBB 6.25% AAbb X BC4 F3 aa BC4 F4 BC5 F5 BC4 F4 BC4 F4 100 % AaBb BC4 F3 X bb Ttgi-3A/gi-3BC) A) Kronos2205 - Ttgi-B3B) Supplementary Figure 2 Supplementary Figure 1 Supplementary Figure 3 Supplementary Figure 4 Supplementary Figure 5 0.818 E) a b cc bc a b b ac bc 0.830 0.826 Fv /F m Fv /F m Kronos WT segregant A) D) F) G) E) B) C) Pe rio d (h ) 28 24 20 R AE 0.8 0.6 0.4 0.2 24 36 48 60 72 84 96 Time in hours (h) 24 36 48 60 72 84 96 Time in hours (h) 24 36 48 60 72 84 96 Time in hours (h) 24 36 48 60 72 84 96 Time in hours (h) 24 36 48 60 72 84 96 Time in hours (h) 0.822 0.814 0.810 0.818 0.818 0.826 0.834 0.822 0.822 0.814 0.810 0.806 0.802 0.810 0.818 0.830 0.826 0.822 0.814 0.810 0.818 0.830 0.826 0.822 0.814 0.830 0.826 Supplementary Figure 6 a a a a a a a a a a a a a a a b aab a a a bb b b a a a a a H ei gh t ( cm ) W ei gh t s ee ds o f P rim ar y H ea d (g ) N um be r o f t ot al se ed s pe r p la nt Le ng th P rim ar y H ea d (c m ) N um be r s ee ds p er p rim ar y he ad N um be r o f t ille rs65 8 30 20 10 6 4 2 0 1.5 1.0 0.5 0 90 60 30 0 20 10 60 55 0 A) B) C) D) E) F) N um be r o f t ot al s ee ds p er p la nt Le ng th P rim ar y H ea d (c m ) 6.5 6 5.5 5 W ei gh t s ee ds o f P rim ar y H ea d (g ) 2 200 150 100 50 0 1 0 N um be r o f t ille rs 12.5 10 7.5 5 40 H ei gh t ( cm ) 68 64 60 56 N um be r s ee ds p er p rim ar y he ad 30 30 10 20 A) B) C) D) E) F) aa ab ab b a ab ab b ab ab a ab abb ab a ab ab b a a a a a a ab ab ab b Supplementary Figure 7 To ta l w ei gh t s ee d (g ) Le ng th P rim ar y H ea d (c m ) 8 6 4 2 0 H ei gh t ( cm ) 80 70 60 50 40 25 22.5 20 17.5 15 30 20 A) B) C) D) a ab b b a a a a a a a a a aab b N um be r s ee ds Supplementary Figure 8 Kronos Ttgi-A3/gi-B3 Tr an sc rip t A bu nd an ce 0.5 0.4 0.3 0.2 0.1 TtGID1 0 3 6 9 12 15 18 21 24 ZT (h) Tr an sc rip t A bu nd an ce 3 2 1 TtGID1 0 3 6 9 12 15 18 21 24 ZT (h) 0.20 0.15 0.10 0.05 TtGA20ox2 0 3 6 9 12 15 18 21 24 ZT (h) A) B) C) D) 0.5 0.4 0.3 0.2 0.1 TtGA20ox2 0 3 6 9 12 15 18 21 24 ZT (h) G S3 9 3 le av es Kronos Kronos Kronos Kronos Kronos Kronos Paragon Paragon Paragon Paragon Paragon Paragon Ttgi-A3 Ttgi-A3 Ttgi-A3 Ttgi-A3 WT segregant WT segregant WT segregant Ttgi-A3 Ttgi-A3 Ttgi-B3 Ttgi-A3 WT segregant WT segregant WT segregant Ttgi-A3/gi-B3 Ttgi-A3/gi-B3 Ttgi-A3/gi-B3 Ttgi-A3/gi-B3 Ttgi-A3/gi-B3 Ttgi-A3/gi-B3 Ttgi-A3/gi-B3 Ttgi-A3 Ttgi-A3/gi-B3Ttgi-B3Kronos WT segregant Ttgi-A3 Ttgi-A3/gi-B3Ttgi-B3Kronos WT segregant Ttgi-A3 Ttgi-A3/gi-B3Ttgi-B3Kronos WT segregant Ttgi-A3 Ttgi-A3/gi-B3Ttgi-B3Kronos WT segregant Ttgi-A3 Ttgi-A3/gi-B3Ttgi-B3Kronos WT segregant Ttgi-A3 Ttgi-A3/gi-B3Kronos WT segregant Ttgi-A3 Ttgi-A3/gi-B3Kronos WT segregant a a a a a aa a a a 0.0 0.5 1.0 1.5 2.0 2.5 12 15 ZT Tr an sc rip t A bu nd an ce Kronos WT segregant Ttgi-B3 Ttgi-A3 Ttgi-A3/gi-3B Variety Name Locality Species Habit Assembly Arina Switzerland T. aestivum W De novo CDC Stanley Canada T. aestivum S De novo CDC Landmark Canada T. aestivum S De novo Claire UK T. aestivum W W2RAP Cadenza UK T. aestivum F W2RAP Jagger USA T. aestivum W De novo Julius Germany T. aestivum W De novo Norin61 Japan T. aestivum S De novo Mace Australia T. aestivum S De novo Robigus UK T. aestivum W W2RAP PI190962 Europe T. spelta W / Paragon UK T.aestivum S W2RAP Lancer Australia T.aestivum S W2RAP SY Mattis France T. aestivum W De novo Zativan Israel T. turgidum NA De novo Supplementary Table S1 0.59 ± 0.05 0.52 ± 0.04 0.27 ± 0.02 0.26 ± 0.02 0.26 ± 0.01 0.21 ± 0.01 Genotype NPQ ± SEM Fv/Fm ± SEM Period RAE 22.70 ± 0.27 23.10 ± 0.14 23.30 ± 0.28 22.70 ± 0.20Kronos 21.30 ± 0.14 21.70 ± 0.11Ttgi-A3 Ttgi-A3 WT Segregant WT Segregant 22.70 ± 0.22 22.05 ± 0.11Ttgi-B3 Ttgi-B3 Ttgi-A3/gi-B3 Ttgi-A3/gi-B3 18.40 ± 0.38 20.80 ± 1.14 0.18 ± 0.020.17 ± 0.01 0.28 ± 0.010.20 ± 0.01Kronos Supplementary Table S2