Article https://doi.org/10.1038/s41467-024-55223-9 Aptamer-conjugated gold nanoparticles enable oligonucleotide delivery into muscle stem cells to promote regeneration of dystrophic muscles Francesco Millozzi 1,2,11, Paula Milán-Rois 3,11, Arghya Sett 4,10, Giovanni Delli Carpini1, Marco De Bardi 5, Miguel Gisbert-Garzarán 3, Martina Sandonà1,5, Ciro Rodríguez-Díaz 3, Mario Martínez-Mingo 3, Irene Pardo 3, Federica Esposito2,5, Maria Teresa Viscomi 1,6, Marina Bouché 2, Ornella Parolini1,6, Valentina Saccone1,6, Jean-Jacques Toulmé 4,7 , Álvaro Somoza 3,8 & Daniela Palacios 1,9 Inefficient targeting of muscle stem cells (MuSCs), also called satellite cells, represents a major bottleneck of current therapeutic strategies for muscular dystrophies, as it precludes the possibility of promoting compensatory regeneration. Herewe describe amuscle-targeting delivery platform, based on gold nanoparticles, that enables the release of therapeutic oligonucleotides into MuSCs. We demonstrate that AuNPs conjugation to an aptamer against α7/β1 integrin dimers directs either local or systemic delivery of microRNA- 206 toMuSCs, thereby promotingmuscle regeneration and improvingmuscle functionality, in a mouse model of Duchenne Muscular Dystrophy. We show here that this platform is biocompatible, non-toxic, and non-immunogenic, and it can be easily adapted for the release of a wide range of therapeutic oligonucleotides into diseased muscles. Duchenne Muscular Dystrophy (DMD; ONIM: #310200) is the most common and severe form of genetic muscular dystrophy, caused by mutations in the dystrophin gene that lead to a complete absence of the protein1. In Duchenne patients, the lack of dystrophin results in structural destabilization of the sarcolemma and increased sensitivity to contraction-induced fibre damage. This leads to a progressive loss of muscle mass that is then replaced with fibrotic and adipose tissue2. There is currently no cure for the disease, and the standard-of- care treatment aims at palliating the disease symptoms through corticosteroids, breathing aids, and physiotherapy3,4. Attempts to recover a functional version of the protein via gene and oligonucleotide-based therapies are in advanced phases of clinical development5,6. However, the vast extension of skeletal muscle, which accounts for 30–40% of the bodymass, together with the exacerbated muscle damage present in dystrophic patients, poses extra challenges to these approaches. Current clinical trials of gene therapies have been evaluated by outcomemeasures that indicate low delivery and expression of micro- Received: 1 February 2024 Accepted: 3 December 2024 Check for updates 1Department of Life Science and PublicHealth, Università Cattolica del Sacro Cuore, Rome, Italy. 2Department of Anatomical, Histological, ForensicMedicine and Orthopaedic Sciences, Section of Histology and Embryology, Sapienza University of Rome, Rome, Italy. 3IMDEA Nanociencia, Madrid, Spain. 4Bordeaux University, Inserm U1212, CNRS UMR5320 Bordeaux, France. 5Fondazione Santa Lucia IRCCS, Rome, Italy. 6Fondazione Policlinico, Universitario Agostino Gemelli IRCCS, Rome, Italy. 7Novaptech, Gradignan, France. 8Unidad Asociada de Nanobiomedicina, Centro Nacional de Biotecnología (CNB-CSIC), Madrid, Spain. 9Institute for Systems Analysis and Computer Science “Antonio Ruberti” (IASI), National Research Council (CNR), Rome, Italy. 10Present address: ERIN Department, Luxembourg Institute of Science and Technology (LIST), Belvaux, Luxembourg. 11These authors contributed equally: Francesco Millozzi, Paula Milán-Rois. e-mail: jj.toulme@novaptech.com; alvaro.somoza@imdea.org; daniela.palacios@cnr.it Nature Communications | (2025) 16:577 1 12 34 56 78 9 0 () :,; 12 34 56 78 9 0 () :,; http://orcid.org/0000-0002-2737-4251 http://orcid.org/0000-0002-2737-4251 http://orcid.org/0000-0002-2737-4251 http://orcid.org/0000-0002-2737-4251 http://orcid.org/0000-0002-2737-4251 http://orcid.org/0000-0002-7043-2920 http://orcid.org/0000-0002-7043-2920 http://orcid.org/0000-0002-7043-2920 http://orcid.org/0000-0002-7043-2920 http://orcid.org/0000-0002-7043-2920 http://orcid.org/0000-0002-8356-5140 http://orcid.org/0000-0002-8356-5140 http://orcid.org/0000-0002-8356-5140 http://orcid.org/0000-0002-8356-5140 http://orcid.org/0000-0002-8356-5140 http://orcid.org/0000-0001-8217-970X http://orcid.org/0000-0001-8217-970X http://orcid.org/0000-0001-8217-970X http://orcid.org/0000-0001-8217-970X http://orcid.org/0000-0001-8217-970X http://orcid.org/0000-0001-9815-0354 http://orcid.org/0000-0001-9815-0354 http://orcid.org/0000-0001-9815-0354 http://orcid.org/0000-0001-9815-0354 http://orcid.org/0000-0001-9815-0354 http://orcid.org/0000-0002-8271-2495 http://orcid.org/0000-0002-8271-2495 http://orcid.org/0000-0002-8271-2495 http://orcid.org/0000-0002-8271-2495 http://orcid.org/0000-0002-8271-2495 http://orcid.org/0000-0002-2963-5769 http://orcid.org/0000-0002-2963-5769 http://orcid.org/0000-0002-2963-5769 http://orcid.org/0000-0002-2963-5769 http://orcid.org/0000-0002-2963-5769 http://orcid.org/0009-0004-9237-7936 http://orcid.org/0009-0004-9237-7936 http://orcid.org/0009-0004-9237-7936 http://orcid.org/0009-0004-9237-7936 http://orcid.org/0009-0004-9237-7936 http://orcid.org/0000-0002-9096-4967 http://orcid.org/0000-0002-9096-4967 http://orcid.org/0000-0002-9096-4967 http://orcid.org/0000-0002-9096-4967 http://orcid.org/0000-0002-9096-4967 http://orcid.org/0000-0002-0938-5360 http://orcid.org/0000-0002-0938-5360 http://orcid.org/0000-0002-0938-5360 http://orcid.org/0000-0002-0938-5360 http://orcid.org/0000-0002-0938-5360 http://orcid.org/0000-0002-8432-5034 http://orcid.org/0000-0002-8432-5034 http://orcid.org/0000-0002-8432-5034 http://orcid.org/0000-0002-8432-5034 http://orcid.org/0000-0002-8432-5034 http://orcid.org/0000-0001-9873-435X http://orcid.org/0000-0001-9873-435X http://orcid.org/0000-0001-9873-435X http://orcid.org/0000-0001-9873-435X http://orcid.org/0000-0001-9873-435X http://orcid.org/0000-0002-2207-2369 http://orcid.org/0000-0002-2207-2369 http://orcid.org/0000-0002-2207-2369 http://orcid.org/0000-0002-2207-2369 http://orcid.org/0000-0002-2207-2369 http://crossmark.crossref.org/dialog/?doi=10.1038/s41467-024-55223-9&domain=pdf http://crossmark.crossref.org/dialog/?doi=10.1038/s41467-024-55223-9&domain=pdf http://crossmark.crossref.org/dialog/?doi=10.1038/s41467-024-55223-9&domain=pdf http://crossmark.crossref.org/dialog/?doi=10.1038/s41467-024-55223-9&domain=pdf mailto:jj.toulme@novaptech.com mailto:alvaro.somoza@imdea.org mailto:daniela.palacios@cnr.it www.nature.com/naturecommunications dystrophin, with no evidence of functional improvement, indicating that gene delivery approaches are amenable of improvement. In addition, available technologies show very little evidence of effective delivery tomuscle stemcells (MuSCs)4,5,7, thedirect effectors ofmuscle regeneration. As MuSC ability to regenerate DMD muscles is severely impaired by the loss of dystrophin8–11 as well as by disease-associated intrinsic12,13 or extrinsic14,15 anti-myogenic signals, correction of MuSCs’ ability to regenerateDMDmuscles represents an imperative task for an effective therapeutic intervention. Yet, the lack of technologies for direct and specific targeting of MuSCs for the delivery of therapeutic agents has complicated this task and represents a current bottleneck in DMD therapeutics. Work from the past few years has revealed that paracrine mole- cules released by muscle fibres or muscle-resident cells can regulate MuSC function and stimulate skeletal muscle regeneration. Of them, microRNAs (miRNAs) have recently emerged as potential therapeutic molecules for DMD and other muscle disorders16. MirRNAs are small non-coding RNAs of around 22 nucleotides that regulate gene expression post-transcriptionally. MiRNA binding to the 3’ untrans- lated region (UTR) of target mRNAs leads to reduced gene expression by either degradation of the target mRNA or translational inhibition17. Several muscle-specificmiRNAs, the so-calledmyomirs, are associated with MuSC function and muscle regeneration18,19. Myomirs are dyna- mically regulated and play a fundamental role in regulating muscle lineage determination20,21 as well as MuSCs quiescence, activation, and differentiation20,22,23. In addition, MuSCs respond not only to endo- genously produced miRNAs, but also to miRNAs released by skeletal muscle fibres24 and non-myogenic resident cells, such as fibro- adipogenic progenitors (FAPs)25,26. Altogether, these studies suggest that modulation of miRNA levels in MuSCs may be an effective ther- apeutic approach to potentiate the regeneration of dystrophic muscles. Amongst the miRNAs with therapeutic potential for muscle dis- eases, miR-206 plays important roles both in MuSCs differentiation and in skeletal muscle regeneration. Using knock-out mice, Liu et al. showed that miR-206 promotes skeletal muscle regeneration and delays disease progression in a mouse model of DMD27. Under phy- siological conditions, miR-206 expression is restricted to the skeletal muscle lineage. However, miR-206 is also produced and released within extra-cellular vesicles (EVs) by FAPs, upon treatment of dys- trophic mice with histone deacetylases (HDACs) inhibitors26. HDAC inhibitors have been shown to promote skeletal muscle regeneration and ameliorate the dystrophic phenotype in pre-clinical models of DMD28–30, leading to FDA approval of one of such inhibitors, givinostat, for the treatment of DMDpatients31. Recent studies demonstrated that the pro-regenerative effect of HDAC inhibitors is mediated, at least in part, by FAPs-released EVs containing miR-206, which target MuSCs25. Altogether, these works highlight the importance of miR-206 in ske- letal muscle regeneration, pointing it out as a potential therapeutic molecule to restore MuSC ability to regenerate DMD muscles. However, as occurs with other oligonucleotide-based therapies, in vivo delivery of miRNAs presents several caveats, including poor pharmacokinetic properties and low stability. Several strategies have been employed to increase oligonucleotide stability in the blood- stream and to improve cellular uptake, such as the use of chemical modifications or conjugation to lipids, cell-penetrating peptides and polymers6. However, there is still the need to improve the selective delivery of high amounts of therapeuticmolecules into skeletalmuscle tissue. Within this context, nanotechnologies may provide efficient and safe biocarriers for oligonucleotide-based therapeutics. A variety of nanostructures can be modified with different types of oligonu- cleotides, such asmiRNAs, small interference RNAs (siRNAs), and anti- sense oligonucleotides (ASOs). Of them, gold nanoparticles (AuNPs) stand out due to their small size, high functionalization capacity, and low toxicity32–36. The use of AuNPs densely covered by oligonucleotides, also known as spherical nucleic acids (SNAs), not only improves the stability of nucleic acids in the bloodstreambut also increases their cellular uptake. Additionally, AuNPs can also be easily conjugated to different targeting moieties (e.g., antibodies, peptides, and aptamers) to improve tissue selectivity and therefore reduce off- target effects37. Here, we developed a delivery platform, based on functionalized AuNPs, to specifically release therapeutic oligonucleotides into skele- tal muscles. The platform is composed of a gold core and a dense, packed shell of nucleic acids38. This kind of packed distribution pre- vents oligonucleotide degradation, improving their pharmacokinetics and enhancing the therapeutic effect39. To achieve selective muscle targeting, the AuNPs were conjugated to an aptamer against the extra- cellular portion of α7/β1 integrin dimers, a highly specific surface receptor expressed by muscle progenitors and differentiated myofi- bers that is virtually absent in other organs or tissues40,41. Our data show that aptamer-conjugated AuNPs efficiently target skeletal mus- cles, including highly inaccessiblemuscles such as the diaphragm,with a high selectivity towards the MuSCs compartment. Moreover, sys- temic treatment with miR-206 containing AuNPs increases skeletal muscle regeneration and improves muscle functionality in a mouse model of DMD. Thanks to its versatility, this platform can be imple- mented to deliver different types of therapeutic molecules, including other types of nucleic acids, small molecules, and proteins42–44. Results Development of a muscle-specific aptamer To obtain muscle-specific targeting, we developed an aptamer against the extra-cellular portion of the α7/β1 integrin dimer. α7/β1 integrins are enriched inmuscle tissues, and are highly expressed inMuSCs, but they are absent in other organs or tissues40,41. The aptamer was obtained through Systematic Evolution of Ligands by Exponential Enrichment (SELEX) from a library of 1014 DNA sequences. Briefly, cross-over SELEX was performed simultaneously against Histidine- tagged α7/β1 integrin recombinant protein and C2C12 muscle cells (Supplementary Fig. 1a) as described previously45. After 14 roundsof selection, thepools eluted fromeach roundand the initial library were submitted to Next Generation Sequencing and sequences were analyzed with bioinformatincs tools (Multiple sequence alignmentMAFFTmotif analyses, cluster analysis, secondary structure analysis). Following this analysis, 8 potential aptamer can- didates were selected, and their binding properties were further investigated by Surface Plasmon Resonance (SPR) (Fig. 1a). The most efficient binder, NM15,with aKDof about 235 nMwas further truncated to eliminate the conservedflanking regions to obtainNM15.2, with aKD of about 40 nM. The ability of NM15.2 to recognize C2C12 cells was then investigated by cytofluorimetry, using an Alexa-594 5’-end con- jugated aptamer. The results shown in Supplementary Fig. 1b demonstrate that over 85% of C2C12 cells were efficiently labelled with NM15.2, confirming its ability to recognize muscle cells. The specificity of NM15.2 -hereinafter α7/β1 aptamer- towards MuSCs and skeletal muscle fibres was then assessed using Alexa-594 5’ end-labelled oligonucleotides. Flow cytofluorimetry experiments in muscles isolated from dystrophic D2.B10-Dmdmdx/J (D2-mdx) mice using antibodies against CD31, CD45, TER119 and SCA1 and the Alexa- 594 5’-end conjugated α7/β1 aptamer confirmed the specificity of the α7/β1 aptamer towards a muscle-resident population defined as negative for both hematopoietic, endothelial and mesenchymal sur- face markers (CD31, CD45, TER119, SCA1), and likely corresponding to MuSCs. A scramble oligonucleotide of the same length was used as a negative control, showing a much-reduced binding (Supplementary Fig. 1c and Fig. 1b, c). Moreover, confocal microscopy on single myo- fibres isolated from dystrophic mice confirmed a positive α7/β1 apta- mer staining on PAX7-positive MuSCs (Fig. 1d). Finally, staining on transversal sections of Tibialis Anterior (TA) muscles from dystrophic Article https://doi.org/10.1038/s41467-024-55223-9 Nature Communications | (2025) 16:577 2 www.nature.com/naturecommunications D2-mdxmice showed that the Alexa-594 5’ end-labelled α7/β1 aptamer is also able to stain muscle fibres membrane, as expected46,47 (Fig. 1e). Altogether, these results indicate that the α7/β1 aptamer efficiently binds skeletal muscles, including MuSCs and myofibers, in a mouse model of DMD. Generation of aptamer-conjugated AuNPs for oligonucleotide delivery We next conjugated either control (scr) or α7/β1 aptamers, together with two different types of cargo oligonucleotides (miR-206 mimics, and oligodT) to the AuNPs as follows. AuNPs were first synthetized through the Turkevichmethod, yielding spherical nanoparticles with a size of ca. 15 nm (Fig. 2a). Then, 5’ end-thiolated aptamers and 3’ end- thiolated cargo oligonucleotideswere added to the AuNPs, whichwere further salt-aged to improve the packing of the nucleic acids. The successful coating was verified by the lack of changes in the absor- bance spectrum, showing all of them amaximum at 520 nm, typical of this kind of nanomaterials (Fig. 2b). The colloidal stability of the dif- ferent nanoparticles was evaluated by Dynamic Light Scattering (DLS), which demonstrated that the hydrodynamic size of the different car- riers remained essentially constant regardless of the nucleic acid employed (ca. 30–40nm, Fig. 2c, red bars). The slight differences found might be ascribed to the nature of each nucleic acid. In con- sequence, these nanoparticles would present an appropriate size to be systemically administered as drug delivery systems (>10 nm to avoid renal clearance and <200nm to reduce an immune response)48. Simi- larly, the Z-potential measurements revealed a slight reduction in the surface charge of all oligonucleotide-containing AuNPs compared to the unmodified counterpart, showing an average value of ca. -30mV in all cases (Fig. 2d, red bars). The same parameters (size and z-potential) were also assessed upon incubation of the nanoparticles with plasma. It is well accepted that nanoparticles behaviour in vivo is intrinsically dependent on their ability to avoid the immune system and to reach their target tissue or organ49. When nanoparticles are released into the blood- stream, they are immediately coated by a dynamic protein layer called the protein corona. This coating significantly affects pharma- cokinetics, biodistribution, and target recognition of the therapeutic nanoparticles. We, therefore, measured the physicochemical prop- erties of the different aptamer-conjugated AuNPs upon incubation with plasma, to allow the formation of a functional protein corona. As expected, the biomolecular corona increased the hydrodynamic size a cb e - d sc r - PAX7 Aptamer Merge sc r PAX7 Aptamer Merge aptamer scr aptamer Ap ta m er -A le xa 59 4 Sca-1 FITC Sca-1 FITC 7/ 1 sc r 0 20 40 60 Ap ta m er po si tiv e ce lls (% ) Sca1- Lin- Sca1+Lin- Lin+ esnopse R U ni ts (R U ) Time (sec) Ap ta m er -A le xa 59 4 600 700 800 900 1000 0 500 1000 NM3_Y NM15_Y NM5_Y NM6_Y NM7_Y NM8_Y NM13_Y NM4_Y Fig. 1 | Selection and characterization of a muscle-specific aptamer against α7/β1 integrin dimers. a Sensogram obtained by Surface Plasmon Resonance (SPR) for the associationwith and the dissociation fromα7/β1 integrin recombinant protein of selected aptamer candidates. b Representative flow cytometry plot showing α7/β1 aptamer-positive cells (y-axis) and Sca1-positive cells (x-axis) on the lineage (CD31, CD45, TER119)-negative muscle resident cells. A scramble (scr) aptamer was included as a negative control. c Percentage of α7/β1 aptamer-posi- tive, Sca1-negative cells (grey), α7/β1 aptamer-negative, Sca1-positive cells (pink) and lineage positive (lin + ) cells (green) in the gastrocnemius muscles of D2-mdx mice analyzed by flow cytometry in (b). Data are presented asmean values +/- SEM (n = 3 mice). Statistical analysis was performed using two-way ANOVA followed by Tukey’spost hoc test.d Fluorescenceanalysis on freshly isolatedmyofibres using an Alexa 594-labelled α7/β1 aptamer and Alexa 594-scr as a control. The panels show representative images of three independent experiments, with similar results. Scale bar: 20 µm. e Fluorescence analysis on transversal sections of Tibialis Anterior (TA) muscles using an Alexa 594- α7/β1 aptamer. Scramble aptamer and un-hybridized sections were included as a negative controls. The panels show representative images from sections of three independent TA muscles. Scale bar: 50μm. Article https://doi.org/10.1038/s41467-024-55223-9 Nature Communications | (2025) 16:577 3 www.nature.com/naturecommunications (Fig. 2c, grey bars) and decreased the z-potential (Fig. 2d, grey bars) of the functionalized AuNPs. Protein corona composition of the therapeutic α7/β1 AuNPs miR-206 in dystrophic plasma We next performed mass spectrometry analysis to investigate the identity of the proteins bound to the therapeutic AuNPswhen exposed to plasma obtained from dystrophic mice (D2-mdx mice) (Supple- mentary Fig. 2a). The identified proteins were then grouped according to the described functional processes in plasma (“coagulation”, “complement”, “immunoglobulins”, “lipoproteins”, “acute phase”, “lipoproteins” and “others”) as reported in ref. 50. Annotation of the 30 (Fig. 2e) and 200 (Supplementary Fig. 2b) most abundant bound proteins show a very low percentage of immunoglobulins and lipo- proteins in the protein corona formed when the α7/β1 AuNPs miR-206 were incubated with D2-mdx plasma. Immunoglobulins deposition on protein corona has been recently associated with complement opso- nization and diminished efficiency of therapeutic nanoparticles51. These results suggest that the α7/β1 AuNPs miR-206 may have a low immunogenic profile. In addition, the ApoE lipoprotein, which is thought to be the main responsible for nanoparticle’s liver targeting due to its ability to bind to low-density lipoprotein receptors present in liver cells, is barely present in the biomolecular corona (around 1%), suggesting the α7/β1 AuNPs miR-206 may have a low liver retention if delivered through the bloodstream. A list of the 30 more abundant proteins and their relative levels is shown in Supplementary Fig. 2c, while a list of the 200 more abundant proteins is shown in Supple- mentary Data 1. In vitro treatment with α7/β1 AuNPs miR-206 stimulates differ- entiation of muscle cells Having characterized the physicochemical properties of the functio- nalized AuNPs, we tested them in vitro, in C2C12 myoblasts. To assess for oligonucleotide intracellular delivery, we first used AuNPs con- taining a fluorescent oligonucleotide (oligodT-cy5). Results shown in Fig. 3a, b show that over 95% of C2C12 cells incorporate oligodT-cy5. Then, to investigate the ability of our nanoformulation to release a functional miRNA, we used a luciferase reporter assay. Briefly, we stably transfected C2C12 cells with a luciferase reporter containing the miR-206 seed sequence in the 3’UTR. As shown in Fig. 3c,α7/β1 AuNPs d e a b c 300 400 500 600 700 0.0 0.2 0.4 0.6 0.8 1.0 Wavelenght (nm) Ab so rb an ce (A U ) AuNP 7/ 1 AuNP oligodT 7/ 1 AuNP mir-206 Top 30 Immunoglobulins Complement Lipoproteins Acute-phase Coagulation Others -40 -30 -20 -10 0 scr AuNP oligodT 7/ 1 AuNP oligodT scr AuNP miR-206 7/ 1 AuNP miR-206 Citrate Zeta potential (mV) w/o plasma with plasma 0 20 40 60 80 scr AuNP oligodT 7/ 1 AuNP oligodT scr AuNP miR-206 7/ 1 AuNP miR-206 Citrate Size (nm) with plasmaw/o plasma Fig. 2 | Aptamer-conjugated AuNPs containing oligonucleotides retain their physicochemical properties. a Transmission Electronic Microscopy (TEM) image of a representrative batch of gold nanoparticles (AuNPs). The histogram show the size distribution of the AuNPs, with a mean size of 14.49 ± 3.45 nm (n = 400 nano- particles). Similar results were obtained with all the AuNPs batches used. b Absorbance spectrum of the different AuNPs formulations, where the corre- sponding surface resonance plasmon band is shown around 520 nm. c Dynamic Light Scattering (DLS) measurements of AuNPs in aqueous media (red) and after incubation with plasma (grey). Overall, size remained constant among groups (ca. 30nm in aqueousmedium; ca. 60 nm after incubation with plasma), regardless of the oligonucleotide composition. Data arepresented asmean values +/- SD (n = 3 biological replicates). d Zeta potential measurements of AuNPs in aqueous media (red) and after incubationwith plasma (grey). The surface chargewas unaffected by the specific oligonucleotide attached (ca. -30 mV), showing a reduction of nega- tivity after the protein coating in all cases (ca. -18mV). Data are presented as mean values +/- D (n = 3 biological replicates). e Composition of the protein corona, considering the 30 more abundant proteins, according to their functional pro- cesses in plasma. Article https://doi.org/10.1038/s41467-024-55223-9 Nature Communications | (2025) 16:577 4 www.nature.com/naturecommunications miR-206 efficiently release a functional miRNA, able to repress the luciferase reporter. The efficiencymimics the one obtained whenmiR- 206 was transfected using lipofectamine. Of note, the AuNPs are not cytotoxic at doses at least three-fold higher than those used in all the in vitro experiments, as shown in Supplementary Fig. 3a. We next investigated if functionalized AuNPs can deliver a func- tional miR-206 in dystrophic MuSCs. To this purpose, we isolated MuSCs by fluorescence-activated cell sorting (FACS), as CD31, CD45, TER119, SCA1-negative, ITGA7-positive mononuclear cells from D2- mdx muscles and treated them ex vivo with α7/β1 AuNPs containing miR-206 or control oligonucleotides. Previous work showed that miR- 206 over-expression enhances MuSC ability to differentiate into myotubes19 and stimulates MuSCs differentiation and fusion into muscle fibres in mdx mice18. Consistently, we observed that α7/β1 AuNPs miR-206 increases MuSC fusion into myotubes, when cultured in proliferation medium, as compared to cells either untreated or treated with control α7/β1 AuNPs (AuNPs oligodT) (Fig. 3d, e). In addition, treatment with control α7/β1 AuNP oligodT partially stimu- lates the differentiation of isolatedMuSCs, even in the absence ofmiR- 206, as shown by the slight increase in the number of myosin heavy chain (MyHC)-positive cells (Fig. 3d, e) and in the partial expression of early (Myog) and late (Myh2) differentiation markers (Supplementary cb /IPA D C Hy M d AuNPs miR-206AuNPs oligodT ol ig oT _c y5 /D AP I a - AuNPs oligodT-cy5 g Untreated PA X 7 7/ 1 AuNPs miR- 206/ 1 AuNPs oligodT egre M M YO D e f Untreated 0 50 100 150 % fir ef ly :re ni lla lu ci f e r a se a c tiv ity - Lipofectamine miR-206 7/ 1 AuNP miR-206 Untr ea ted 7/ 1 AuN Ps oli go dT 7/ 1 AuN Ps miR-20 6 0 50 100 150 N uc le ip e r cl us t e r( % ) PAX7 PAX7/MYOD MYOD * Untr ea ted 7/ 1 AuN Ps oli go dT 7/ 1 AuN Ps miR-20 6 0 50 100 150 n<2 25 * N uc le i( % ) Article https://doi.org/10.1038/s41467-024-55223-9 Nature Communications | (2025) 16:577 5 www.nature.com/naturecommunications Fig. 3b). These results are in agreementwith previouslypublishedwork using gold- silver (Au-Ag) nanoparticles52, suggesting that some inor- ganic nanoparticles may modulate both activation and differentiation of MuSCs by themselves53. Finally, we show here that α7/β1 AuNPs can modulate the activity of MuSCs also in their niche. To this end, we treated freshly isolatedmyofibres for 48hwith control orα7/β1 AuNPs miR-206 and stained them with antibodies recognizing MYOD and PAX7, two key markers of MuSCs function that mark the quiescent (PAX7 single positive) activated (PAX7/MYOD double positive), or committed (MYOD single positive) cellular stages of muscle differentiation54. Of note, Pax7 mRNA is a direct target of miR-20655. Our results show that miR-206-containing AuNPs stimulate MuSCs differentiation within the context of their niche, as shown by the decrease in the number of PAX/ MYOD positive cells in favour of an increase in the number of MYOD single-positive cells (Fig. 3f, g). Altogether, these data demonstrate that α7/β1 AuNPs containing miR- 206 efficiently target skeletal muscle cells ex vivo and increase their differentiation potential. Intramuscular injection of α7/β1 AuNPs miR-206 stimulates skeletal muscle regeneration in a mouse model of DMD Next, we tested the effect of delivering the functionalized AuNPs in vivo into dystrophic muscles by local (intramuscular) injection. To this end, we first injected α7/β1 AuNPs oligodT-cy5 (AuNPs con- centration: 33.6 nM; oligonucleotide dose: 0. 3mg/kg) into the TA muscles of 8weeks old D2-mdx mice and assessed for fluorescence release by confocal microscopy. Results shown in Supplementary Fig. 4 indicate that cy5 fluorescence is still observed within dystrophic muscles 1 week after the injection. However, we could not unequi- vocally discriminate if the muscle-resident cell population receiving the α7/β1 AuNPs oligodT-cy5 corresponded to PAX7-positive MuSCs, as the immunofluorescence protocol conditions inactivated the fluorescent dye. We then injected α7/β1 AuNPs miR-206 or control α7/β1 AuNPs oligodT (AuNPs concentration: 33.6 nM; oligonucleotide dose: 0.3 mg/kg per injection), once a week for a total of 3 weeks (Fig. 4a). This treatment protocol was selected based on results shown in Supplementary Fig. 4 and on published work showing that MuSCs reacquire quiescence 5–7 after activation, following the formation of new myofibres56. We reasoned that delivering the therapeutic AuNPs once a week should be enough to allow a full cycle of MuSCs-mediated regeneration and return to quies- cence, while keeping detectable levels of the oligonucleotide cargo. After the sacrifice, we performed histological analysis to assess AuNPs delivery into muscle-resident cells (Fig. 4b), miR- 206 levels (Fig. 4c, d), skeletal muscle regeneration (Fig. 4e, f) and fibrotic deposition (Fig. 4g, h). Our results confirmed that local delivery of both α7/β1 AuNPs miR-206 and control α7/β1 AuNPs oligodT into TA muscles efficiently target muscle-resident cells (Fig. 4b) while, in addition, treatment with α7/β1 AuNPs miR-206 strongly increases the levels of this miRNA, which is highly enriched in the newly formed, centrally nucleated, myofibres (Fig. 4c, d, red arrows). Functionally, treatment with α7/β1 AuNPs miR-206 induces a strong increase in the number of regenerating embryonic MyHC (eMyHC)-positive fibres as compared to PBS- treated animals and mice injected with control AuNPs (Fig. 4e, f), with no changes in fibrotic deposition (Fig. 4g, h). Altogether, these data point out to a specific effect of the treatment on MuSC-mediated regeneration after local delivery of the ther- apeutic nanoparticles. Systemic delivery of α7/β1 AuNPs efficiently target skeletal muscles, including MuSCs, in dystrophic mice Given the strong pro-regenerative response observed after local delivery of miR-206 in D2-mdx mice, we next tested if the developed nanotherapy was suitable for systemic delivery. We first investigated if the α7/β1 AuNPs efficiently target dystrophic muscles when injected into the bloodstream. To this end, we injected 8-weeks old D2-mdx mice intravenously with AuNPs- oligodT-cy5 conjugated to either scr- or α7/β1 aptamers (AuNPs concentration: 33.6 nM, oligonucleotide concentration: 1.5mg/kg). After 24 h we sacrificed the animals, har- vested skeletal muscles (TA, gastrocnemius, quadriceps and triceps), lung, heart, liver, spleen, kidney and brain, and analysed the released fluorescence using an IVIS imaging system. Data shown in Fig. 5a, b show that α7/β1 AuNPs, but not those containing the control aptamer, efficiently target skeletal muscle tissue in dystrophic mice after intra- venous injection. We also detected cy5 fluorescence in kidney and liver, but not in any of the other organs analysed. Liver, and to a lower extent kidney and spleen, have been previously described as the main organs involved in the clearance of oligonucleotide conjugated AuNPs33,35, while kidney is also the primary organ for the clearance of small molecules, such as the unconjugated oligodT-cy557,58. To dis- criminate if the strong fluorescent signal observed in the kidneys was due to the retention of conjugated AuNPs or the clearance of uncon- jugated cy5 fluorophores, we also measured the amount of gold deposition by InducedCouple Plasmamass spectrometry (ICP-MS). To this end, we injected 8-weeks old D2-mdx mice intravenously with AuNPs- oligodT conjugated to either scr- or α7/β1 aptamers (AuNPs concentration: 33.6 nM). Twenty four hours after the treatment, we harvested skeletal muscle, heart, liver, spleen, and kidneys for ICP-MS analysis to quantitate metal deposition in the different organs59. Data shown in Fig. 5c confirmed that α7/β1 AuNPs efficiently target skeletal muscle tissue 24 h after intravenous injection. Scramble-AuNPs, on the contrary, do not efficiently reach skeletal muscle tissues and pre- ferentially accumulate in the liver and, to a lesser extent, in the spleen and kidney after systemic delivery, as previously observed for other oligonucleotide-conjugated AuNPs of the same size35,36. These results indicate that the α7/β1 aptamer strongly improves skeletal muscle delivery of oligonucleotide conjugated AuNPs in dystrophicmice after intravenous injection. We next investigated if the α7/β1 AuNPs were able to target also MuSCs within dystrophic muscles. To this end we delivered α7/β1 Fig. 3 | Aptamer-conjugated AuNPs efficiently deliver a functional miR-206 mimic and stimulate MuSCs differentiation ex vivo. a Cytofluorimetry and b fluorescence analysis of C2C12 cells treated with PBS or α7/β1 AuNPs containing oligodT-cy5 (3 nM) for 24 h. Scale bar: 50 µm. The histogram and panels show representative images of two independent experiments performed in triplicate. c Luciferase experiments performed inC2C12 cells containing the reporter plasmid pmirGLO 206 and transfected with miR-206 (5μM) using lipofectamine, or treated with α7/β1 AuNPs functionalized with miR-206 (3 nM). Data are presented asmean values +/- SEM (n = 4 independent experiments). Statistical analysis was performed using one-way ANOVA followed by Tukey’s post hoc test. d Immunofluorescence performed inMuSCs derived fromD2-mdxmice isolated by FACS as lineage (CD31, CD45, TER119)-negative, SCA1-negative, ITGA7-positive and treated with the indi- cated AuNPs (3 nM) in growth medium. Red, MyHC (MF20), Blue, DAPI. Untreated cells are shown as a control. Scale bar: 70 µm. e Graph showing the percentage of nuclei contained in eMyHC- fibres containing 1, 2 to 5 or >5 nuclei in the same conditions as in (c). Data are presented as mean values +/- SEM (n = 3 biological replicates). Statistical analysis was performed using one-way ANOVA followed by Tukey’s post hoc test. * indicates statistical differences between α7/β1 AuNPs miR- 206 and untreated fibres. f Fluorescence analysis on freshly isolated myofibres using anti-PAX7 and anti-MYOD antibodies after 48h in culture. Blue, DAPI. Scale bar: 50μm. g Quantification of the percentage of PAX7, MYOD and PAX7/MYOD positive cells per cluster in (f). Data are presented as mean values +/- SEM (n = 3 independent experiments, with at least 30 clusters per per condition analysed in each experiment). Statistical analysis was performed using one-way ANOVA fol- lowed by Tukey’s post hoc test. * indicates statistical differences in MYOD positive cells between α7/β1 AuNPs miR-206 and untreated fibres. Article https://doi.org/10.1038/s41467-024-55223-9 Nature Communications | (2025) 16:577 6 www.nature.com/naturecommunications AuNPs oligodT-cy5 via intravenous injection as in Fig. 5a, b and 24 h later we harvested hindlimb muscles for cytofluorimetry analysis, using antibodies against CD31, CD45, TER119, SCA1 and ITGA7 for lineage determination. The results shown in Fig. 5d show cy5 fluores- cence in around 20%ofMuSCs after a single intravenous injectionwith the indicated AuNPs. No fluorescence was observed in FAPs or in hematopoietic and endothelial cells (labelled as lineage positive in the graph) further corroborating the selectivity of our system towards the muscle lineage. Unexpectedly, we did not detect α7/β1 AuNPs accumulation in the heart with any of the methodologies used (IVIS, Fig. 5a, b and ICP-MS, Fig. 5c). Lack of accumulation in the heart was surprising, as the α7/β1 integrin dimers we previously described to be expressed also in cardiac tissue40,41. To investigate if the preferred selectivity towards skeletal muscle could be due to the presence of different levels of α7/β1 integrin in the two tissues in dystrophic mice, we performed immunofluorescence analysis using antibodies against α7 and β1 integrins. Results shown in Supplementary Fig. 5a show that the levels of the two integrins are barely detectable in cardiac muscle derived from D2-mdx mice as compared to skeletal muscle. In agreement with this observation, incubation with 5’ labelled α7/β1 aptamer does not efficiently label cardiac tis- sue in these mice (Supplementary Fig. 5b). Of note, both integrins are present in all the skeletal muscles analysed (Supplemen- tary Fig. 5c). Finally, to assess if our α7/β1 AuNP can also target highly inac- cessible muscles, such as the diaphragm, and if they could be suitable for in vivo systemic delivery of miRNAs mimics, we injected D2-mdx a AuNPs oligodT AuNPs miR-206 m iR -2 06 AuNPs oligodT AuNPs- miR-206PBSc e d fAuNPs oligodT AuNPs- miR-206PBS La m in in /e M yH C /D AP I Si llv er en ha nc em en t g Si riu s R ed AuNPs oligodT AuNPs miR-206PBS h b PBS 0 20 40 60 80 m iR -2 06 po si tiv e ar ea (% ) PBS 7/ 1 AuNPs oligodT 7/ 1 AuNPs miR-206 0 10 20 30 eM yH C po si tiv e fib re s (% ) PBS 7/ 1 AuNPs oligodT 7/ 1 AuNPs miR-206 0 10 20 30 40 Fi br ot i c a r ea (% ) PBS 7/ 1 AuNPs oligodT 7/ 1 AuNPs miR-206 Fig. 4 | Functionalized AuNPs efficiently stimulate muscle regeneration in D2- mdxmice when injected locally. a Scheme of the experimental protocol. b Silver enhancement performed on transversal sections on TA muscles of mice treated once a week for a total of 3weekswith intramuscular injections of either PBS,α7/β1 AuNPs containing oligodT or α7/β1 AuNPs containing miR-206. White arrows indicate AuNPdeposition. Scale bar: 30 µm. The panels show representative images of three independent muscles. cmiR-206 staining in TAmuscles of mice treated as in (b). Red arrows indicate miR-206 within centrally nucleated, regenerating, myofibres. Scale bar: 50 µm. d Graph shows the percentage of stained area (in pixels) quantified in (c). Data are presented asmean values +/- SEM (n = 7 biological replicates). e Immunofluorescence for embryonic myosin heavy chain (eMyHC- red) and laminin (green) in the same conditions as in (b). Nuclei were counter- stained with DAPI (blue). Scale bar: 50 µm. fGraph shows the percentage of eMyHC positive fibres. Data are presented as mean values +/- SEM (n= 5 biological repli- cates). g Sirius red staining performed on TA muscles. Scale bar: 50 µm. h Graph shows the percentage of fibrotic area in the different conditions. Data are pre- sented as mean values +/- SEM (n = 7 biological replicates). Statistical analysis was performed using one-way ANOVA followed by Tukey’s post hoc test in all panels. Figure 4a was created in BioRender. Somoza, Á. (2024). https://BioRender.com/ w38k062. Article https://doi.org/10.1038/s41467-024-55223-9 Nature Communications | (2025) 16:577 7 https://BioRender.com/w38k062 https://BioRender.com/w38k062 www.nature.com/naturecommunications mice with scr- or α7/β1 AuNPs conjugated to a C. elegans specific miRNA, ce-miR-39. ThismiRNAwas initially used insteadofmiR-206 to avoid interference with endogenous miRNAs, as it is not expressed in any Mus musculus tissue. The results shown in Fig. 5e confirmed that α7/β1 AuNPs can efficiently reach skeletal muscle (both hindlimb muscles and diaphragm) 24 h after injection, delivering as a cargo an exogenous ce-miR-39 and confirming the validity of our system as an efficient platform for miRNA release into skeletal muscle tissue of dystrophic mice. Systemic delivery of α7/β1 AuNPs miR-206 stimulates skeletal muscle regeneration and improves muscle functionality in D2- mdx mice Once assessed that the α7/β1 AuNPs efficiently target skeletal muscle and can be used for the delivery of miRNA mimics, we investigated whether systemic treatment with α7/β1 AuNPs containing the ther- apeutic miRNA miR-206 promotes skeletal muscle regeneration and functional recovery in dystrophic mice. To this end, we treated 8-weeks old D2-mdx mice with aptamer-conjugated AuNPs containing a c d 0 20 40 60 80 100 200 400 600 800 1000 Gastrocnemius R el at iv e ex pr es si on (c e- m iR -3 9) ns ns 0 20 40 60 Diaphragm R el at iv e ex pr es si on (c e- m iR -3 9) PBS scr AuNPs miR-39 7/ 1 AuNPs miR-39 ns ns e b Gas tro cn em ius Qua dri ce ps Tric ep s TA Hea rt Sple en Liv er Lu ng Brai n 0 5×107 1×108 1.5×108 p/ s PBS scr AuNPs 7/ 1 AuNPs Gas tro cn em ius Qua dri ce ps Tric ep s TA Hea rt Sple en Liv er Lu ng Brai n Kidn ey 0 2×108 4×108 6×108 8×108 p/ s PBS scr AuNPs 7/ 1 AuNPs PBS 7/ 1 AuN Ps cy 5 PBS 7/ 1 AuN Ps cy 5 PBS 7/ 1 AuN Ps cy 5 0 5 10 15 20 25 cy 5 po si tiv e ce lls (% ) MuSCs FAPs Lineage positive PBS scr TA Gastrocnemius Quadriceps Triceps Lung Heart Liver Spleen Kidney Brain Gas tro cn em ius Hea rt Kidn ey Sple en Liv er 0 5 10 15 20 g Au /m g or ga n PBS scr AuNPs 7/ 1 AuNPs SS H Cy5 MuSCs FAPs Lineage positive PB S Au N Ps C y5 Article https://doi.org/10.1038/s41467-024-55223-9 Nature Communications | (2025) 16:577 8 www.nature.com/naturecommunications eithermiR-206 or a control oligonucleotide (oligodT), once a week for up to 5 weeks (AuNPs concentration: 33.6 nM; final oligonucleotide dose: 0.75mg/kg per injection). We first confirmed by qRT-PCR experiments that α7/β1 AuNPs miR-206 efficiently target skeletal muscles when injected in the caudal vein. Our results show an increase in miR-206 levels in hindlimb muscles (quadriceps) (Sup- plementary Fig. 6a) and diaphragm (Supplementary Fig. 6b) isolated from α7/β1 AuNP miR-206 treated mice, as compared to control AuNPs and PBS-treated animals. Moreover, we confirmed that α7/β1 AuNPs selectively target MuSCs, as shown by the increase in miR-206 levels in those cells, but not in other muscle-resident populations, such as FAPs ormacrophages, that were co-isolated by FACS (Fig. 6a). We also observed that control AuNPs (which do not containmiR-206) could partially stimulate the expression of endogenous miR-206 both in hindlimb skeletal muscle (Supplementary Fig. 6a) and in MuSCs (Fig. 6a). This observation is consistent with our ex vivo data showing partial stimulation of MuSCs with α7/β1 AuNPs oligodT (Fig. 3c, d) and is probably due to the intrinsic ability of AuNPs to activate muscle cells52. Then, we investigated the effect of systemic treatment with α7/β1 AuNPsmiR-206 on skeletal muscle regeneration and functional recovery in D2-mdx mice. Immunofluorescence analysis in gastro- cnemius, quadriceps, triceps, TA, and diaphragm showed that intravenous delivery of α7/β1 AuNPs miR-206 induces a significant increase in the number of regenerating eMyHC-positive fibres, as compared to PBS-treated animals and mice injected with control AuNPs (α7/β1 AuNPs oligodT) (Fig. 6b, c and Supplementary Fig. 7). On the other hand the number of fibres per section, as well as their average calibre, remained unchanged within the different experi- mental groups (Supplementary Fig. 8). Moreover, the increase in the number of regenerating myofibres does not correlate with an increase in tissue necrosis (Supplementary Fig. 9), suggesting that regeneration is not due to an exacerbated muscle damage due to the treatment but instead to the ability of the released miR-206 to sti- mulate MuSCs-mediated regeneration. Moreover, consistent with a highly selective effect of the treatment towards the skeletal muscle lineage, we did not observe any change in the amount of fibrotic deposition (Supplementary Fig. 10). Finally, to demonstrate that the increased regeneration has a functional outcome on muscle functionality and strength, we per- formed a forelimb grip strengh test. For these experiments, mice were treated once a week, for 5weeks, with intravenous delivery of α7/β1 AuNPs oligodT, α7/β1 AuNPs miR-206 or PBS. Forelimb strength was measured once a week using a grip strength meter (Bioseb Bio GS-3) and normalized by the weight of the animal. The results show that treatment with α7/β1 AuNPs miR-206 increases maximal normalized strength (Fmax) as compared to control animals treated with either PBSorwithα7/β1 AuNPsoligodT (Fig. 6d).While longer treatmentswill be needed to define the long-term effect and therapeutic window of action better, altogether these results demonstrate that systemic delivery of α7/β1 AuNPs efficiently target MuSCs, stimulating their regeneration potential and improving the functionality of dystrophic muscles. α7/β1 AuNPs have an intrinsic ability to stimulate MuSCs proliferation To get mechanistic insights on α7/β1 AuNPs miR-206 mechanism of action, and to address if increased muscle regeneration is due to the ability of the α7/β1 AuNPs miR-206 to modulate MuSCs function in vivo, we performed immunofluorescence experiments on trans- versal muscle sections of gastrocnemius muscles using antibodies against PAX7, MYOD and the proliferationmarker KI67. Our data show that treatment with α7/β1 AuNPs (either oligodT or miR-206) does not significantly change the total number of PAX7-positiveMuSCs perfibre as compared to PBS-treated animals (Fig. 7a, b) but increases the percentage of proliferating, KI67/PAX7 double positive MuSCs (Fig. 7c). This indicates that the α7/β1 AuNPs per se can activate the MuSCs compartment in dystrophic mice, without leading to an exhaustion of the MuSCs compartment in the timeframe analyzed. Moreover, treatment with α7/β1 AuNPs miR-206, but not with α7/β1 AuNP oligodT, increases the percentage of MYOD/PAX7 double posi- tive MuSCs (Fig. 7d, e), showing that the released miR-206 can induce MuSCs differentiation, as expected from our ex vivo data (Fig. 3). This was further confirmed by measuring the differentiation index of MuSCs isolated from control or α7/β1 AuNPsmiR-206 treated animals. The results shown in Supplementary Fig. 11 show that in vivo treatment with α7/β1 AuNPs miR-206 through systemic delivery increases the in vitro differentiation potential of isolated MuSCs, measured as the percentage of nuclei contained in MyHC-positive myofibres. The results shown so far indicate that systemic delivery of aptamer-conjugated AuNPs containing miR-206 increases skeletal muscle regeneration in dystrophic mice, through modulation of both MuSCs proliferation (mediated by the AuNP) and differentiation (mediated by the cargo, miR-206). α7/β1 AuNPs present a safety profile compatible with repetitive dosing We finally assessed the safety profile of our nanoplatform. It is gen- erally accepted that AuNPs are non-toxic, and some of them are currently under investigation in clinical trials33–36. However, given the need for repetitive dosing in our model, we checked if the treatment scheme and doses used to obtain a functional effect with our α7/β1 AuNPs (Fig. 6d) may have a detrimental effect on the animals due to accumulated toxicity. To this end, we measured animal welfare and growth during the whole duration of the experiments, and we per- formed histological analysis of different organs after 5 weeks of treatment. Our results confirmed that weekly treatment with aptamer-conjugated AuNPs (AuNPs concentration: 33.6 nM; oligo- nucleotide dose: 0.75mg/kg per injection) did not lead to alterations in overall animal growth (Supplementary Fig. 12a) and did not show any sign of toxicity in organs such as liver and kidney, the main organs for AuNPs and oligonucleotide clearance, respectively (Sup- plementary Fig. 12b). We also investigated if treatment with the α7/β1 AuNPs alters the inflammatory infiltrate in dystrophic muscles. Flow cytometry analysis showed that treatment with either control or α7/β1 AuNPs miR-206, injected systemically does not modulate the overall recruitment of Fig. 5 | α7/β1 AuNPs efficiently target skeletal muscles, including the dia- phragm, when injected into the bloodstream. a Fluorescence imaging (IVIS) of the indicated muscles and organs 24 h after a single IV injection of α7/β1 or scrambleAuNPs containing oligodT-cy5. PBS-treated animals are used as a negative control. b Signal intensity measured as photons per second (p/s) Data are pre- sented as mean values +/- SEM (n = 4 biological replicates). Statistical analysis was performed using one-way ANOVA followed by Tukey’s post hoc test. c ICP-MS on gastrocnemius, heart, kidney, liver and spleen isolated from in D2-mdx mice 24h after systemic delivery of α7/β1 or scramble AuNPs. Graph show the normalized amount of gold (inμg) per organweight. Data are presented asmeanvalues +/- SEM (n = 5 biological replicates). Statistical analysis was performed using two-way ANOVA followed by Tukey’s post hoc test. d Representative flow cytometry plot showing the amount of cy5-positive cells onMuSCs, FAPs and lineage-positive cells after a single IV injection of α7/β1 AuNPs cy5. Graph shows the percentage of cy5- positive cells in the different populations. Data are presented as mean values +/- SEM (n = 3 biological replicates). Statistical analysis was performed using two-way ANOVA followed by Tukey’s post hoc test. e qRT-PCR showing the relative levels of ce-miR-39 normalized against the small nuclear RNA U6 in the gastrocnemius and diaphragmofD2-mdxmice after systemicdeliveryofα7/β1 or scrambleAuNPsmiR- 39. PBS-treated mice are used as a control. Data are presented as mean values +/- SEM (n = 8 biological replicates). Statistical analysis was performed using one-way ANOVA followed by Kruskal-Willis post hoc test. Article https://doi.org/10.1038/s41467-024-55223-9 Nature Communications | (2025) 16:577 9 www.nature.com/naturecommunications hematopoietic cells to dystrophic muscles (Fig. 8a, b), or the percen- tage of F4/80 CD11b double positive cells, representing the macro- phage population (Fig. 8c, d). Immunofluorescence analysis confirmed these data, showing that the percentage of F4/80 positive area in dystrophic muscles is not altered by the treatments (Fig. 8e, f). In summary, our data show that the muscle selective nanoplat- form described here represents a suitable delivery system for oligo- nucleotide release intodystrophicMuSCs. Suchplatform,whichallows repetitive dosing without eliciting a toxic or immunogenic response, was successfully used to deliver miRNAs mimics (ie. miR206) in a mouse model of DMD. Systemic treatment through intravenous delivery of the α7/β1 AuNP-miR206 stimulated muscle regeneration in D2-mdx mice, leading to a functional recovery of muscle strength. Mechanistically, our results show that this is achieved through a combined effect of the nanotherapy in the modulation of the pro- liferation and differentiation potential of MuSCs. Discussion The delivery of therapeutic oligonucleotides is a promising strategy for many muscle disorders. However, it presents several caveats, including low in vivo stability, uneven efficacy, and poor targeting of skeletal muscle tissue6. While some issues, like nucleic acid stability, can be addressed through chemical modifications60, efficacy highly depends on selective and efficient tissue targeting. In the case of skeletalmuscle, this is particularly challenging, due to the extent of the target tissue and the need to reach all muscles in the body. Different types of nanoparticles have been tested in the past few years as delivery systems formuscle disorders, and the first proof-of-principles in animal models are now showing promising results53,61. Despite these studies strongly support the idea that conjugating oligonucleotides to a wide array of nanocarriers may improve their bioavailability and therapeutic action, efficient tissue up-taking and MuSCs targeting still needs to be solved. ba c La m in in /e M yH C /D AP I AuNPs oligodT AuNPs miR-206PBS d MuSC FAP MP 0 10 20 30 40 R el at iv e ex pr es si on (m iR -2 06 ) PBS 7/ 1 AuNPs oligodT 7/ 1 AuNPs miR-206 0 7 14 21 28 35 1 2 3 4 Days from experiment start gF /g (m ea n ± SD ) PBS 7/ 1 AuNPs oligodT 7/ 1 AuNPs miR-206 ** #### **** FMax 0 5 10 15 eM yH C po si tiv e fib re s (% ) ns 0 5 10 15 eM yH C po si tiv e fib re s (% ) ns 0 2 4 6 8 eM y H C po si tiv e f ib re s (% ) ns 0 2 4 6 8 10 eM yH C po si tiv e f ib re s ( % ) ns 0 2 4 6 8 10 eM yH C po si tiv e fib re s (% ) PBS 7/ 1 AuNPs oligodT 7/ 1 AuNPs miR-206 ns DiaphragmTATricepsQuadricepsGastrocnemius Fig. 6 | α7/β1 AuNPs miR-206 selectively target MuSCs in dystrophic mice, stimulate muscle regeneration and improve muscle function. a qRT-PCR showing the levels of miR-206 normalized against the levels of endogenous small nuclear RNAU6 in the indicatedmuscle-resident cell populations. Cells were isolated by FACS from gastrocnemius muscles of dystrophic mice treated via intravenous injection with PBS or with control or α7/β1 AuNPs miR-206 for 3weeks. Data are presented as mean values +/- SEM (n = 5 animals per group). b Immunofluorescence staining for eMyHC-(red) and laminin (green) in skeletal muscle (gastrocnemius) of mice treated via intravenous injections of the indicated AuNPs, once a week for 5weeks. Nuclei were counterstained with DAPI (blue). Scale bar: 50μm. c Graph shows the quantifications of the percentage of eMyHC positive fibres in the gas- trocnemius, quadriceps, triceps, TA and diaphragm of the same mice as in (b). Data are presented as mean values +/- SEM (n=8 biological replicates for the gastro- cnemius and tibialis; n= 6 for the quadriceps, triceps and diaphragm). d Graph showing the normalizedmaximal strength (Fmax) of the same animals as in (b). Data are presented as mean values +/- SEM (n= 8 biological replicates). Statistical analysis was performed using one-way ANOVA followed by Tukey’s post hoc test in all panels. In panel (d) **** indicates statistically significant differences between α7/β1 AuNPs miR-206 and untreated animals; #### indicates statistically significant differences between α7/β1 AuNPs miR-206 and α7/β1 AuNPs oligodT. Article https://doi.org/10.1038/s41467-024-55223-9 Nature Communications | (2025) 16:577 10 www.nature.com/naturecommunications nini maL / /7XAP KI 67 PA X7 KI 67 AuNPs oligodT AuNPs miR-206PBS ba c e 0 20 40 60 P A X7 + M YO D + / PA X7 (% ) ns PBS 7/ 1 AuNPs oligodT 7/ 1 AuNPs miR-206 PA X7 M YO D ni ni maL / /7XAP M YO D AuNPs oligodT AuNPs miR-206PBSd 0 5 10 15 P A X7 + ce ll s pe r1 00 f ib re s PBS 7/ 1 AuNPs oligodT 7/ 1 AuNPs miR-206 0 20 40 60 PA X7 + K I 6 7 +/ PA X7 ( % ) ns PBS 7/ 1 AuNPs oligodT 7/ 1 AuNPs miR-206 Fig. 7 | α7/β1 AuNPs stimulate MuSCs proliferation in a cargo-independent manner. a Immunofluorescence for PAX7 (red) and KI67 (green) staining in gas- trocnemius of D2-mdx mice treated with intra-venous injections of PBS, α7/β1 AuNPs oligodT or α7/β1 AuNPs miR-206 (n = 7 per group). Nuclei were counter- stained with DAPI (blue). Scale bar: 20μm. b Graph showing the number of PAX7- positive cells per 100 fibres in (a). Data are presented asmean values +/- SEM (n = 7 biological replicates per group). c Graphs showing percentage of KI67/ /PAX7- double positive cells over total PAX/7-positive cells. Data are presented as mean values +/- SEM (n = 7 biological replicates per group). d Immunofluorescence for PAX7 (red) and MYOD (green) staining in gastrocnemius of D2-mdx mice treated with intravenous injections of PBS, α7/β1 AuNPs oligodT or α7/β1 AuNPs miR-206. Scale bar: 20μm (e) Graphs showing percentage of MYOD//PAX7-double positive cells over total PAX/7-positive cells. Data are presented as mean values +/- SEM (n = 7 biological replicates per group). Statistical analysis was performed using one-way ANOVA followed by Tukey’s post hoc test in all panels. Article https://doi.org/10.1038/s41467-024-55223-9 Nature Communications | (2025) 16:577 11 www.nature.com/naturecommunications Tissue selectivity can be achieved using muscle-targeting mole- cules, such as peptides, antibodies, enzymes, or aptamers62,63. Some of these molecules have been tested in cell lines64,65, or in vivo66,67. How- ever, none of these strategies has proven effective in targetingMuSCs, the cells responsible for muscle regeneration. Recently, a ground- breaking work from Millay’s lab demonstrated that engineered lenti- viruses containingmuscle fusogenic genes can target activatedMuSCs and can be used for muscle gene delivery68. However, although viral vectors are commonly used in gene therapy, there are still concerns regarding their safety, including immunogenicity or, in the case of lentiviruses, random integration within the genome. Here, we describe a muscle-targeting aptamer that can be used in combination with nanoparticles for the selective delivery of ther- apeutic oligonucleotides into skeletal muscle tissue, with a high affinity for the MuSCs compartment. Aptamers are a class of nucleic acid ligands, with usually a high binding affinity to the target molecule69. The muscle-targeting aptamer described here was designed against the α7/β1 integrin dimer, a surface protein highly enriched in striated muscles40,41. Consistently with the α7/β1 integrin expression patterns, Alexa594 5’ end-labelled α7/β1 aptamer effi- ciently recognizes skeletal muscle fibres and MuSCs both in transversal muscle sections, bulk muscle-resident cell populations, and isolated single myofibres. Recently, another muscle-specific aptamer was identified using a cell internalization SELEX process. This aptamer was shown to internalize into muscle fibres when injected locally in the TA muscle. However, the specificity of this aptamer upon systemic delivery, and its ability to target the MuSC compartment have not been addressed70. In this work, we show that α7/β1 aptamer-conjugated AuNPs efficiently target MuSCs and restore their ability to regenerate dys- trophicmuscles, after either local or systemicdelivery inD2-mdxmice. D2-mdx mice were used in this work due to their more severe dys- trophic phenotype as compared to mdx in the C57/Bl10 background14. Conjugation of the therapeuticmiR-206, a muscle-specificmiRNA that stimulates MuSCs function through a paracrine mechanism25, improves skeletal muscle regeneration in dystrophic mice. On the other hand, it does not affect other histopathological parameters, such as necrosis, inflammation, or fibrotic deposition. This is not surprising as our data show that the α7/β1 AuNPs are not cytotoxic and do not target othermuscle-resident cell populations, such as FAPs or immune cells. Although it was previously shown that MuSC-derived miR-206 plays an anti-fibrotic role in response to hypertrophic stimuli71, our fe c d ba AuNPs oligodT AuNPs miR-206PBS FS C -A CD45, CD31, TER119 PB FS C -A CD45, CD31, TER119 PB FS C -A CD45, CD31, TER119 PB F4 /8 0 PE EP 08/4F F4 /8 0 PE CD11b PC7CD11b PC7CD11b PC7 AuNPs oligodT AuNPs miR-206PBS 0 20 40 60 80 Li ne ag e p o si tiv e (% ) PBS 7/ 1 AuNPs oligodT 7/ 1 AuNPs miR-206 0 20 40 60 80 M ac ro ph ag es (% ) PBS 7/ 1 AuNPs oligodT 7/ 1 AuNPs miR-206 nini maL /F 48 0/ D AP I 0 1 2 3 4 F4 /8 0 po si tiv e ar ea (% ) PBS 7/ 1 AuNPs oligodT 7/ 1 AuNPs miR-206 AuNPs oligodT AuNPs miR-206PBS Fig. 8 | Systemic treatment with α7/β1 AuNPs miR-206 does not alter the inflammatory infiltrate in D2-mdx mice. a Representative flow cytometry plot showing lineage (CD45, CD31, TER 119) positive and negative cells on gastro- cnemiusmuscles obtained frommice treatedwith PBS,α7/β1 AuNPs oligodTorα7/ β1 AuNPsmiR-206.bPercentage of lineage positive cells in thedifferent conditions, analyzed by flow cytometry in (a) (n = 6). c Representative flow cytometry plot showing F4/80 and CD11b positive cells (macrophages) on the lineage-positive populationdescribed in (a).dPercentageof F4/80andCD11bpositive cells over the total lineage positive cells, analyzed by flow cytometry in (c). Data are presented as mean values +/- SEM (n = 6 biological replicates). e Immunofluorescence staining for F4/80 (red) and laminin (cyan) in the gastrocnemius of mice treated via intra- venous injection with PBS or with control or α7/β1 AuNPs miR-206. Scale bar: 500 μm. f Graph shows the percentage of F4/80-positive area in the different conditions. Data are presented as mean values +/- SEM (n = 7 biological replicates). Statistical analysis was performed using one-way ANOVA followed by Tukey’s post hoc test in all panels (no statistically significant differences were observed). Article https://doi.org/10.1038/s41467-024-55223-9 Nature Communications | (2025) 16:577 12 www.nature.com/naturecommunications data demonstrate that this is not the case when miR-206 is delivered ectopically into dystrophic MuSCs. On the other hand, despite α7/β1 integrin was previously descri- bed to be expressed in cardiac muscle, our biodistribution experi- ments using two different methodologies did not show a consistent accumulation of α7/β1 AuNPs in this tissue. Moreover, the results shown in this work suggest that the preferred selectivity towards skeletal muscle could be due to different levels of α7/β1 integrin dimers in the two tissues. In particular, while α7 and β1 integrin are present in skeletal muscle fibres and MuSCs, this integrin dimer is undetectable in cardiac tissues in the model used, the dystrophic D2- mdx mice. However, further studies are needed to investigate if the difference in the levels of these proteins is species or strain specific. In addition to the targeting aptamer, a second advantage of the developed nanoplatform arises from its tailored design, based on the use of thiol bonds for oligonucleotide incorporation. This leads to preferential intracellular release, which is mediated by the high glu- tathione (GSH) levels72. GSH inside the cells is foundwithin the rangeof 0.5–10mM, with the higher levels observed in liver and skeletal mus- cle, whereas extracellular values are one to three orders of magnitude lower73–75. This GSH-dependent release, combined with the muscle- specific α7/β1 aptamer, allowed selective release of a functional miR- 206 mimic into muscle cells, upon intravenous injection of the func- tionalized AuNPs76. Finally, a commonbottleneckwhen exploring the use of inorganic nanoparticles for therapeutic purposes regards their safety profile. In this sense, AuNPs stem out as a versatile delivery system due to their almost absence of toxicity and low immunogenicity77, which has led to the initiation of several clinical trials and FDA approval for medical applications78. This is consistent with our results showing that α7/β1 AuNPs containing miR-206 did not alter mice growth, nor induce alterations in organs such as liver and kidney. In addition, the treat- ment did not target or modulate the activity of muscle-resident mac- rophages. Although we have not fully addressed it here, the pharmacokinetics and safety profile of similar AuNPs in mice have been studied by other groups35,36,79. Despite being highly inert from an immunogenic profile, our data show that in vivo treatment with control nanoparticles, which do not contain the therapeutic miRNA, is enough to promote activation of MuSCs in dystrophic mice, as shown by the increase in the number of PAX7/KI67 double positive MuSCs with both α7/β1 AuNP oligodT and α7/β1 AuNP miR-206. Moreover, we also observed a slight (although not statistically significative) increase in the number of regenerating fibres when treating with control α7/β1 AuNP as compared to PBS in some of the muscles analysed. This is then further increased when the α7/β1 AuNPdeliver a functionalmiR-206. Similar resultswereobserved ex vivo when we treated freshly isolatedMuSCs cells with α7/β1 AuNPs oligodT. These observations are consistent with published data showing that internalization of gold, and gold-silver nanoparticles enhancesmyogenicdifferentiation andpromotesmuscle regeneration in vivo52. It was previously shown that enhanced myogenic differ- entiation by such nanoparticles was dependent on activation of the p38α signalling pathway52, a key cascade regulating MuSCs function and skeletal muscle regeneration54. Although further studies are necessary to elucidate the mechanisms of action on MuSCs activation by the α7/β1 AuNPs described here, our data suggest that our nano- platform could have a positive role in regulating MuSCs function by itself, which is then further potentiated by their therapeutic cargo. Altogether, the results presented here point out to the first directed nanoplatform that efficiently targets MuSCs when delivered systemically. We demonstrate here that aptamer-modified AuNPs can be used to deliver oligonucleotides into skeletal muscle in vivo, increasing muscle regeneration and improvingmuscle functionality in a mouse model of DMD. While in this work we delivered the ther- apeutic miR-206 mimic as a proof-of-principle, the versatility of our nanoplatform stems from thepossibility of conjugating different types of oligonucleotides, such as antagomiRs, ASOs, or siRNAs, therefore amplifying its potential as a suitable delivery platform for a wide array of therapeutic molecules for muscle disorders. Methods SELEX experiments Cross-over SELEX with random region of 40 deoxyribonucleotides (A,T,G,C) was carried out. DNA aptamer library containing ~1014 ran- dom oligonucleotides were considered as a starting pool for this SELEX. The sequence of the aptamer library is: 5’ GCCTGTTGTGAGCCTCCTGTCGAA –N40- TTG AGC GTT TAT TCT TGT CTC CC 3’ and forward primer 5’- GCC TGT TGT GAG CCT CCT GTC GAA -3’ and reverse primer 5’- GGGAGACAAGAATAAACGCTCAA -3’ to amplify eluted pools after each round. We have started with 500 picomoles of aptamer library and 10 picomoles of histidine tagged integrin α7/β1 which was immobilized on Ni-NTA beads. His-GST pro- teinwasused as a counter selection in each protein-SELEX round. After initial 4 rounds of protein SELEX, we moved to cell SELEX where around 7.5×106 C2C12 cells were used. As the rounds proceeded, selection pressure was introduced by varying the pool and target ratio and more stringent washing conditions. After 14 rounds of the evolu- tion process, we have sequenced each pool by Illumina Next Genera- tion sequencing (NGS). We obtained 89% to 95% of the pool which are sequences with 40 nucleotides(random region). After MAFFT analyses (multiple sequence alignment) we found the top 10 clusters corre- spond to 26% of the total sequences and good evolution pattern was observed. After motif analyses, we selected 8 sequences for further binding studies. The aptamer library, the primers, NGS indexes used for SELEX experiments and biotinylated aptamer candidates were obtained from Eurogentec, Belgium. Surface Plasmon Resonance Surface Plasmon Resonance (SPR) assay was performed to assess the binding affinity of the candidate aptamer sequences to α7/β1 integrin protein. Typically, biotinylated aptamer candidates were immobilized onto the streptavidin chip (CM5) and analysed by Biacore 3000 (GE Healthcare). In this assay, the kinetics rate of the association and dis- sociation of the aptamer-protein complex and the binding constant were also evaluated. Initially, we immobilised 10 µM of biotinylated aptamers and 3.3 µMof proteinwas injected. After initial screening of 8 candidates, we performed the saturation studies of the best binding aptamer sequence. Next, we truncated the best candidate sequence, and measured the binding constant of the truncated candidate. AuNPs synthesis and functionalization AuNPs were synthesized following the Turkevich method. Briefly, a solution of 945.2 µM hydrogen tetrachloroaurate (III) hydrate in RNAse-free water was stirred and heated at 140 °C under reflux until boiling. Then, a solution of 40mM sodium citrate tribasic was added, and the mixture was stirred for 15min. Afterwards, the solution was allowed to reach room temperature and then the as-synthetizedAuNPs were first filtered through a 0.3 µm fritted filter, followed by a second filtration through a 0.22μm PES filter. AuNPs concentration was cal- culated using the Beer-Lambert law from the value of absorbance at 520nm, and employing an extinction coefficient of 2.7 × 108 for 13 nm nanoparticles80. The different oligonucleotides were purchased from Integrated DNA Technologies (IDT, Coralveille, USA). AuNPs were functionalized with aptamers anddifferent oligonucleotides suchasmicroRNAs (miR- 206, miR-39), imaging oligonucleotides (oligodT-cy5). These oligonu- cleotides were dsRNA or ssDNA, with the passenger strand modified with a thiol group linker (sequences below). A general protocol for the formulation of oligonucleotide-functionalizedAuNP is as follows. First, the thiol group from the oligonucleotide is decaged by incubating Article https://doi.org/10.1038/s41467-024-55223-9 Nature Communications | (2025) 16:577 13 www.nature.com/naturecommunications them with an excess of tris(2-carboxyethyl) phosphine hydrochloride (100 eq) for 2 h at room temperature. Then, the oligonucleotides are added to the AuNP solution, vortexed, and shaken for 20min. After that, a 5M NaCl solution is sequentially added every 20-30min until a final concentration of0.3M is reached.Of note, the nanoparticles need to be quickly vortexed after each salt addition to avoid aggregation. Afterward, the nanoparticles are shaken overnight and subsequently centrifuged and washed 3 times with water. The oligonucleotide loading is calculated from the supernatant of the first centrifugation. Finally, the nanoparticles are redispersed in RNA-free water and stored in the fridge until used37. AuNPs oligonucleotide loadings were 2 ± 0.1 µM. AuNPs concentration in all groups was adjusted to 33.6 nM and they were filtered with a syringe filter 0.2 µm in a laminar flow hood. Cargo oligonucleotides sequences Cargo Sequence (5’→3’) miR-206 UGGAAUGUAAGGAAGUGUGUGG CCACACACUUCCUUACAUUCCATTTTT thiol miR-39 UCACCGGGUGUAAAUCAGCUUG CAAGCUGAUUUACACCCGGUGATTTTT thiol oligodT(22) TTTTTTTTTTTTTTTTTTTTTT thiol oligodT (37) Cy5 Thiol TTTTTTTTTTTTTTTTTTTTTT TTTTTTTTTTTTTTT Cy5 TEM AuNPs size and shape were examined by transmission electron microscopy (TEM) in a JEOL JEM 101, operating 100 kV. For that pur- pose, a drop of AuNPs dilution was placed onto a carbon-coated copper grid and allowed to dry. The size distribution was calculated manually by measuring the mean size of 200 particles with Image J Software81. Hydrodynamic size The hydrodynamic size was measured on a Dynamic Light Scattering (DLS) DLS Zeta Sizer Nano-ZS (Malvern Instruments, UK). For that purpose, AuNPs were diluted to a final concentration of 1 nM in water and the measurements were performed in a standard cuvette for 12 runs of 60 s each 25 °C using a laser at 633 nm. Z-potential The Z-potential was measured by DLS Zeta Sizer Nano-ZS (Malvern Instruments). AuNPs were diluted in water solution at 1 nM. NaCl was added until its concentration reached 5mM. Then, the nanoparticles were measured in a Z-potential cell (Malvern Instruments) at 25 °C. AuNPs displaying a protein corona were prepared following the sucrose cushion step shown below in section Protein corona. After that centrifugation step, the nanoparticles were redispersed following the same rationale of the uncoated AuNPs. Protein corona The therapeutic candidate containingmiR-206 and α7/β1 aptamer was subjected to protein corona studies. For that purpose, a solution of nanoparticles in RNAase-free water (150 µL, 7.73·1011 particles) was incubated with 150 µL of the corresponding plasma at 37 °C for 5min. Afterwards, the mixture was loaded onto a sucrose cushion (2 × 1mL, 0.7M in PBS) and centrifuged (1 h, 18400g, 4 °C). Then, the super- natantwasdiscarded, and the nanoparticleswere collected inone tube using 1.2mL of PBS and centrifuged again (1 h, 18400 g, 4 °C). This step was carried out twice. Finally, the nanoparticles were dispersed in PBS and stored in the freezer until the different analyses were carried out. The protein corona formed was detached from the surface immedi- ately before the different experiments (SDS-PAGE or mass spectro- metry) were carried out to prevent the proteins from adsorbing again onto the gold surface. For the SDS-PAGE, 25 µL of the corresponding sample weremixed with 25 µLof a solution containingdithiothreitol (200mM) and sodium docecyl sulfate (100mM). Then, the samples were placed in a ther- moshaker at 90 °C for 10min. Then, 25 µL of the previously heated solutions were mixed with 25 µL of 2x Laemmli sample buffer and immediately injected into the corresponding well of a 10% poly- acrylamide gel. The samples were run at a constant voltage of 140V, stained with Coomassie blue, and imaged in a Chemidoc Imaging Instrument (Bio-Rad Laboratories). The mass spectrometry was carried out at the Proteomics Facility of the Spanish National Centre for Biotechnology (CNB), using an Orbitrap Exploris 240 mass spectrometer and the Proteome Dis- coverer software. The first step was the tryptic digestion. Briefly, the samples (n = 3) were diluted with lysis buffer (5% sodium dodecyl sul- fate (SDS), 50mM triethylammonium bicarbonate (TEAB)). Then, samples were reduced and alkylated with 5mM tris(2-carboxyethyl) phosphine (TCEP) and 10mM chloroacetamide (CAA) for 30° min at 60 °C. Protein digestion in the S-trap filter (Protifi, Huntington, NY, USA)was carried out according to themanufacturer’s instructionswith minormodifications82. Samples were digested overnight at 37 °C using a protein:trypsin ratio of 15:1, and further cleaned with a StageTip C18 prior to LC-ESI-MS/MS analysis. After desalting the above-mentioned samples, Qubit™ Fluorometric Quantitation (Thermo Fisher Scientific) was employed to determine peptide concentration. Afterwards, 500 ng of the corresponding samplewere subjected to 1D-nano LC ESI- MS/MS (LiquidChromatography Electrospray IonizationTandemMass Spectrometric) analysis employing an Ultimate 3000 nano HPLC sys- tem (Thermo Fisher Scientific) coupled online to an Orbitrap Exploris 240 mass spectrometer (Thermo Fisher Scientific). The peptides were eluted onto a 50 cm× 75 μmEasy‐spray PepMapC18 analytical column at 45 °C and separated at a flow rate of 250 nL/min using a 40min gradient ranging from2% to95%mobilephaseB (mobile phaseA: 0.1% formic acid (FA); mobile phase B: 100 % acetonitrile (ACN), 0.1 % FA). The injection volume was 5 µl and the loading solvent 2 % ACN in 0.1 % FA. Data acquisition was carried out employing a data-dependent top-20 method, in full scan positive mode, scanning 350 – 1200m/z. Survey scans were acquired at a resolution of 60,000 at m/z 200, with Normalized Automatic Gain Control (AGC) target (%) of 300 and a maximum injection time (IT) of 40ms. The top 20 most intense ions from each MS1 scan were selected and fragmented via Higher- energy collisional dissociation (HCD). Resolution for HCD spectra was set to 45,000 at m/z 200, with AGC target of 200 and maximum ion injection time of 120ms. Isolation of precursors was performed with a window of 1m/z, exclusion duration (s) of 45 and the HCD collision energy was 32. Precursor ions with single, unassigned, or six and higher charge states from fragmentation selection were dis- carded. Raw instrument files were processed using Proteome Dis- coverer (PD) version 2.5.0.400 (Thermo Fisher Scientific). MS2 spectra were searched using Mascot Server v2.8.0 (Matrix Sci- ence, London, UK) against a Mus musculus UniProtKB database (20190314, 22,356 sequences) containing the most common labora- tory contaminants (cRAP database with 70 sequences). All searches were configured with dynamic modifications for pyrrolidone from Q (-17.027Da) and oxidation ofmethionine residues ( + 15.9949Da) and static modification as carbamidomethyl ( + 57.021 Da) on cysteine, monoisotopic masses, and trypsin cleavage (max 2 missed clea- vages). The peptide precursor mass tolerance was 10 ppm, and MS/ MS tolerance was 0.02 Da. The false discovery rate (FDR) for pro- teins, peptides, and peptide spectral matches (PSMs) peptides was kept at 1%. Overall, proteins were identified with >1 unique peptides Article https://doi.org/10.1038/s41467-024-55223-9 Nature Communications | (2025) 16:577 14 www.nature.com/naturecommunications with minor exceptions. Those proteins that did not appear in the three replicates were discarded. Precursor ion quantitation was carried out in Proteome Dis- coverer as well, using the “Minora” feature in the processing method and the “FeatureMapper” and “Precursor Ions Quantifier” nodes in the consensus step. Protein abundances were calculated by summing sample abundances of the connected peptide groups (using unique +razor peptides). Cell lines C2.C12 (C2C12) cells were obtained from ATTC and cultured in growth medium (GM) (DMEM without pyruvate (#61965-026, Gibco)), sup- plemented with 10% of FBS (#16000044, Gibco). Cells were incubated with the different AuNPs at the final concentration indicated in each experiment and then collected for cytofluorimetric analysis, confocal microscopy, luciferase reporter and cytotoxicity assays as described below. Cytotoxicity assay C2C12 cells were seeded in 96-well plates (10000 cells/well) and trea- ted at 60 % confluency with the indicated AuNPs at different con- centrations (0.1, 1, 2.5, 5, 10 and 20nM) in GM medium. After 24 h of incubation, cells were washed twice with PBS to remove the non- internalized nanoparticles. Then, cell viability wasmeasured 72 h after the treatment using a solution of resazurin sodium salt (1% v/v; Sigma Aldrich) in GM medium to the cells as a reported. After 3 h in the incubator, the fluorescence of the media was measured in a Synergy H4 microplate reader (λex: 550 nm, λem: 590nm). The fluorescence intensity measurements were processed according to the equation: %cell viability = sample data� negative control positive control� negative control � � × 100 Luciferase reporter assay MiR-206 sequence was cloned in pmirGLO dual luciferase reporter (Promega) according to the manufactured specifications. For that purpose, 100 ng/well miR-206 pmirGLO plasmid were transfected in C2C12 cells using lipofectamine following manufacturer indications. After 4 h, the cells were washed and treated with 1 nM of AuNP miR- 206. 24 h later, the cells were lysed, and the kit Dual-luciferase reporter assay system (Promega) was used in a plate reader SynergyH4 (Biotek) according to the manufactured specifications. Results were normal- ized and represented as percentages. Animals and in vivo treatments All experiments in this study were performed in D2.B10-Dmdmdx/J (D2- mdx) mice, provided by Jackson Laboratory (Bar Harbor, ME, USA). Mice were housed in ventilated cages with a 12 h light/dark cycle and free access towater and chow. Eight-weeks oldmiceof both sexeswere used for in vivo experiments and MuSCs isolation. Animals were ran- domly assigned within the experimental groups. Procedures involving mice were corformed to institutional guidelines that comply with national and international laws and policies (DL 26/2014; EEC Council Directive 2010/63/UE) and they were be approved by the Italian Min- istry of Health. Local administration of AuNPs (20 μl) was performed by intra- muscular injection of α7/β1 AuNPs oligodT and α7/β1 AuNPs miR-206 into the TA muscles. Mice were treated once a week for a total of 3weeks. Oligonucleotides (oligodT/miRNA mimics) were delivered at a concentration of 0,5mg/kg per injection. AuNPs systemic delivery was obtained by intravenous injection in the lateral tail vein. Briefly, the injection was performed under anaesthesia by intraperitoneal injection of 40mg/kg ketamine (Zoletil®) and 10mg/kg xylazine (Rampum®). For long-term treatments, mice were injected with 50 μl of resuspended AuNPs once a week for a total of three or 5 weeks, depending on the experiment. Oligonucleotides (oligodT/miRNA mimics) were deliv- ered at a concentration of 1.2mg/kg per injection. For biodistribution experiments, mice were injected with 150 μl of α7/β1 or scramble AuNPs containing oligodT-cy5, oligodT, or miR-39 mimics in the lateral tail vein (final oligonucleotide dose of 1.8mg/kg). Injection was performed under anaesthesia by intraperitoneal injection of 40mg/kg ketamine (Zoletil®) and 10mg/kg xylazine (Rampum®) as above. Mice were sacrificed 24 h after treatment and the different organs were collected to analyse the released fluorescence using an IVIS imaging system (Lumina series III) or to perform flow cytometry, qRT-PCR and ICP-MS analysis. Forelimb strength was measured once a week using a grip strength meter (Bioseb Bio GS-3). Five measurements for each mouse were recorded, and the average maximal strength (Fmax) was nor- malized to the mouse body weight in order to calculate the absolute grip strength. The procedure was compliant with the standard oper- ating procedures of the TREAT–NMD Neuromuscular Network. ICP-MS Organs from treated mice were dried for 72 h at 140 °C in vials. Then the organs were digested in 1ml Aqua Regia for 48 h. After that, the dissolutions were diluted up to 10ml in water and filtered with 0.2 µm syringe filters. The gold concentration was measured by ICP-MS in a iCAP-Q ICP-MS equipment (Thermo Scientific, Bremen, Germany) with an automatic atomic sampler ASX-500 (CETAC Technologies, Omaha, USA) in the mass spectroscopy service of CICbiomaGUNE (San Sebastian, Spain). Single-fibre isolation and culture Single fibres were isolated from gastrocnemius and soleus muscles of D2.B10-Dmdmdx/J (mdx) mice by digestion with 0,35% collagenase I (#C0130, Sigma) inDMEMwith pyruvate, 4.5 g/l glucoseandglutamate (# 31966-021, Gibco) for 1 h at 37 °C. Fibres were then cultured in proliferation medium, GM1: DMEM with pyruvate,4.5 g/l glucose and glutamate (# 31966-021, Gibco), supplemented with 10% horse serum (HS, #26050‐070, Gibco) and 0.5% chicken embryo extract (CEE, #CE‐650‐F, Seralab) and penicillin/streptomycin. Myofibres were then treated with either PBS, α7/β1 AuNPs miR-206 or α7/β1 AuNPs oligodT at a final concentration of 6,7 nM, for 24-48 h. After treatment, the fibres were fixed in 4% paraformaldehyde (PFA) for immunostaining. FACS isolation and MuSCs culture Hindlimb muscle were digested in PBS containing Mg and Ca (# 14040133, Gibco) with 2 µg/ml collagenase A (#S10103586001, Roche), 2,4 U/mL dispase I (Roche) and 10 ng/mL DNase I (#10104159001, Roche), for 40min at 37 °C. Cells were then blocked in HBSS buffer (# 14170-088) containing 10% goat serum for 5min and isolated based on fluorophore levels using FACSMoFloAstriosEQHighSpeedCell Sorter (Backman Coulter). The following antibodies were used: CD45‐eFluor 450 (1/50, #48‐0451‐82, leucocyte common antigen, Ly‐5, eBioscience), CD31‐eFluor 450 (1/50, PECAM‐1, #48‐0311‐82, eBioscience), TER‐119‐eFluor 450 (1/50, clone TER‐119, #48‐5921‐82, eBioscience), Sca1‐FITC (1/50, Ly‐6A/E FITC, clone D7, #11‐5981‐82, eBioscience), ITGA7‐649 (1/500, AbLab #67‐0010‐01). MuSCs were isolated as TER119 − /CD45 − /CD31 − /ITGA7 + /SCA-1− cells; FAPs were isolated as TER119 − /CD45 − /CD31 − /ITGA7-/SCA-1+ cells; Macro- phages were isolated as TER119 + /CD45 + /CD31 + /F480 + / CD11b+ cells. For ex vivo experiments isolated MuSCs were plated at low den- sity on cell culture dishes coated with gelatin 0,1% (#07903, Stemcell) and cultured in BIO-ANF-2 medium (Biological industries) for 24 h. Then, medium was changed to growth medium, GM2: DMEM with Article https://doi.org/10.1038/s41467-024-55223-9 Nature Communications | (2025) 16:577 15 www.nature.com/naturecommunications Pyruvate (#41966, Gibco) supplemented with 20% FBS (#16000044, Gibco), 10% HS (#26050‐070, Gibco), 1% CEE (#CE‐650‐F, Seralab) and 1% penicillin–streptomycin (#15140, Gibco) and cells were incubated with α7/β1 AuNPs miR-206 or α7/β1 AuNPs oligodT at a final con- centration of 6.7 nM for 48 h. RNA extraction and qRT-PCR TotalRNA fromeither cellsorwholemusclewas extractedusingTRIzol reagent (#T9424, Sigma), following manufacturer indications. 0,5-1 µg were then retro-transcribed using PrimeScript Reagent kit (#RR037A, Takara). The cDNA was used as a template in real-time PCR reactions, performed with TB Green® Premix Ex Taq™ II (Tli RNase H Plus) (#RR82LR Takara). Real-time qPCR was performed using primers (Mm GAPDH FW 5′ GAAGGTCGGTGTGAACGGAT 3′; Mm GAPDH RV 5′ ACTGTGCCGTTGAATTTGCC 3′; Mm Myog FW 5′ GTCCCAACCCAG- GAGATCAT 3′; Mm Myog RV 5′ CCACGATGGACGTAAGGGAG 3′; MmMyh2 FW 5′ CACAAGGCATCCTCAAGGACA 3′; Mm Myh2 RV 5′ CAGCATCGGGACAGCCTTAC 3′; Mm U6 FW: 5’ TCTACCGGTTTGG CGGTCC 3′; Mm U6 RV: 5’GCACATAGCGGACGACTGAG 3′). Real-timeqRT-PCR formiR-206 andmiR-39were performedusing the following primers: Universal primer: RV CATGATCAGCTGGGC- CAAGA (Sigma); LNA oligonucleotide (miR-206), design ID: 666230; LNA oligonucleotide (miR-39), design ID: YCO0210528. Cytofluorimetry experiments Fluorescence of C2C12 cells incubated for 24 h with AuNPs-cy5 were revealed using a CytoFLEX flow cytometer (Beckman Coulter) and analysed using the FlowJo software v 10.8.1. For aptamer staining on muscle-resident cell populations, hin- dlimb muscle were digested in PBS containing Mg and Ca (# 14040133, Gibco) with 2 µg/ml collagenase A (Roche) and 2,4U/mL dispase I (Roche), for 40min at 37 °C. Cells were then blocked in HBSS buffer containing 10% goat serum. To evaluate aptamer specific binding, cells were first blocked with yeast tRNA (1mg/ml) and stained using followed antibodies: CD45‐eFluor 450 (1/50, #48‐0451‐ 82, leucocyte common antigen, Ly‐5, eBioscience), CD31‐eFluor 450 (1/50, PECAM‐1, #48‐0311‐82, eBioscience), TER‐119‐eFluor 450 (1/50, clone TER‐119, #48‐5921‐82, eBioscience) and Sca1‐FITC (1/50, Ly‐6 A/ E FITC, clone D7, #11‐5981‐82, eBioscience). In addition, cells were incubated with α7/β1 or scramble aptamers labelled with Alexa fluor 594. Before incubation, a folding step was performed. Briefly, 20 µM of Alexa 594-labelled aptamers (#1000913303-Eurogentec) were denatured for 3min at 90oC in a solution containing 5mM magne- sium acetate, and then cooled down in ice for 5min. After folding, cells were incubated with the α7/β1 or scramble aptamers for 1 h at +4 °C. Fluorecence was detected using a CytoFLEX flow cyto- fluorimeter (Beckman coulter). Results were analysed using the FlowJo software v 10.8.1. For detection of cy5 on muscle-resident cell populations, hin- dlimb muscles were digested in PBS containing Mg and Ca (# 14040133, Gibco) with 2 µg/ml collagenase A (Roche) and 2,4U/mL dispase I (Roche), for 40min at 37 °C. Cells were then blocked in HBSS buffer containing 10% goat serum and stained using followed antibodies:: CD45‐eFluor 450 (1/50, #48‐0451‐82, leucocyte common antigen, Ly‐5, eBioscience), CD31‐eFluor 450 (1/50, PECAM‐1, #48‐ 0311‐82, eBioscience), TER‐119‐eFluor 450 (1/50, clone TER‐119, #48‐ 5921‐82, eBioscience), Sca1‐FITC (1/50, Ly‐6 A/E FITC, clone D7, #11‐ 5981‐82, eBioscience), ITGA7‐PE (1/50, Miltenyi Biotec, Clone 3C12, #130-120-812). MuSCs were identified as TER119 − /CD45 − /CD31 − / ITGA7 + /SCA-1− cells; FAPs were identified as TER119 − /CD45 − / CD31 − /ITGA7-/SCA-1+ cells; Lineage positive cells were identified as TER119 + /CD45 + /CD31 + . Cy5 fluorescence within the indicated populations was detected using a a CytoFLEX flow cytofluorimeter (Beckman coulter). Results were analysed using the FlowJo software v 10.8.1. Immunofluorescence and aptamer hybridization Immunofluorescence: Cryosections and cells were fixed in 4% PFA for 10min at RT and permeabilized with 100% cold acetone (#32201, Sigma) or 100% cold methanol (#32213, Sigma) for 6min at −20 °C. Muscle sectionswere blocked for 1 hwith a solution containing 4%BSA (#A7030, Sigma) in PBS. For PAX7 staining an antigen retrieval step was performed by incubating the cryosections with 0.01% of hot citric acid, pH 6.0, for 10min The primary antibody incubation was per- formed O.N. at 4 °C and then, the antibody binding specificity was revealed using secondary antibodies coupled to Alexa Fluor 488, 594, or 647 (Invitrogen). Sectionswere incubatedwithDAPI in PBS for 5min for nuclear staining, washed in PBS, and mounted with glycerol 3:1 in PBS. The primary antibodies used for immunofluorescences are as follows: rabbit anti-Laminin (1/400, #L9393, Sigma); mouse anti- eMyHC (1/20, #F1.652, Developmental Studies Hybridoma Bank, DSHB, http://dshb.biology.uiowa.edu/F1- 652);mouse anti-MF20 (1:20, Developmental Studies Hybridoma Bank, DSHB, http://dshb.biology. uiowa.edu/MF-20); mouse anti-PAX7 (1/10, Developmental Studies Hybridoma Bank, DSHB, http://dshb.biology.uiowa.edu/PAX7);– anti- F4/80 (BM8,Biolegend); rabbit anti-KI67 (1/500, Abcam 15580);mouse anti-MYOD (1/100, 5,8A-NOVUSBIO); rabbit anti-ITGB1 (#4706, Cell Signalling); rabbit anti-ITGA7(H-40, sc-50431, SantaCruz). Imageswere acquired with fluorescent microscope and by four-laser Leica confocal microscopy (Microsystems, Concord, ON, Canada) integrated with image capture system and analytical software. Aptamer staining. Cryosections and myofibres were fixed in PFA 4% for 15min at RT. The cryosections were then permeabilized with 100% methanol at – 20 °C for 6min. Single myofibres were permea- bilized in 0,1% Triton-X 100 (#T8787) for 20min at room temperature. Cryosections and myofibres were blocked for 1 h with a solution con- taining 4% BSA with addition of 0,15mg/ml salmon sperm DNA (#AM9680- Thermofisher). Then, a folding step was performed. Briefly, 20 µM of Alexa 594-labelled aptamers (#1000913303-Euro- gentec) were denatured for 3min at 90oC in a solution containing 5mM magnesium acetate, and then cooled down in ice for 5min. Finally, cryosections andmyofibres were incubated with 100 nM α7/β1 or scramble aptamer for 1 h at +4 °C. Nuclei were counterstained with DAPI. Images were acquired with fluorescent microscope and by four- laser Leica confocalmicroscopy (Microsystems, Concord,ON,Canada) integrated with image capture system and analytical software. Histological analysis and in situ hybridization Sirius red staining was performed to analyse total collagens I and III content. Briefly, muscle cryosections were fixed for an 1 h at 56 °C in Bouin’s Solution (#HT10132-Sigma) and then stained in Picrosirius red solution (0.1%) (#09189) for 1 h protected from light. After a brief washing step in acidified water 0.5% v/v, sections were fixed in 100% ethanol (#1009866010-Sigma) and a final dehydration step was per- formed in xylene 100% (#534056). Sections were mounted with EUKITT® (#05393) and visualized using a Nikon Eclipse 90i. miRNA in situ hybridization was performed in formaldehyde- and carbodiimide (EDC)-fixed TA cryosections (0.16M 90min at RT, #25952-53-8, Merck KGaA). After washing with 0.2% glycine (#G8898, Sigma) and TBS, cryosections were acetylated using 0.1M triethanola- mine and0.25% acetic anhydride for 25min at RT (respectively, #90275, #A6404, Sigma). These steps were followed by a pre-hybridization using 2× SSC, 25% formamide (#F9037, Sigma), and0.2%Triton (#X100, Sigma) for 30min at RT, and by the overnight hybridization at 4 °Cwith the hsa-miR206 probe (10 pmol, #18100-01, Exiqon) dissolved in a solution of 50% formamide, 250 μg/ml tRNA (#R1753, Sigma), 200mg/ ml ssDNA (#D7656, Sigma), 10%dextran sulphate (#D8906, Sigma), and 2× SSC. The hybridization was followed by specific washes with SSC to eliminate non-specific binding of the probe (5× SSC 5min at RT, 1× SSC 15min at 45 °C, 2% BSA in 0.2× SSC 15min at 4 °C, 2× SSC 5min at RT, TN buffer 10min at RT, and TNT buffer 15min at RT) and by the Article https://doi.org/10.1038/s41467-024-55223-9 Nature Communications | (2025) 16:577 16 http://dshb.biology.uiowa.edu/F1 http://dshb.biology.uiowa.edu/MF-20 http://dshb.biology.uiowa.edu/MF-20 http://dshb.biology.uiowa.edu/PAX7 www.nature.com/naturecommunications incubation of cryosection using anti-digoxigenin-ap Fab fragments (1/ 100, #11093274910, Roche) dissolved in TN buffer for 2 h at RT. To reveal the miRNA probe specific binding, cryosections, covered from light, were incubating overnight at 4 °C with 0.375mg/ml of NBT and 0.188mg/ml BCIP dissolved in a solution of TMN buffer (respectively, #11383213001 and #11383221001, Roche). TN buffer is composed of 0.1M Tris–HCl (#T1503, Sigma) and 0.15M NaCl (#S3014, Sigma) at pH 7.5; TNT buffer is TN buffer with 0.1% Tween (#P1379, Sigma), while TMN buffer is composed of 0.1M Tris–HCl, 0.005M MgCl2 (#M8366, Sigma), 0.5M NaCl, and 2mM of Levamisole (#L9756, Sigma). Silver enhancement was performed using a silver enhancer kit (sigma Aldrich SE100-1KT) following manufacturer indications. Briefly sectionswerefixed in 2.5%glutaraldehyde solution (#G6257) for 15min and washed in distilled water to remove all traces of chlorides and buffer salts. The specimen was then covered with a silver enhancer mixture for 15min a 20 °C. After a washing step, the specimen was fixed in 2,5% sodium thiosulfate for 3min, washed, and mounted. Hematoxilin/ Eosin staining was performed to analyse tissue morphology and integrity. Briefly, muscle, liver and spleen cryosection were fixed in PFA 4% for 15min at RT and then stained with with Mayer’s Hematoxylin for 8min followed by washing in running tap water for 10’. Eosin counterstain was applied for 1’ a RT. Following staining, slides were dehydrated through 75%, 90% and absolute alco- hol cleared in Xylene andmounted with Eukitt (Sigma Aldrich, 03989). Necrotic fibres staining was performed as follows. Muscle cryosec- tion were fixed in PFA 4% for 15min at RT and blocked for 1 h with a solution containing 4%BSA (#A7030, Sigma) in PBS. Then sectionswere incubated with secondary antibody anti-mouse coupled to Alexa Fluor 594. Finally, sections were incubated with DAPI in PBS for 5min for nuclear staining, washed in PBS, and mounted with glycerol 3:1 in PBS. Images were analysed using ImageJ software (https://imagej.nih. gov/ij/download.html). For the analysis of the fibrotic area, an algo- rithm for colour deconvolution was used. Statistics and reproducibility The number of independent biological replicates is reported in the figure legends. Statistical analysis was performed using GraphPadPr- ism8. Normal distribution was first assessed. Comparisons between groups were made using one way and two way ANOVA followed by Tukey’s or Kruskal-Wallis post hoc test, as indicated in the figure legends. Significance is defined as: p < 0.05 (*/#),p < 0.01 (**), p <0.001 (***) and p <0.0001 (****). Sample exclusion was not performed unless statistically significant outliers were identified using Grubb’s test (extreme studentized method). The exact p-values for all the experi- ments are provided in the Source Data file. Ethics Every experiment involving animals have been carried out following a protocol approved by an ethical commission. Reporting summary Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article. Data availability The mass spectrometry proteomics data have been deposited to the ProteomeXchange Consortium via the PRIDE83 partner repositorywith the dataset identifier PXD049295 and 10.6019/PXD049295 (https:// doi.org/10.6019/PXD049295). Specific sequences obtained through the SELEX process are not disclosed here as they are under patent evaluation and are consideredconfidential information. Thematerial is available upon request, after payment of a cost-recovery fee. All other data supporting thefindings of this study are availablewithin thepaper and its Supplementary Information. Source data are provided with this paper. References 1. Mendell, J. R. et al. Evidence-based path to newborn screening for Duchenne muscular dystrophy. Ann. Neurol. 71, 304–313 (2012). 2. Ervasti, J. M. & Sonnemann, K. J. Biology of the striated muscle dystrophin-glycoprotein complex. Int Rev. Cytol. 265, 191–225 (2008). 3. Waldrop, M. A. & Flanigan, K. M. Update in Duchenne and Becker muscular dystrophy. Curr. Opin. Neurol. 32, 722 (2019). 4. Duan, D., Goemans, N., Takeda, S., Mercuri, E. & Aartsma-Rus, A. Duchenne muscular dystrophy. Nat. Rev. Dis. Prim. 7, 1–19 (2021). 5. Chamberlain, J. S. et al. Microdystrophin expression as a surrogate endpoint for Duchenne muscular dystrophy clinical trials. Hum. Gene Ther. 34, 404–415 (2023). 6. Hammond, S. M. et al. Delivery of oligonucleotide-based ther- apeutics: challenges and opportunities. EMBO Mol. Med. 13, e13243 (2021). 7. Crudele, J. M. & Chamberlain, J. S. AAV-based gene therapies for the muscular dystrophies. Hum. Mol. Genet 28, R102–R107 (2019). 8. Chang, N. C. et al. The Dystrophin glycoprotein complex regulates the epigenetic activation of muscle stem cell commitment. Cell Stem Cell 22, 755–768.e6 (2018). 9. Dumont, N. A. et al. Dystrophin expression in muscle stem cells regulates their polarity and asymmetric division. Nat. Med. 21, 1455–1463 (2015). 10. Kodippili, K. & Rudnicki, M. A. Satellite cell contribution to disease pathology in Duchenne muscular dystrophy. Front Physiol. 14, 1180980 (2023). 11. Wang, Y. X. et al. EGFR-aurka signaling rescues polarity and regeneration defects in dystrophin-deficient muscle stem cells by increasing asymmetric divisions. Cell Stem Cell 24, 419–432.e6 (2019). 12. Sacco, A. et al. Short telomeres and stem cell exhaustion model Duchenne muscular dystrophy in mdx/mTR mice. Cell 143, 1059–1071 (2010). 13. Latella, L. et al. DNA damage signaling mediates the functional antagonism between replicative senescence and terminal muscle differentiation. Genes Dev. 31, 648–659 (2017). 14. Mázala, D. A. et al. TGF-β-driven muscle degeneration and failed regeneration underlie disease onset in a DMD mouse model. JCI Insight 5, e135703 (2020). 15. Mázala, D. A. G. et al. Alteredmuscle niche contributes tomyogenic deficit in the D2-mdx model of severe DMD. Cell Death Discov. 9, 224 (2023). 16. Aránega, A. E. et al. MiRNAs and muscle regeneration: therapeutic targets in Duchenne muscular dystrophy. Int J. Mol. Sci. 22, 4236 (2021). 17. Bartel, D. P. MicroRNAs: target recognition and regulatory func- tions. Cell 136, 215–233 (2009). 18. Rao, P. K., Kumar, R. M., Farkhondeh, M., Baskerville, S. & Lodish, H. F. Myogenic factors that regulate expression of muscle-specific microRNAs. Proc. Natl Acad. Sci. USA 103, 8721–8726 (2006). 19. Chen, J.-F. et al. The role of microRNA-1 and microRNA-133 in ske- letal muscle proliferation and differentiation. Nat. Genet 38, 228–233 (2006). 20. Lozano-Velasco, E. et al. A Pitx2-microRNA pathway modulates cell proliferation in myoblasts and skeletal-muscle satellite cells and promotes their commitment to a myogenic cell fate.Mol. Cell Biol. 35, 2892–2909 (2015). 21. Yin, H. et al.MicroRNA-133 controls brown adiposedetermination in skeletal muscle satellite cells by targeting Prdm16. Cell Metab. 17, 210–224 (2013). 22. Baghdadi, M. B. et al. Notch-Induced miR-708 antagonizes satel- lite cell migration and maintains quiescence. Cell Stem Cell 23, 859–868.e5 (2018). Article https://doi.org/10.1038/s41467-024-55223-9 Nature Communications | (2025) 16:577 17 https://imagej.nih.gov/ij/download.html https://imagej.nih.gov/ij/download.html https://doi.org/10.6019/PXD049295 https://doi.org/10.6019/PXD049295 www.nature.com/naturecommunications 23. Castel, D. et al. Small-RNA sequencing identifies dynamic micro- RNA deregulation during skeletal muscle lineage progression. Sci. Rep. 8, 4208 (2018). 24. Mytidou, C. et al. Muscle-derived exosomes encapsulate myomiRs and are involved in local skeletal muscle tissue communication. FASEB J. 35, e21279 (2021). 25. Sandonà, M. et al. HDAC inhibitors tune miRNAs in extracellular vesicles of dystrophic muscle-resident mesenchymal cells. EMBO Rep. 21, e50863 (2020). 26. Saccone, V. et al. HDAC-regulated myomiRs control BAF60 variant exchange and direct the functional phenotype of fibro-adipogenic progenitors in dystrophic muscles. Genes Dev. 28, 841–857 (2014). 27. Liu, N. et al. microRNA-206 promotes skeletal muscle regeneration anddelays progression of Duchennemuscular dystrophy inmice. J. Clin. Invest. 122, 2054–2065 (2012). 28. Consalvi, S. et al. Preclinical studies in the mdx mouse model of Duchenne muscular dystrophy with the histone deacetylase inhi- bitor givinostat. Mol. Med. 19, 79–87 (2013). 29. Mozzetta, C. et al. Fibroadipogenic progenitors mediate the ability of HDAC inhibitors to promote regeneration in dystrophic muscles of young, but not old Mdx mice. EMBO Mol. Med. 5, 626–639 (2013). 30. Minetti, G. C. et al. Functional and morphological recovery of dys- trophic muscles in mice treated with deacetylase inhibitors. Nat. Med. 12, 1147–1150 (2006). 31. Mercuri, E. et al. Safety and efficacy of givinostat in boys with Duchenne muscular dystrophy (EPIDYS): a multicentre, rando- mised, double-blind, placebo-controlled, phase 3 trial. Lancet Neurol. 23, 393–403 (2024). 32. Latorre, A. et al. DNA and aptamer stabilized gold nanoparticles for targeted delivery of anticancer therapeutics. Nanoscale 6, 7436–7442 (2014). 33. Zhang, R., Kiessling, F., Lammers, T. & Pallares, R. M. Clinical translation of gold nanoparticles. Drug Deliv. Transl. Res. 13, 378–385 (2023). 34. Xue, H. Y., Liu, S. & Wong, H. L. Nanotoxicity: A key obstacle to clinical translation of siRNA-based. Nanomed. Nanomed. 9, 295–312 (2014). 35. Kouri, F. M. et al. miR-182 integrates apoptosis, growth, and differ- entiation programs in glioblastoma.Genes Dev. 29, 732–745 (2015). 36. Jensen, S. A. et al. Spherical nucleic acid nanoparticle conjugates as an RNAi-based therapy for glioblastoma. Sci. Transl. Med. 5, 209ra152 (2013). 37. Milán-Rois, P., Rodriguez-Diaz, C., Castellanos, M. & Somoza, Á. Conjugation of nucleic acids and drugs to gold nanoparticles. Methods Mol. Biol. 2434, 103–116 (2022). 38. Cutler, J. I., Auyeung, E. & Mirkin, C. A. Spherical Nucleic Acids. Vol. 4 (Jenny Stanford, 2020). 39. Mokhtarzadeh, A. et al. Applications of spherical nucleic acid nanoparticles as delivery systems. Trends Mol. Med 25, 1066–1079 (2019). 40. Burkin, D. J. et al. Transgenic expression of {alpha}7{beta}1 integrin maintains muscle integrity, increases regenerative capacity, pro- motes hypertrophy, and reduces cardiomyopathy in dystrophic mice. Am. J. Pathol. 166, 253–263 (2005). 41. Burkin, D. J.,Wallace, G.Q., Nicol, K. J., Kaufman, D. J. & Kaufman, S. J. Enhanced expression of the alpha 7 beta 1 integrin reduces muscular dystrophy and restores viability in dystrophicmice. J. Cell Biol. 152, 1207–1218 (2001). 42. Ferreira, D. et al. Gold nanoparticles for vectorization of nucleic acids for cancer therapeutics. Molecules 25, 3489 (2020). 43. Kanu, G. A., Parambath, J. B. M., AbuOdeh, R. O. & Mohamed, A. A. Gold nanoparticle-mediated gene therapy. Cancers 14, 5366 (2022). 44. Wang, W., Wang, J. & Ding, Y. Gold nanoparticle-conjugated nanomedicine: design, construction, and structure–efficacy rela- tionship studies. J. Mater. Chem. B 8, 4813–4830 (2020). 45. Fellows, T. et al.Goldnanoparticle-streptavidin conjugates for rapid and efficient screening of aptamer function in lateral flow sensors using novel CD4-binding aptamers identified through Crossover- SELEX. Analyst 145, 5180–5193 (2020). 46. Vachon, P. H. et al. Integrins (alpha7beta1) in muscle function and survival. Disrupted expression in merosin-deficient congenital muscular dystrophy. J. Clin. Invest. 100, 1870–1881 (1997). 47. Sarathy, A. et al. SU9516 increases α7β1 integrin and ameliorates disease progression in the mdx mouse model of Duchenne mus- cular dystrophy. Mol. Ther. 25, 1395–1407 (2017). 48. Mitchell, M. J. et al. Engineering precision nanoparticles for drug delivery. Nat. Rev. Drug Discov. 20, 101–124 (2021). 49. Millozzi, F., Papait, A., Bouché, M., Parolini, O. & Palacios, D. Nano- immunomodulation: a new strategy for skeletal muscle diseases and aging? Int J. Mol. Sci. 24, 1175 (2023). 50. Tenzer, S. et al. rapid formation of plasma protein corona critically affects nanoparticle pathophysiology. Nat. Nanotech. 8, 772–781 (2013). 51. Vu, V. P. et al. Immunoglobulin deposition on biomolecule corona determines complement opsonisation efficiency of preclinical and clinical nanoparticles. Nat. Nanotechnol. 14, 260–268 (2019). 52. Ge, J. et al. Gold and gold-silver alloy nanoparticles enhance the myogenic differentiation ofmyoblasts through p38MAPK signaling pathway and promote in vivo skeletal muscle regeneration. Bio- materials 175, 19–29 (2018). 53. Colapicchioni, V., Millozzi, F., Parolini, O. & Palacios, D. Nanomedi- cine, a valuable tool for skeletal muscle disorders: Challenges, promises, and limitations. Wiley Interdiscip. Rev. Nanomed. Nano- biotechnol. 14, e1777 (2022). 54. Brancaccio, A. & Palacios, D. Chromatin signaling in muscle stem cells: interpreting the regenerativemicroenvironment. Front. Aging Neurosci. 7, 36 (2015). 55. Chen, J.-F. et al. microRNA-1 and microRNA-206 regulate skeletal muscle satellite cell proliferation and differentiation by repressing Pax7. J. Cell Biol. 190, 867–879 (2010). 56. Cutler, A. A. et al. The regenerating skeletal muscle niche drives satellite cell return to quiescence. iScience 25, 104444 (2022). 57. Geary, R. S., Norris, D., Yu, R. & Bennett, C. F. Pharmacokinetics, biodistribution and cell uptake of antisense oligonucleotides. Adv. Drug Deliv. Rev. 87, 46–51 (2015). 58. Du, B. et al. Tailoring kidney transport of organic dyes with low- molecular-weight PEGylation. Bioconjugate Chem. 31, 241–247 (2020). 59. Katoozi, D., Clayton, A. H. A., Moss, D. J. & Chon, J. W. M. Uptake quantification of gold nanoparticles inside of cancer cells using high order image correlation spectroscopy. Biomed. Opt. Express 12, 539–552 (2021). 60. Roberts, T. C., Langer, R. & Wood, M. J. A. Advances in oligonu- cleotide drug delivery. Nat. Rev. Drug Discov. 19, 673–694 (2020). 61. Hicks, M. R. et al. Nanoparticles systemically biodistribute to regenerating skeletal muscle in DMD. J. Nanobiotechnol. 21, 303 (2023). 62. Rothdiener, M., Beuttler, J., Messerschmidt, S. K. E. & Kontermann, R. E. Antibody targeting of nanoparticles to tumor-specific recep- tors: immunoliposomes. Methods Mol. Biol. 624, 295–308 (2010). 63. Wang, C.-H. et al. Aptamer-conjugated and drug-loaded acoustic droplets for ultrasound theranosis. Biomaterials 33, 1939–1947 (2012). 64. Acharya, S. & Hill, R. A. High efficacy gold-KDEL peptide-siRNA nanoconstruct-mediated transfection in C2C12 myoblasts and myotubes. Nanomedicine 10, 329–337 (2014). Article https://doi.org/10.1038/s41467-024-55223-9 Nature Communications | (2025) 16:577 18 www.nature.com/naturecommunications 65. Jativa, S. D. et al. Enhanced delivery of plasmid DNA to skeletal muscle cells using a DLC8-binding peptide and ASSLNIA-modified PAMAM dendrimer. Mol. Pharm. 16, 2376–2384 (2019). 66. Ungerleider, J. L., Kammeyer, J. K., Braden, R. L., Christman, K. L. & Gianneschi, N. C. Enzyme-targeted nanoparticles for delivery to ischemic skeletal muscle. Polym. Chem. 8, 5212–5219 (2017). 67. Malecova, B. et al. Targeted tissue delivery of RNA therapeutics using antibody-oligonucleotide conjugates (AOCs). Nucleic Acids Res. 51, 5901–5910 (2023). 68. Hindi, S. M. et al. Enveloped viruses pseudotyped with mammalian myogenic cell fusogens target skeletal muscle for gene delivery. Cell 186, 2062–2077.e17 (2023). 69. Zhou, G. et al. Aptamers: A promising chemical antibody for cancer therapy. Oncotarget 7, 13446–13463 (2016). 70. Philippou, S. et al. Selection and identification of skeletal-muscle- targetedRNAaptamers.Mol. Ther. Nucleic Acids 10, 199–214 (2018). 71. Fry, C. S., Kirby, T. J., Kosmac, K., McCarthy, J. J. & Peterson, C. A. Myogenic progenitor cells control extracellular matrix production by fibroblasts during skeletal muscle hypertrophy. Cell Stem Cell 20, 56–69 (2017). 72. Latorre, A. & Somoza, Á. Glutathione-triggered drug release from nanostructures. Curr. Top. Med Chem. 14, 2662–2671 (2014). 73. Lushchak, V. I. Glutathione homeostasis and functions: potential targets formedical interventions. J. AminoAcids2012, 736837 (2012). 74. Meister, A. Glutathionemetabolismand its selectivemodification. J. Biol. Chem. 263, 17205–17208 (1988). 75. Sen, C. K. Glutathione: A key role in skeletal muscle metabolism. In Oxidative Stress in Skeletal Muscle (eds. Reznick, A. Z., Packer, L., Sen, C. K., Holloszy, J. O. & Jackson, M. J.) 127–139 (Birkhäuser, Basel, 1998). 76. Hurst, S. J., Lytton-Jean, A. K. R. & Mirkin, C. A. Maximizing DNA loading on a range of gold nanoparticle sizes. Anal. Chem. 78, 8313–8318 (2006). 77. Milan, J., Niemczyk, K. & Kus-Liśkiewicz, M. Treasure on the earth- gold nanoparticles and their biomedical applications. Materials 15, 3355 (2022). 78. Sibuyi, N. R. S. et al. Multifunctional gold nanoparticles for improved diagnostic and therapeutic applications: a review. Nanoscale Res Lett. 16, 174 (2021). 79. Lee, K. et al. Nanoparticle delivery of Cas9 ribonucleoprotein and donor DNA in vivo induces homology-directed DNA repair. Nat. Biomed. Eng. 1, 889–901 (2017). 80. Prigodich, A. E. et al. Nano-flares for mRNA regulation and detec- tion. ACS Nano 3, 2147–2152 (2009). 81. Milán Rois, P., Latorre, A., Rodriguez Diaz, C., Del Moral, Á. & Somoza, Á. Reprogramming cells for synergistic combination therapy with nanotherapeutics against uveal melanoma. Biomim. (Basel) 3, E28 (2018). 82. Ciordia, S. et al. Diggingdeeper intobile proteome. J. Proteom.230, 103984 (2021). 83. Perez-Riverol, Y. et al. The PRIDE database resources in 2022: a hub for mass spectrometry-based proteomics evidences. Nucleic Acids Res. 50, D543–D552 (2022). Acknowledgements This work was funded by the Eranet-Euronanomed Joint Call 2016 (H2020), project #ER-2016-2360733 to D.P, A.S., and J-J. T and the French Association Against Myopathies, Ignition project #23592 to D.P and A.S. Also, it was partially supported by the Spanish Ministry of Economy and Competitiveness [PID2020-119352RB-I00, PID2023- 146982OB-I00], Comunidad de Madrid [S2022/BMD‑7403 RENIM‑CM], Asociación Española Contra el Cáncer (PRYCO223002PEIN), and IMDEA Nanociencia. F.M. acknowledges a PhD fellowship from Università Sapienza, G.D.C. acknowledges a PhD fellowship from Università Cattolica del Sacro Cuore. M.M. acknowledges support from Ministerio de Ciencia e Innovación (FJC2021-048151-I). I.P. acknowledges a PhD fellowship from the Community of Madrid (Grant No: PIPF‑2022SAL‑GL‑24788). IMDEANanociencia receives support from the ‘Severo Ochoa’ Programme for Centres of Excellence in R&D (MICINN Grant no: CEX2020‑001039‑S). The authors would like to thank Dr. Pier Lorenzo Puri for critical discussions and helpful suggestions. Author contributions D.P., A.So., and J.-J.T. conceived and designed the study. F.M. per- formedall the in vitro and in vivo experiments andanalysed thedatawith help fromG.D.C.,M.S., F.E., andM.T.V. P.M.-R. designed and synthetized the nanoparticles, with help fromC.R., M.M., and I.P. A.S. performed the SELEX experiments and characterization studies of selected aptamers. M.D.B. performd the cytofluorimetry and FACS analysis. M.G.-G. per- formed the protein corona experiments. M.B., O.P., and V.S. contributed to data analysis and interpretation. D.P. and A.So. wrote the manuscript with input from J.-J.T., F.M., P.M.-R., A.S. and M.G.-G. All the authors reviewed and approved the manuscript. Competing interests A patent application has been filed by the Università Cattolica del Sacro Cuore, IMDEA Nanociencias, Inserm and IRCCS Fondazione Santa Lucia with D.P. A.So., J.-J.T., F.M., P.M.-R and A.S. as inventors (Nucleic acid aptamers recognizing the extra cellular domain of alpha7/beta1 integrin dimers anduses thereof. Applicationnumber: 102024000007594.). The other authors declare no competing interests. Additional information Supplementary information The online version contains supplementary material available at https://doi.org/10.1038/s41467-024-55223-9. Correspondence and requests for materials should be addressed to Jean-Jacques Toulmé, Álvaro Somoza or Daniela Palacios. Peer review information Nature Communications thanks the anon- ymous reviewers for their contribution to the peer review of this work. A peer review file is available. Reprints and permissions information is available at http://www.nature.com/reprints Publisher’s note Springer Nature remains neutral with regard to jur- isdictional claims in published maps and institutional affiliations. Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. Youdonot havepermissionunder this licence toshare adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http:// creativecommons.org/licenses/by-nc-nd/4.0/. © The Author(s) 2025 Article https://doi.org/10.1038/s41467-024-55223-9 Nature Communications | (2025) 16:577 19 https://doi.org/10.1038/s41467-024-55223-9 http://www.nature.com/reprints http://creativecommons.org/licenses/by-nc-nd/4.0/ http://creativecommons.org/licenses/by-nc-nd/4.0/ www.nature.com/naturecommunications Aptamer-conjugated gold nanoparticles enable oligonucleotide delivery into muscle stem cells to promote regeneration of dystrophic muscles Results Development of a muscle-specific aptamer Generation of aptamer-conjugated AuNPs for oligonucleotide delivery Protein corona composition of the therapeutic α7/β1 AuNPs miR-206 in dystrophic plasma In vitro treatment with α7/β1 AuNPs miR-206 stimulates differentiation of muscle cells Intramuscular injection of α7/β1 AuNPs miR-206 stimulates skeletal muscle regeneration in a mouse model of DMD Systemic delivery of α7/β1 AuNPs efficiently target skeletal muscles, including MuSCs, in dystrophic mice Systemic delivery of α7/β1 AuNPs miR-206 stimulates skeletal muscle regeneration and improves muscle functionality in D2-mdx mice α7/β1 AuNPs have an intrinsic ability to stimulate MuSCs proliferation α7/β1 AuNPs present a safety profile compatible with repetitive dosing Discussion Methods SELEX experiments Surface Plasmon Resonance AuNPs synthesis and functionalization TEM Hydrodynamic size Z-potential Protein corona Cell lines Cytotoxicity assay Luciferase reporter assay Animals and in vivo treatments ICP-MS Single-fibre isolation and culture FACS isolation and MuSCs culture RNA extraction and qRT-PCR Cytofluorimetry experiments Immunofluorescence and aptamer hybridization Histological analysis and in situ hybridization Statistics and reproducibility Ethics Reporting summary Data availability References Acknowledgements Author contributions Competing interests Additional information