*For correspondence:
pjl30@cam.ac.uk
†These authors contributed
equally to this work
Present address: ‡Department
of Medicine, Brigham and
Women’s Hospital, Boston,
United States
Competing interests: The
authors declare that no
competing interests exist.
Funding: See page 25
Received: 13 July 2018
Accepted: 19 November 2018
Published: 13 December 2018
Reviewing editor: Wade
Harper, Harvard Medical School,
United States
Copyright Menzies et al. This
article is distributed under the
terms of the Creative Commons
Attribution License, which
permits unrestricted use and
redistribution provided that the
original author and source are
credited.
The sterol-responsive RNF145 E3
ubiquitin ligase mediates the degradation
of HMG-CoA reductase together with
gp78 and Hrd1
Sam A Menzies†, Norbert Volkmar†, Dick JH van den Boomen, Richard T Timms‡,
Anna S Dickson, James A Nathan, Paul J Lehner*
Department of Medicine, Cambridge Institute for Medical Research, Cambridge,
United Kingdom
Abstract Mammalian HMG-CoA reductase (HMGCR), the rate-limiting enzyme of the cholesterol
biosynthetic pathway and the therapeutic target of statins, is post-transcriptionally regulated by
sterol-accelerated degradation. Under cholesterol-replete conditions, HMGCR is ubiquitinated and
degraded, but the identity of the E3 ubiquitin ligase(s) responsible for mammalian HMGCR
turnover remains controversial. Using systematic, unbiased CRISPR/Cas9 genome-wide screens
with a sterol-sensitive endogenous HMGCR reporter, we comprehensively map the E3 ligase
landscape required for sterol-accelerated HMGCR degradation. We find that RNF145 and gp78
independently co-ordinate HMGCR ubiquitination and degradation. RNF145, a sterol-responsive
ER-resident E3 ligase, is unstable but accumulates following sterol depletion. Sterol addition
triggers RNF145 recruitment to HMGCR via Insigs, promoting HMGCR ubiquitination and
proteasome-mediated degradation. In the absence of both RNF145 and gp78, Hrd1, a third
UBE2G2-dependent E3 ligase, partially regulates HMGCR activity. Our findings reveal a critical role
for the sterol-responsive RNF145 in HMGCR regulation and elucidate the complexity of sterol-
accelerated HMGCR degradation.
Editorial note: This article has been through an editorial process in which the authors decide how
to respond to the issues raised during peer review. The Reviewing Editor’s assessment is that all
the issues have been addressed (see decision letter).
DOI: https://doi.org/10.7554/eLife.40009.001
Introduction
Cholesterol plays a critical role in cellular homeostasis. As an abundant lipid in the eukaryotic plasma
membrane, it modulates vital processes including membrane fluidity and permeability
(Hannich et al., 2011; Haines, 2001) and serves as a precursor for important metabolites including
steroid hormones and bile acids (Payne and Hales, 2004; Chiang, 2013). The cholesterol biosyn-
thetic pathway in mammalian cells also provides intermediates for essential non-steroid isoprenoids
and therefore requires strict regulation (Goldstein and Brown, 1990). The endoplasmic-reticulum
(ER) resident, polytopic membrane glycoprotein 3-hydroxy-3-methylglutaryl coenzyme A reductase
(HMGCR) is central to this pathway, catalysing the formation of mevalonate, a crucial isoprenoid pre-
cursor. As the rate-limiting enzyme in mevalonate metabolism, HMGCR levels need to be tightly reg-
ulated, as dictated by intermediates and products of the mevalonate pathway (Johnson and
DeBose-Boyd, 2018). The statin family of drugs, which acts as competitive inhibitors of HMGCR,
represents the single most successful approach to reducing plasma cholesterol levels and therefore
preventing atherosclerosis-related diseases (Heart Protection Study Collaborative Group, 2002).
Menzies et al. eLife 2018;7:e40009. DOI: https://doi.org/10.7554/eLife.40009 1 of 30
RESEARCH COMMUNICATION
Understanding how HMGCR is regulated is therefore of fundamental biological and clinical
importance.
Cholesterol, together with its biosynthetic intermediates and isoprenoid derivatives, regulates
HMGCR expression at both the transcriptional and posttranscriptional level (Johnson and DeBose-
Boyd, 2018). Low cholesterol induces transcriptional activation of HMGCR through the sterol
response element binding proteins (SREBPs) which bind SREs in the promoter region
(Osborne, 1991). In a cholesterol-rich environment, SREBPs are inactive and held in the ER in com-
plex with their cognate chaperone SREBP cleavage-activating protein (SCAP) in association with the
ER-resident Insulin-induced genes 1/2 (Insig-1/2) anchor proteins (Dong and Tang, 2010;
Yabe et al., 2002). A decrease in membrane cholesterol triggers dissociation of the SCAP-SREBP
complex from Insigs and translocation to the Golgi apparatus, where the SREBP transcription factor
is proteolytically activated by Site-1 and Site-2 proteases, released into the cytosol and trafficked to
the nucleus (reviewed in Horton et al., 2002). Low sterol levels therefore dramatically increase both
HMGCR mRNA and extend HMGCR protein half-life, ensuring the resultant elevated enzyme levels
stimulate the supply of mevalonate to re-balance cholesterol homeostasis (Goldstein and Brown,
1990; Brown et al., 1973). Once cholesterol levels are restored, excess HMGCR is rapidly degraded
by the ubiquitin proteasome system (UPS) in a process termed sterol-accelerated degradation
(Hampton et al., 1996; Ravid et al., 2000; Sever et al., 2003a). This joint transcriptional and trans-
lational regulation of HMGCR is controlled by a host of ER-resident polytopic membrane proteins
and represents a finely balanced homeostatic mechanism to rapidly regulate this critical enzyme in
response to alterations in intracellular cholesterol. While the ubiquitin-mediated, post-translational
regulation of HMGCR is well-established, the identity of the critical mammalian ER-associated degra-
dation (ERAD) E3 ubiquitin ligase(s) responsible for sterol-accelerated HMGCR ERAD remains
controversial.
In yeast, S. cerevisiae encodes three ERAD E3 ubiquitin ligases, of which Hrd1p (HMG-CoA deg-
radation 1), is named for its ability to degrade yeast HMGCR (Hmg2p) in response to non-sterol iso-
prenoids (Hampton et al., 1996; Bays et al., 2001). The marked expansion and diversification of E3
ligases in mammals makes the situation more complex, as in human cells there are 37 putative E3
eLife digest Cholesterol is a fatty molecule that is essential for our health; for example, it is a
component of the outer membrane that surrounds every cell in our body. Yet, it also has a
reputation for clogging arteries and causing heart attacks and strokes. Our organism can adjust the
amount of cholesterol it creates through an enzyme called HMGCR, which is found in all cells.
Switching off HMGCR, for instance by taking drugs called statins, reduces the amount of cholesterol
made by cells. To regulate the activity of HMGCR, the body uses proteins known as E3 ubiquitin
ligases, which can label the enzyme for destruction. However, the identity of the ligases that target
HMGCR is a matter of intense debate.
Here, Menzies, Volkmar et al. addressed this issue by using an approach called a genome-wide
CRISPR forward genetic screen. First, HMGCR was marked inside the cells with a fluorescent tag to
watch how its levels change in response to different amounts of cholesterol. Then, each gene in the
cell was deleted, and the effects recorded. This allowed Menzies, Volkmar et al. to find the genes
responsible for the rapid destruction of HMGCR.
The experiments revealed that the E3 ubiquitin ligases RNF145 and gp78 are independently
responsible for the degradation of the majority of HMGCR, with a third ligase, Hrd1, getting
involved if the first two are absent. In particular, RNF145 builds up when a cell is starved of
cholesterol, but it immediately marks HMGCR for destruction once cholesterol becomes more
abundant. This ligase can therefore both sense and respond to the amount of cholesterol in a cell,
making it a perfect candidate for regulating HMGCR based on what the body needs.
Identifying the proteins that adjust the levels of HMGCR sheds light on how a cell controls the
amount of cholesterol it creates. This knowledge could be relevant in the fight against the health
problems associated with this molecule.
DOI: https://doi.org/10.7554/eLife.40009.002
Menzies et al. eLife 2018;7:e40009. DOI: https://doi.org/10.7554/eLife.40009 2 of 30
Research Communication Cell Biology
ligases involved in ERAD, few of which are well-characterised (Kaneko et al., 2016). Hrd1 and gp78
represent the two mammalian orthologues of yeast Hrd1p. Hrd1 was not found to regulate HMGCR
(Song et al., 2005; Nadav et al., 2003). However, gp78 was reported to be responsible for the ste-
rol-induced degradation of HMGCR as (i) gp78 associates with Insig-1 in a sterol-independent man-
ner, (ii) Insig-1 mediates a sterol-dependent interaction between HMGCR and gp78, (iii)
overexpression of the transmembrane domains of gp78 exerted a dominant-negative effect and
inhibited HMGCR degradation, and (iv), siRNA-mediated depletion of gp78 resulted in decreased
sterol-induced ubiquitination and degradation of HMGCR (Song et al., 2005). The same laboratory
subsequently suggested that the sterol-induced degradation of HMGCR was mediated by two
ERAD E3 ubiquitin ligases, with TRC8 involved in addition to gp78 (Jo et al., 2011). However, these
findings remain controversial as, despite confirming a role for gp78 in the regulation of Insig-1
(Lee et al., 2006; Tsai et al., 2012), an independent study found no evidence for either gp78 or
TRC8 in the sterol-induced degradation of HMGCR (Tsai et al., 2012). Therefore, the E3 ligase(s)
responsible for the sterol-accelerated degradation of HMGCR remain disputed.
The introduction of systematic forward genetic screening approaches to mammalian systems
(Carette et al., 2009; Wang et al., 2014) has made the unbiased identification of E3 ubiquitin
ligases more tractable, as demonstrated for the viral (van den Boomen and Lehner, 2015; van de
Weijer et al., 2014; Stagg et al., 2009) and endogenous regulation of MHC-I (Burr et al., 2011;
Cano et al., 2012).
To identify the E3 ligases governing HMGCR ERAD, we applied a genome-wide forward genetic
screen to a dynamic, cholesterol-sensitive reporter cell line, engineered to express a fluorescent pro-
tein fused to endogenous HMGCR. This approach identified cellular genes required for sterol-
induced HMGCR degradation, including UBE2G2 and the RNF145 ERAD E3 ubiquitin ligase. The
subtle phenotype observed upon RNF145 depletion alone suggested redundant ligase usage. A
subsequent, targeted ubiquitome CRISPR/Cas9 screen in RNF145-knockout cells showed RNF145 to
be functionally redundant with gp78, the E3 ligase originally implicated in HMGCR degradation. We
confirmed that loss of gp78 alone showed no phenotype, while loss of both E3 ligases significantly
inhibited the sterol-induced ubiquitination and degradation of HMGCR. Complete stabilisation
required additional depletion of a third ligase - Hrd1. We find that endogenous RNF145 is an auto-
regulated, sterol-responsive E3 ligase which is recruited to Insig proteins under sterol-replete condi-
tions, thus promoting the regulated ubiquitination and sterol-accelerated degradation of HMGCR.
Our data resolve the controversy of the E3 ligases responsible for the post-translational regulation
of HMGCR and emphasise the complexity of the mammalian ubiquitin system in fine-tuning sterol-
induced HMGCR turnover and cholesterol homeostasis.
Results
Targeted knock-in at the endogenous HMGCR locus creates a dynamic,
cholesterol-sensitive reporter
To identify genes involved in the post-translational regulation of HMGCR, we engineered a cell line
in which Clover, a bright fluorescent protein (Lam et al., 2012), was fused to the C-terminus of
endogenous HMGCR, generating an HMGCR-Clover fusion protein (Figure 1A). The resulting
HMGCR-Clover Hela single-cell clone expresses a dynamic, cholesterol-sensitive fluorescent reporter
that is highly responsive to fluctuations in intracellular cholesterol. Basal HMGCR-Clover levels in ste-
rol-replete tissue culture media were undetectable by flow cytometry (Figure 1B) and phenocopy
endogenous WT HMGCR expression (Figure 1C, compare lanes 1 and 4). Following overnight sterol
depletion, a ~ 25 fold increase in HMGCR-Clover expression was detected (shaded grey to blue his-
togram in Figure 1D, Figure 1C (lanes 2 and 5)), representing a combination of increased SREBP-
induced transcription and decreased sterol-induced HMGCR degradation. Reintroduction of sterols
induced the rapid degradation of HMGCR-Clover (~80% decrease within 2 hr), confirming the sterol-
dependent regulation of the reporter (blue to red histogram in Figure 1D). Residual, untagged
HMGCR detected by immunoblot analysis in the reporter cells under sterol-depleted conditions sug-
gested that at least one HMGCR allele remained untagged (Figure 1C, compare lanes 2 and 5),
which was confirmed by PCR-amplification and sequencing of the genomic locus (Figure 1—figure
supplement 1A–C). The unmodified allele allowed us to monitor both tagged and untagged forms
Menzies et al. eLife 2018;7:e40009. DOI: https://doi.org/10.7554/eLife.40009 3 of 30
Research Communication Cell Biology
Figure 1. Fluorescent protein tagging of endogenous HMGCR generates a cholesterol-sensitive dynamic reporter. (A) Schematic showing generation
of the HMGCR-Clover reporter. (i) The endogenous HMGCR locus of HeLa cells was modified by transfection of Cas9, sgRNA and a donor template.
The 5’ and 3’ arm of the donor template were designed as homologous sequences encoding the C-terminal region and 3’ UTR of the HMGCR gene.
The C-terminal Clover tag (green) was appended in frame to the ORF of HMGCR (blue) including a myc-tag (grey) as spacer and an antibiotic
Figure 1 continued on next page
Menzies et al. eLife 2018;7:e40009. DOI: https://doi.org/10.7554/eLife.40009 4 of 30
Research Communication Cell Biology
of HMGCR. Inhibiting the enzymatic activity of HMGCR with mevastatin also stabilised HMGCR-Clo-
ver expression, as did inhibition of the proteasome (bortezomib) or p97/VCP (NMS-873) (Figure 1E),
confirming the rapid, steady-state degradation of the HMGCR reporter. Furthermore, we showed
that CRISPR/Cas9-mediated ablation of both Insig-1 and 2 together induced a dramatic increase in
HMGCR-Clover expression, equivalent to levels seen following sterol depletion (Figure 1F). Under
these conditions, the SREBP-SCAP complex is not retained in the ER, leading to constitutive SREBP-
mediated transcription of HMGCR-Clover, irrespective of the sterol environment. CRISPR-mediated
gene disruption of either Insig-1 or 2 alone caused only a small, steady-state rescue of HMGCR-
Clover (Figure 1F), which was more pronounced with the loss of Insig-1 than Insig-2. While Insig-1-
deficient cells were unable to completely degrade HMGCR upon sterol addition, only a minor defect
in HMGCR degradation was seen in the absence of Insig-2 (Figure 1F), suggesting that Insig-1 is
dominant over Insig-2 under these conditions. Finally, we confirmed that HMGCR-Clover was appro-
priately localised to the ER by confocal microscopy (Figure 1G). Thus, HMGCR-Clover is a dynamic,
cholesterol-sensitive reporter, which rapidly responds to changes in intracellular cholesterol and is
regulated in a proteasome-dependent manner.
A genome-wide CRISPR/Cas9 screen identifies RNF145 as an E3 ligase
required for HMGCR degradation
To identify genes required for the sterol-induced degradation of HMGCR, we performed a genome-
wide CRISPR/Cas9 knockout screen in HMGCR-Clover cells. We took advantage of the rapid
decrease in HMGCR-Clover expression following sterol addition to cells starved overnight (16 hr) of
sterols (Figure 1D), and enriched for rare genetic mutants with reduced ability to degrade HMGCR-
Clover in response to sterols. To this end, HMGCR-Clover cells were transduced with a genome-
wide CRISPR/Cas9 knockout library comprising 10 sgRNAs per gene (Morgens et al., 2017). Muta-
genised cells were first depleted of sterols overnight; sterols were then reintroduced for 5 hr, at
which point rare mutant cells with reduced ability to degrade HMGCR-Clover upon sterol repletion
were enriched by fluorescence-activated cell sorting (FACS) (Figure 2A, gating shown in Figure 2—
figure supplement 1A). This process was repeated eight days later to further purify the selected
cells. The enriched population contained only a small percentage of cells (1.96% after sort #1,
24.49% after sort #2) with increased steady-state HMGCR-Clover expression (green filled histogram
in Figure 2B). However, the majority of sterol-starved cells from this selected population showed
impaired degradation of HMGCR-Clover after addition of sterols (compare red versus orange filled
histogram (Figure 2B, compare lanes 6 and 9 in Figure 2—figure supplement 1B)). The broad dis-
tribution of this histogram (Figure 2B red histogram) suggested that the enriched cell population
contains a variety of mutants which differ in their ability to degrade HMGCR-Clover.
Figure 1 continued
resistance cassette flanked by loxP sites. (ii) Cells having stably integrated the recombination construct were enriched by antibiotic selection. (iii) The
resistance cassette was removed by transient transfection of Cre recombinase to yield endogenous, C-terminally modified HMGCR (iv). pUb, ubiquitin
promoter; ORF, open reading frame; UTR, untranslated region. (B – E) The HMGCR-Clover reporter phenocopies untagged HMGCR. (B) HMGCR-
Clover expression (grey shaded histogram) as detected by flow cytometry under sterol-replete conditions. (C) Immunoblot of HMGCR in sterol-
depleted (SD) HeLa WT vs. HMGCR-Clover cells -/+sterols (S) for 2 hr. For sterol depletion, cells were switched to SD medium (10% LPDS, mevastatin
(10 mM), mevalonate (50 mM)) for 16 hr. Whole-cell lysates were separated by SDS-PAGE and HMGCR(-Clover) detected with an HMGCR-specific
antibody. (D) Cytofluorometric analysis of HMGCR-Clover HeLa cells cultured in sterol-replete (shaded histogram) vs. sterol-depleted medium (SD) (16
hr, blue line histogram). Sterols (S) (2 mg/ml 25-hydroxycholesterol, 20 mg/ml cholesterol) were added back for 2 hr (red line histogram). (E) Flow
cytometric analysis of HMGCR-Clover cells treated overnight with Bortezomib (25 nM), mevastatin (10 mM), or NMS-873 (10 mM) for 8 hr. (F) CRISPR/
Cas9-mediated depletion of Insig-1 and 2 together (red line histogram) induce a dramatic increase in HMGCR-Clover expression, equivalent to sterol
depletion (SD, orange shaded). HMGCR-Clover cells transiently expressing the indicated Insig-1/2 specific sgRNAs (four sgRNAs per gene) were
treated as in (D) and, where indicated, sterols (S) added back for 4 hr (SD + S, bottom row). Representative of 3 independent experiments. (G)
Immunofluorescence analysis of HMGCR-Clover and KDEL (ER marker) expression, showing co-localisation in sterol-depleted (SD, 16 hr) HMGCR-
Clover HeLa cells. Scale bar = 20 mm.
DOI: https://doi.org/10.7554/eLife.40009.003
The following figure supplement is available for figure 1:
Figure supplement 1. Genotyping of HMGCR-Clover knock-in cells.
DOI: https://doi.org/10.7554/eLife.40009.004
Menzies et al. eLife 2018;7:e40009. DOI: https://doi.org/10.7554/eLife.40009 5 of 30
Research Communication Cell Biology
Figure 2. Genome-wide CRISPR knockout screen identifies a role for RNF145 in the sterol-dependent degradation of HMGCR. (A - B) Schematic view
of the CRISPR/Cas9 knockout screen workflow and FACS enrichment. (A) HMGCR-Clover HeLa cells transduced with a genome-wide sgRNA library
targeting 19930 genes (i) were subjected to overnight sterol-starvation followed by sterol repletion for 5 hr (ii, iii, v, vi). Mutants unable to degrade
HMGCR-Clover despite sterol repletion (Cloverhigh) were enriched by two sequential rounds of FACS (iv, vii) and candidate genes identified by deep
Figure 2 continued on next page
Menzies et al. eLife 2018;7:e40009. DOI: https://doi.org/10.7554/eLife.40009 6 of 30
Research Communication Cell Biology
The sgRNAs in the selected cells, and an unselected control library, were sequenced on the Illu-
mina HiSeq platform (Figure 2A (viii)). Using the RSA algorithm, we identified a set of 11 genes,
which showed significant enrichment (-logP >5) in the selected cells (Figure 2C). Many of these are
known to be required for the sterol-induced degradation of HMGCR (Ko¨nig et al., 2007). The
screen identified the E2 ubiquitin conjugating enzyme UBE2G2 and its accessory factor AUP1, which
recruits UBE2G2 to lipid droplets and membrane E3 ubiquitin ligases (Klemm et al., 2011; Jo et al.,
2013; Spandl et al., 2011; Christianson et al., 2011), as well as both Insig-1 and 2 (Yabe et al.,
2002; Yang et al., 2002; Sever et al., 2003a). The role of the remaining hits is summarized (Table 1)
and validation of selected hits is shown (Insig-1/2, Figure 1F; UBE2G2, EHD1, GALNT11, LDLR and
TECR, Figure 2 – figure supplement 1C/D).
Strikingly, the only ER-resident E3 ubiquitin ligase to emerge from the screen is the poorly charac-
terised RNF145. RNF145 shares 27% amino acid identity with TRC8, which is one of the E3 ligases
(together with gp78) previously suggested to ubiquitinate HMGCR (Jo et al., 2011). Interestingly,
RNF145 also harbours a YLYF motif at its N-terminus, which is similar to the YIYF motif present in
the sterol-sensing domain (SSD) of SCAP and HMGCR required for their binding to the Insig proteins
(Yang et al., 2002; Sever et al., 2003a; Jiang et al., 2018; Cook et al., 2017; Zhang et al., 2017).
The presence of the YLYF motif suggested that RNF145 might itself interact with the Insig proteins
and therefore represented a promising candidate from our genetic screen.
To see if we could validate the role of RNF145 in HMGCR degradation, we designed four inde-
pendent sgRNAs, either targeting RNF145 individually or as a pool. Under cholesterol-replete condi-
tions, no accumulation of the HMGCR-reporter was observed in RNF145-depleted cells (top and
Figure 2 continued
sequencing (viii). (B) Enrichment of HMGCR-Clover mutants after sort #1 and sort #2 (red line histograms, corresponding to steps ‘iv’ and ‘vii’ in
Figure 2A) as determined by flow cytometry. Cells were treated as described in Figure 1D. SD, sterol-depleted; S, sterols. (C) Candidate genes
identified in the genome-wide knockout screen. Genes scoring above the significance threshold of - logP 5 (dotted line) and AUP1 (- logP = 4.7) are
highlighted. (D) RNF145 depletion mildly impairs sterol-accelerated HMGCR-Clover degradation. HMGCR-Clover cells transiently expressing four
independent RNF145-specific sgRNAs (gRNF145#1–4, red line histogram), individually or as a pool, vs. sgB2M (gCTR) were sterol-depleted overnight
(middle row, SD) and re-examined by flow cytometry following 2 hr sterol addition (bottom row, SD + S). Representative of 3 independent
experiments.
DOI: https://doi.org/10.7554/eLife.40009.005
The following figure supplement is available for figure 2:
Figure supplement 1. Genome-wide screen for proteins involved in HMGCR degradation.
DOI: https://doi.org/10.7554/eLife.40009.006
Table 1. Candidate genes (- log(p)5) identified in a genome-wide CRISPR/Cas9 screen for proteins involved HMGCR degradation.
Gene Full name -log(p)* Function
AUP1 Ancient Ubiquitous Protein 1 4.70 ERAD
EHD1 EH Domain Containing 1 6.50 Early endosome membrane fusion
FAF2 Fas Associated Factor Family Member 2 6.63 ERAD
FER Tyrosine-protein Kinase Fer 6.05 Tyrosine kinase
GALNT11 Polypeptide N-acetylgalactosaminyltransferase 11 7.03 Protein glycosylation
INSIG1 Insulin Induced Gene 1 7.50 Cholesterol metabolism
INSIG2 Insulin Induced Gene 2 33.24 Cholesterol metabolism
LDLR Low Density Lipoprotein Receptor 11.44 Cholesterol metabolism
PPAP2C Phospholipid Phosphatase 2 5.67 Glycerolipid synthesis
RNF145 RING Finger Protein 145 9.18 E3 ubiquitin ligase
TECR Trans-2,3-enoyl CoA Reductase 7.45 Very-long chain fatty acid synthesis
UBE2G2 Ubiquitin Conjugating Enzyme E2 G2 31.14 E2 ubiquitin conjugating enzyme
*Only statistically significant hits (-log(p)5) are shown.
DOI: https://doi.org/10.7554/eLife.40009.007
Menzies et al. eLife 2018;7:e40009. DOI: https://doi.org/10.7554/eLife.40009 7 of 30
Research Communication Cell Biology
middle rows, Figure 2D), but a small and highly reproducible decrease in HMGCR-Clover degrada-
tion was seen following re-introduction of sterols (red histograms, bottom row in Figure 2D),
emphasising the utility of the endogenous fluorescent reporter in identifying subtle phenotypes.
Since the identity of the E3 ubiquitin ligases regulating HMGCR turnover remains controversial, the
modest effect of RNF145 loss on HMGCR-Clover sterol-induced degradation suggested the involve-
ment of additional ligase(s). Our screen therefore identified both known and novel components
implicated in sterol-dependent HMGCR ERAD.
RNF145 together with gp78 are required for HMGCR degradation
If a second E3 ligase is partially redundant with RNF145, its effect should be unmasked in RNF145-
deficient cells. We therefore generated a focussed subgenomic sgRNA library targeting 1119 genes
of the ubiquitin-proteasome system as described in ‘Materials and methods’, including 830 pre-
dicted E3 ubiquitin ligases, and used this library to screen for genes required for the degradation of
HMGCR in RNF145-deficient HMGCR-Clover cells (Figure 3—figure supplement 4B, lane two for
knockout validation). Due to the reduced complexity of this focussed library, only a single FACS
enrichment step was used (Figure 3A, red histogram).
Strikingly, this screen identified gp78 (gene name: AMFR) (Figure 3B, Table 2), the E3 ubiquitin
ligase previously implicated in HMGCR degradation (Jo et al., 2011; Song et al., 2005; Fang et al.,
2001). Taking a combined knockout strategy we asked whether gp78 and RNF145 are together
responsible for HMGCR degradation. As predicted by the genetic approach (Figure 3C (ii)), there
was no difference in sterol-induced HMGCR-Clover degradation between control and gp78-
depleted HMGCR-Clover cells. Gp78 was not, therefore, a false-negative from our initial, genome-
wide CRISPR/Cas9 screen (Figure 2C). Individual knockout of RNF145 again showed that sterol-
induced HMGCR-Clover degradation was mildly impaired in RNF145-depleted cells (Figure 3C (iii)).
However, sgRNA-mediated targeting of gp78 together with RNF145 (Figure 3C (iv), see Figure 3—
figure supplement 4A and B lane three for knockout validation), resulted in a significant increase in
both steady-state HMGCR-Clover (Figure 3C (iv) grey to green filled histograms) and an inability to
degrade HMGCR-Clover upon addition of sterols to sterol-starved cells (Figure 3C (iv) blue to red
histogram), a phenotype comparable to UBE2G2 deletion (Figure 3C (v)). Our results therefore sug-
gest a partial functional redundancy between gp78 and RNF145 and imply that both ligases can
independently regulate the sterol-induced degradation of HMGCR.
RNF145 and gp78 regulate endogenous wild type HMGCR
To confirm that the phenotypes observed in RNF145- and gp78-deficient HMGCR-Clover cells were
representative of endogenous, wild type HMGCR regulation, we deleted RNF145 and/or gp78 from
WT HeLa cells and monitored endogenous HMGCR by immunoblot analysis. The sterol-induced deg-
radation of HMGCR was assessed in four RNF145 knockout clones, derived from two different
sgRNAs (validation in Figure 3—figure supplement 1A,B). No difference in the sterol-induced deg-
radation of HMGCR was seen in these RNF145 knockout clones (Figure 3—figure supplement 2,
compare lanes 6 and 7–10). The subtle effect on HMGCR-Clover expression revealed by flow cytom-
etry (Figures 2D and 3C) may not be detected by the less sensitive immunoblot analysis. Similarly,
loss of gp78 alone (Figure 3—figure supplement 3A for sgRNA validation) did not affect HMGCR
degradation (Figure 3D, compare lanes 6 and 7–10), but loss of gp78 together with RNF145
resulted in a significant rescue of steady state HMGCR (Figure 3E, Figure 3—figure supplement
3C). Following sterol addition, gp78/RNF145 double-knockout clones showed a marked (although
still incomplete) reduction in sterol-induced HMGCR degradation (Figure 3F, compare lanes 7 + 8
with 9 –12). These data validate the phenotypes exhibited by the HMGCR-Clover reporter cell line
and confirm a role for both gp78 and RNF145 in the sterol-induced degradation of endogenous
HMGCR.
RNF145 E3 ubiquitin ligase activity is required for HMGCR degradation
To determine whether RNF145 E3 ubiquitin ligase activity is required for HMGCR degradation, we
complemented a population of gp78/RNF145 double-knockout HMGCR-Clover cells (Figure 3—fig-
ure supplement 4B, lane three for knockout validation) with either epitope-tagged wild type
RNF145, or a catalytically-inactive RNF145 RING domain mutant (C552A, H554A) (Figure 4A). The
Menzies et al. eLife 2018;7:e40009. DOI: https://doi.org/10.7554/eLife.40009 8 of 30
Research Communication Cell Biology
Figure 3. RNF145 together with gp78 are required for HMGCR degradation. (A - B) FACS enrichment and scatter plot of candidate genes identified in
the ubiquitome-targeted knockout screen. (A) HMGCR-Clover DRNF145#5 HeLa cells were mutagenized using a targeted ubiquitome-specific sgRNA
library and mutant cells showing impaired sterol-dependent degradation of HMGCR-Clover were enriched by FACS. Enrichment is represented by a
broad population of Cloverhigh cells in the presence of sterols (S, 2 hr) after overnight sterol depletion (SD, blue to red histogram). (B) Genes scoring
Figure 3 continued on next page
Menzies et al. eLife 2018;7:e40009. DOI: https://doi.org/10.7554/eLife.40009 9 of 30
Research Communication Cell Biology
pronounced block in the sterol-induced degradation of HMGCR-Clover was at least partially rescued
by expression of wild type, but not the RNF145 RING domain mutant (Figure 4B, compare blue to
red histogram). The E3 ligase activity of RNF145 is therefore critical for HMGCR ERAD.
Endogenous RNF145 is an unstable E3 ligase, whose transcription is
sterol-regulated
Endogenous RNF145 has a short half-life (~2 hr) and displayed rapid, proteasome-mediated degra-
dation (Figure 5A (i)), an observation confirmed in multiple cell lines (Figure 5—figure supplement
1A). This rapid turnover of endogenous RNF145 contrasts sharply with the stability of endogenous
gp78, which shows little degradation over the 10 hr chase period (Figure 5A (i)). Although RNF145
and gp78 both target HMGCR for degradation, the two ligases did not appear to be co-regulated
as RNF145 stability was unaffected by gp78 and vice-versa (Figure 5A (i, ii), Figure 5—figure sup-
plement 1B). However, endogenous RNF145 was stabilised by deletion of its cognate E2 enzyme
UBE2G2 (Figure 5B), and, furthermore, the catalytically-inactive RING domain mutant expressed in
RNF145-deficient cells (DRNF145 #4 + RNF145-V5 (mut)) exhibited greater abundance at steady-
state compared with its wild type counterpart (Figure 3—figure supplement 4C). Together these
data show that RNF145 is intrinsically unstable and rapidly turned over in an auto-regulatory
manner.
Since RNF145 is rapidly turned over, we aimed to determine whether RNF145 gene transcription
was sterol-responsive. Sterol depletion induced RNF145 (~2.99 ± 0.65 fold increase, p=0.0009)
mRNA expression as well as HMGCR (~12.26 ± 3.16 fold increase, p=0.0004) mRNA expression
Figure 3 continued
above the significance threshold of - logP 5 (dotted line) are highlighted. (C - F) sgRNA targeting of gp78 together with RNF145 increases steady-
state HMGCR-Clover and inhibits sterol-accelerated degradation of HMGCR-Clover in sterol-starved cells. (C) HMGCR-Clover cells transiently
transfected with indicated sgRNAs were sterol-depleted (SD) overnight (blue line histogram) and sterols (2 mg/ml 25-hydroxycholesterol, 20 mg/ml
cholesterol) added back (SD + S) for 2 hr (red line histogram or blue shaded histogram for sgB2M (gCTR)). Representative of 3 independent
experiments. (D) Four independent gp78 knockout clones (#1–4) or WT cells were sterol-depleted (16 hr) ± S (4 hr) and HMGCR levels monitored by
immunoblotting. LE, long exposure. (E) HMGCR steady-state levels in three RNF145/gp78 double knockout clones (DRDG #1–3). (F) Four RNF145/gp78
double-knockout clones (DRDG #4–7), RNF145 knockout, and WT cells were sterol-depleted (SD) overnight and HMGCR expression assessed ± sterols
(S, 4 hr) by immunoblot analysis.
DOI: https://doi.org/10.7554/eLife.40009.008
The following figure supplements are available for figure 3:
Figure supplement 1. Validation of RNF145 knockout clones.
DOI: https://doi.org/10.7554/eLife.40009.009
Figure supplement 2. RNF145 loss is insufficient to block sterol-induced HMGCR degradation.
DOI: https://doi.org/10.7554/eLife.40009.010
Figure supplement 3. RNF145/gp78 double-knockout cells show increased HMGCR at steady-state and impaired sterol-induced HMGCR degradation.
DOI: https://doi.org/10.7554/eLife.40009.011
Figure supplement 4. Establishment of RNF145/gp78 knockout HeLa HMCR-Clover and RNF145 complementation cell lines.
DOI: https://doi.org/10.7554/eLife.40009.012
Table 2. Candidate genes (-log(p)5) identified in a ubiquitome CRISPR/Cas9 screen for proteins mediating HMGCR degradation in
RNF145-deficient cells.
Gene Full name -log(p)* Function
AMFR Gp78/Autocrine Motility Factor Receptor 10.87 E3 ubiquitin ligase
ANKFY1 Ankyrin Repeat And FYVE Domain Containing 1 6.19 Proposed Rab5 effector
FAF2 Fas Associated Factor Family Member 2 5.05 ERAD
NPLOC4 NPL4 Homolog 7.63 Ubiquitin recognition factor
RABGEF1 RAB Guanine Nucleotide Exchange Factor 1 8.56 Nucleotide exchange factor, E3 ubiquitin ligase
UBE2G2 Ubiquitin Conjugating Enzyme E2 G2 13.66 E2 ubiquitin conjugating enzyme
*Only statistically significant hits (-log(p)5) are shown.
DOI: https://doi.org/10.7554/eLife.40009.013
Menzies et al. eLife 2018;7:e40009. DOI: https://doi.org/10.7554/eLife.40009 10 of 30
Research Communication Cell Biology
(Figure 5C). This accumulation of endogenous RNF145 was suppressed following the addition of
methyl beta-cyclodextrin (MBCD)-complexed cholesterol (Chol/MBCD) to the starvation media
(Figure 5D), whereas gp78 abundance remained unaltered (Figure 5—figure supplement 1D).
RNF145 is therefore a unique, sterol-regulated E3 ubiquitin ligase whose expression is dependent
on the cellular sterol status.
Endogenous RNF145 shows a sterol-sensitive interaction with HMGCR
and Insig-1
The Insig proteins provide an ER-resident platform for sterol-dependent interactions between
HMGCR and its regulatory components (Dong et al., 2012). Since RNF145 is sterol-regulated and
degrades HMGCR we initially wanted to know if RNF145 interacts with HMGCR. We found that in
sterol-replete but not sterol-deplete conditions, endogenous HMGCR co-immunoprecipitates both
epitope-tagged RNF145 (Figure 6A, Figure 3—figure supplement 4C lane three for relative
RNF145-V5 levels upon reconstitution), as well as endogenous RNF145 (Figure 6B). Initial attempts
to ascertain whether this interaction between RNF145 and HMGCR was direct, or mediated via the
Insig proteins were challenging due to the low expression levels of endogenous RNF145. We circum-
vented this problem by performing the co-immunoprecipitation in UBE2G2 knockout cells, which
express increased levels of endogenous RNF145 (Figure 5B). Under these conditions, RNF145
showed a clear, sterol-dependent interaction with Insig-1, correlating with RNF145’s association with
HMGCR (Figure 6C). Importantly, endogenous RNF145 is not, therefore, continually bound to Insig-
1, but, like HMGCR, associates with Insig-1 in a sterol-dependent manner.
Binding of RNF145 to Insig-1 was HMGCR-independent (Figure 6D) and, in the absence of Insigs,
RNF145 was unable to bind HMGCR (Figure 6E, see Figure 6—figure supplement 1A–C for gener-
ation of Insig-1+2 knockout cells). Insigs are therefore indispensable for the interaction between
RNF145 and HMGCR. These findings emphasize the central role of Insig proteins as scaffolds in the
sterol-induced engagement of HMGCR by RNF145.
In the absence of RNF145 and gp78, Hrd1 targets HMGCR for
degradation
Despite our two genetic screens identifying a requirement for RNF145 and gp78 in HMGCR degra-
dation (Figures 2C and 3B), the combined loss of these two ligases failed to completely inhibit ste-
rol-induced HMGCR degradation (Figure 3C (iv); Figure 7A (ii)). Furthermore, ablation of UBE2G2
in RNF145/gp78 double-knockout cells exacerbated the sterol-dependent degradation defect
Figure 4. RNF145 E3 ligase activity is required for HMGCR degradation. (A) Exogenous expression of RNF145 and RING-mutant RNF145 in HMGCR-
Clover HeLa cells. RNF145/gp78 double-knockout HMGCR-Clover cells were transduced with lentivirus expressing either RNF145-V5 (WT) or a
catalytically inactive RING domain mutant RNF145(C552A, H554A)-V5 cDNA (RING mutant) and cell lysates separated by SDS-PAGE and visualised by
immunoblot analysis. IB, immunoblot. (B) Wild type, but not RING mutant RNF145, complements the RNF145-deficiency phenotype. RNF145/gp78
double-knockout HMGCR-Clover cells (DRDG #11) were transduced with lentivirus expressing either RNF145-V5 or a catalytically inactive RING domain
mutant RNF145(C552A, H554A)-V5 cDNA. Cells were sterol-depleted (16 hr) and after sterol repletion (2 hr), HMGCR-Clover levels were assessed by
flow cytometry.
DOI: https://doi.org/10.7554/eLife.40009.014
Menzies et al. eLife 2018;7:e40009. DOI: https://doi.org/10.7554/eLife.40009 11 of 30
Research Communication Cell Biology
Figure 5. RNF145 is an intrinsically unstable, sterol-responsive E3 ligase. (A and B) RNF145 has a short half-life and is auto-regulated by UBE2G2. (A)
Translational shutoff analysis of gp78 in WT versus DRNF145 #4 (i) or RNF145 in Dgp78 #3 cells (ii) treated with cycloheximide (CHX, 1 mg/ml) ± MG132
(20 mg/ml) for the indicated times. Non-specific bands are indicated by an asterisk (*). Representative of 2 independent experiments. (B) Immunoblot
analysis of WT and DUBE2G2 HeLa cells treated with CHX (1 mg/ml) for the indicated times. VCP serves as a loading control. LE, long exposure. An
asterisk (*) signifies non-specific bands. (C and D) Sterol depletion induces transcriptional activation and increased levels of RNF145 protein. (C) Relative
RNF145 and HMGCR mRNA levels as measured by quantitative PCR in HeLa cells grown in 10% FCS (FCS) or sterol-depleted (SD, 10% LPDS + 10 mM
mevastatin + 50 mM mevalonate) for 48 hr. Mean ± S.D. (n = 4) and significance are shown, unpaired Students t-test: ***p0.001. (D) HeLa cells were
grown under sterol-rich or -deplete conditions (±SD, as indicated) for 48 hr in the presence of mevastatin (10 mM) and mevalonate (50 mM) ± complexed
cholesterol (Chol:MBCD, 37.5 mM). Whole-cell lysates were separated by SDS-PAGE and underwent immunoblot analysis. Non-specific bands are
indicated (*). Representative of 2 independent experiments.
DOI: https://doi.org/10.7554/eLife.40009.015
The following source data and figure supplements are available for figure 5:
Source data 1. Raw data from qPCR experiment in Figure 5C.
DOI: https://doi.org/10.7554/eLife.40009.019
Figure supplement 1. RNF145 is rapidly degraded by the ubiquitin proteasome system.
DOI: https://doi.org/10.7554/eLife.40009.016
Figure supplement 2. Increased RNF145 transcription upon sterol depletion is LXR-independent.
DOI: https://doi.org/10.7554/eLife.40009.017
Figure 5 continued on next page
Menzies et al. eLife 2018;7:e40009. DOI: https://doi.org/10.7554/eLife.40009 12 of 30
Research Communication Cell Biology
(Figure 7A (iv)), predicting the role for an additional E3 ubiquitin ligase(s) utilising UBE2G2 in
HMGCR degradation. We therefore assessed whether ablation of either of the two remaining ER-
resident E3 ligases known to use UBE2G2, TRC8 (van de Weijer et al., 2017) and Hrd1
(Kikkert et al., 2004), exacerbated the HMGCR-degradation defect in RNF145/gp78 double-knock-
out cells (Figure 7B, Figure 7—figure supplements 1B and 2B for knockdown validation). While the
loss of TRC8 had no effect on HMGCR-Clover expression, the loss of Hrd1 in RNF145/gp78 double-
knockout cells increased steady-state HMGCR-Clover expression and caused a complete block in
the sterol-accelerated degradation of HMGCR-Clover (Figure 7B (ii), Figure 7—figure supplement
1A for validation with individual independent sgRNAs). This additive effect of Hrd1 depletion on the
sterol-induced turnover of endogenous HMGCR was independently confirmed by immunoblot analy-
sis (Figure 7C, compare lanes 2, 4 and 6) and was observed as early as 60 min after sterol addition
(Figure 7—figure supplement 1D, compare lanes 7 and 9). Importantly, depletion of Hrd1, alone or
in combination with depletion of either gp78 or RNF145, did not affect HMGCR-Clover degradation
(Figure 7—figure supplement 1C). Moreover, TRC8 depletion affected neither steady-state
HMGCR-Clover expression, nor sterol-induced HMGCR-Clover degradation (Figure 7B (iii)). Indeed,
despite a functional TRC8 depletion (Figure 7—figure supplement 2B for validation of TRC8 deple-
tion) (Stagg et al., 2009), we could detect no role for TRC8, depleted either alone or in combination
with RNF145, in the sterol-induced degradation of HMGCR (Figure 7—figure supplement 2A).
In summary, gp78 with RNF145 are the only combination of ligases whose loss inhibited HMGCR
degradation. Hrd1 depletion also delays sterol-induced HMGCR degradation, but only in the
absence of RNF145 and gp78.
RNF145, gp78 and Hrd1 are required for sterol-accelerated HMGCR
ubiquitination
As a complete block of sterol-accelerated HMGCR degradation required the depletion of all three
UBE2G2-dependent E3 ubiquitin ligases, we determined how the sequential depletion of these
ligases affected the ubiquitination status of HMGCR. The combined loss of RNF145 with gp78
showed a dramatic reduction in HMGCR ubiquitination, but a complete loss of ubiquitination
required the depletion of all three ligases (Figure 7D). As predicted, depletion of UBE2G2 also
caused a marked decrease in HMGCR ubiquitination. Taken together, these results demonstrate the
remarkable plasticity of the HMGCR-degradation machinery.
Discussion
The generation of a dynamic, cholesterol-sensitive endogenous HMGCR reporter cell line allowed an
unbiased genetic approach to identify the cellular machinery required for sterol-accelerated HMGCR
degradation. This reporter cell line has the advantage of being able to identify both complete and
partial phenotypes and helps explain why the identity of the E3 ubiquitin ligases responsible for the
sterol-accelerated degradation of HMGCR has remained controversial. We find that three E3 ubiqui-
tin ligases - RNF145, gp78 and Hrd1 - are together responsible for HMGCR degradation (Figure 8).
The activity of the two primary ligases, RNF145 and gp78 is partially redundant as the loss of gp78
alone did not affect HMGCR degradation, while loss of RNF145 showed only a small reduction on
HMGCR degradation. In the absence of both RNF145 and gp78, a third ligase, Hrd1, can compen-
sate and partially regulate HGMCR degradation, but this effect of Hrd1 is only revealed in the
absence of both RNF145 and gp78, and in no other identified combination.
Initial reports of a role for gp78 in HMGCR degradation, either alone (Song et al., 2005) or in
combination with TRC8 (Jo et al., 2011), were not reproduced in an independent study (Tsai et al.,
2012) and so this important issue has remained unresolved. Our initial genome-wide screen success-
fully identified a single E3 ligase (RNF145) as well as many of the components known to be required
for sterol-accelerated HMGCR degradation (e.g. Insig-1/2, UBE2G2, AUP1, FAF2; Figure 2C)
Figure 5 continued
Figure supplement 2—source data 1. Raw data from qPCR experiment in Figure 5—figure supplement 2B.
DOI: https://doi.org/10.7554/eLife.40009.018
Menzies et al. eLife 2018;7:e40009. DOI: https://doi.org/10.7554/eLife.40009 13 of 30
Research Communication Cell Biology
Figure 6. Endogenous RNF145 shows sterol-sensitive binding to Insig-1 and HMGCR. (A) Exogenous RNF145 shows sterol-sensitive binding to
HMGCR. RNF145 knockout cells stably reconstituted with RNF145-V5 (DR145 #4 + R145-V5, as shown in Figure 3—figure supplement 4C, lane 3) were
sterol-depleted (SD, 20 hr) and, where indicated, sterols (S) added back for 1 hr in the presence of NMS-873 (10 mM, 1.5 hr). RNF145-V5 was affinity-
purified (AP) and HMGCR detected by immunoblotting. Representative of 3 independent experiments. (B - C) Endogenous RNF145 shows sterol-
sensitive binding to HMGCR and Insig-1. (B) HeLa WT or DRNF145 #4 (DR) cells were treated as in (A), endogenous RNF145 was immunoprecipitated
(IP), and RNF145 and HMGCR detected by immunoblot analysis. Non-specific bands are designated by an asterisk (*). Representative of 3
independent experiments. (C) HeLa UBE2G2 knockout cells (DUBE2G2 #1) were sterol-depleted (SD, 20 hr) and, where indicated, sterols (S) added for 1
Figure 6 continued on next page
Menzies et al. eLife 2018;7:e40009. DOI: https://doi.org/10.7554/eLife.40009 14 of 30
Research Communication Cell Biology
(Sever et al., 2003b; Miao et al., 2010; Jo et al., 2013), thus validating the suitability of this genetic
approach.
For a small number of validated hits from our screen (Figure 2C, Figure 2—figure supplement
1D), the effects on sterol-accelerated HMGCR degradation were unanticipated and likely reflect
wide-ranging alterations to the protein and lipid environment. Trans-2,3-enoyl CoA reductase
(TECR) catalyses the final steps in the synthesis of very long-chain fatty acids (VLCFAs) (Moon and
Horton, 2003) as well as the saturation step in sphingolipid degradation (Wakashima et al., 2014).
Polypeptide N-acetylgalctosaminyltransferase 11 (GALNT11) initiates protein O-linked glycosylation,
suggesting that a protein involved in HMGCR regulation requires O-linked glycosylation
(Schwientek et al., 2002). Interestingly, our screen revealed that loss of the LDLR impaired
HMGCR-Clover degradation. This finding is unexpected as the cholesterol added to the cells to
induce HMGCR degradation was not in the form of LDL. EH domain-containing protein 1 (EHD1) is
required for the internalisation and recycling of several plasma membrane receptors, including the
LDLR (Naslavsky et al., 2007; Naslavsky and Caplan, 2011) and loss of EDH1 impairs LDLR traffick-
ing with decreased intracellular cholesterol levels (Naslavsky et al., 2007). The other significant hits
in the screen (PPAP2C, FER) have not been validated.
The screen also identified the E2 ubiquitin conjugating enzyme UBE2G2 and the E3 ubiquitin
ligase RNF145. Depletion of UBE2G2 prevented HMGCR degradation, implying that all ligases
involved in HMGCR degradation utilise this E2 enzyme. In contrast, and despite being a high confi-
dence hit in our screen, depletion of RNF145 caused a highly reproducible but small inhibition of
sterol-accelerated HMGCR degradation, confirming the sensitivity of the screen to detect partial
phenotypes and predicting the requirement for at least one additional UBE2G2-dependent ligase. A
subsequent, targeted ubiquitome library screen in an RNF145-knockout reporter cell line confirmed
a role for gp78 in HMGCR degradation. Gp78 has previously been shown to use UBE2G2 as its cog-
nate E2 enzyme in the degradation of ERAD substrates (Chen et al., 2006). During preparation of
this manuscript, the combined involvement of RNF145 and gp78 in Insig-mediated HMGCR degra-
dation in hamster (CHO) cells was also reported (Jiang et al., 2018), confirming the role for these
ligases in other species.
The availability of an RNF145-specific polyclonal antibody provides further insight into the expres-
sion and activity of endogenous RNF145, without the concerns of overexpression artefacts. RNF145
is an ER-resident E3 ubiquitin ligase with several unique features that make it well-suited for HMGCR
regulation. A challenge facing all proteins responsible for cholesterol regulation is that the target
they monitor, cholesterol, resides entirely within membranes. Like HMGCR and SCAP, RNF145 con-
tains a putative sterol-sensing domain in its transmembrane region (Cook et al., 2017), suggesting
that sterols may facilitate RNF145’s association with Insigs. In contrast to Jiang et al., 2018, who
reported a constitutive, sterol-independent association between ectopically expressed RNF145 and
Insig-1 or 2, we find that endogenous RNF145 interacts with endogenous Insig-1 in a sterol-depen-
dent manner (Figure 6C), as reported for the interaction of SCAP and HMGCR with the Insig pro-
teins (Lee et al., 2007). The binding of RNF145 to Insig-1 is HMGCR-independent (Figure 6D).
Furthermore, in the absence of Insigs, the RNF145-HMGCR association is lost (Figure 6E), implying
that the interaction between these two proteins is absolutely Insig-dependent. Therefore, sterols
trigger the recruitment of RNF145 to HMGCR via Insigs, leading to HMGCR ubiquitination and
Figure 6 continued
hr. Endogenous RNF145 was affinity-purified and following SDS-PAGE separation, Insig-1 and HMGCR detected by immunoblot analysis.
Representative of 2 independent experiments. (D - E) Insigs mediate binding between RNF145 and HMGCR. (D) HeLa UBE2G2 knockout cells
(DUBE2G2 #1) transfected with a pool of four sgRNAs targeting HMGCR (gHMGCR) or sgRNA targeting B2M (gCTR) were enriched by puromycin
selection and sterol-depleted for 20 hr, before adding back sterols for 1 hr + NMS-873 (10 mM, 1.5 hr). Endogenous RNF145 was immunoprecipitated
and Insig-1 and HMGCR detected by immunoblot analysis. Non-specific bands are designated by an asterisk (*). (E) HMGCR-Clover HeLa WT or Insig-1
+2 knockout (DIn-1+2) cells were transfected with a pool of three sgRNAs targeting UBE2G2 (gUBE2G2) and treated as in (D). Non-specific bands are
designated by an asterisk (*).
DOI: https://doi.org/10.7554/eLife.40009.020
The following figure supplement is available for figure 6:
Figure supplement 1. Generation of Insig knockout cell lines.
DOI: https://doi.org/10.7554/eLife.40009.021
Menzies et al. eLife 2018;7:e40009. DOI: https://doi.org/10.7554/eLife.40009 15 of 30
Research Communication Cell Biology
Figure 7. In the absence of RNF145 and gp78, Hrd1 targets HMGCR for ubiquitination and degradation. (A) Loss of gp78, RNF145 and UBE2G2 exert
an additive effect on HMGCR degradation. WT or RNF145/gp78 double knockout (DRDG #11) HMGCR-Clover HeLa cells transiently expressing sgRNAs
targeting UBE2G2 (gUBE2G2) or B2M (gCTR) were enriched by puromycin selection, sterol-depleted (SD) overnight and HMGCR-Clover expression
assessed ± sterols (S, 4 hr). Representative of 3 independent experiments. (B and C) A targeted gene approach shows that loss of Hrd1 from RNF145/
Figure 7 continued on next page
Menzies et al. eLife 2018;7:e40009. DOI: https://doi.org/10.7554/eLife.40009 16 of 30
Research Communication Cell Biology
degradation. This ability of RNF145 to rapidly bind Insigs following sterol availability supports a key
role for this ligase in HMGCR regulation.
A striking feature of RNF145 is its short half-life and rapid proteasome-mediated degradation,
which contrasts with the long-lived gp78 (Figure 5A/B, Figure 5—figure supplement 1B). RNF145
is an intrinsically unstable ligase whose half-life is regulated through autoubiquitination and was not
prolonged on binding to Insig proteins (data not shown). Its stability and turnover is RING- and
UBE2G2-dependent, but independent of either the gp78 (Figure 6A- C ) or Hrd1 E3 ligase (Fig-
ure 5—figure supplement 1C). As cells become sterol-depleted, the transcriptional increase in
RNF145 (Figure 5C/D) likely anticipates the need to rapidly eliminate HMGCR, once normal cellular
sterol levels are restored.
While this sterol-dependent transcriptional increase in RNF145 expression may at first seem coun-
terintuitive, under sterol-deplete conditions the RNF145 ligase is not engaged with Insigs or its
HMGCR substrate. The build-up of RNF145 predicts the restoration of sterol concentrations allowing
RNF145 to immediately engage with, and degrade its HMGCR substrate. Thus the build-up of
RNF145 anticipates its critical role in the restoration of cellular cholesterol homeostasis.
RNF145 transcription was reported to be regulated by the sterol-responsive Liver X Receptor
(LXR) family of transcription factors (Cook et al., 2017; Zhang et al., 2017), which transcriptionally
activate cholesterol efflux pumps (ABCA1, ABCG1) (Costet, 2000; Edwards et al., 2002) and the
IDOL E3 ubiquitin ligase, which targets the LDLR for degradation (Zelcer et al., 2009). Pharmaco-
logical treatment of HeLa cells with the LXR inducer (GW3965) increased protein levels of ABCA1,
but RNF145 transcript levels were not significantly increased (Figure 5 – figure supplement 2A/B).
In HeLa cells, therefore, the increased expression of RNF145 following cholesterol starvation is not
primarily driven by the LXR pathway.
While it is not unusual for more than one ligase to be required for substrate ERAD degradation
(Christianson and Ye, 2014; Morito et al., 2008; Stefanovic-Barrett et al., 2018), the redundancy
in HMGCR turnover is intriguing. This may simply reflect the central role of HMGCR in the mevalo-
nate pathway and the importance of a fail-safe mechanism of HMGCR regulation to both maintain
substrates for non-sterol isoprenoid synthesis and prevent cholesterol overproduction. Alternative
explanations can also be considered, particularly as the properties of RNF145 and gp78 are so differ-
ent. Under sterol-deplete conditions gp78 also regulates the degradation of Insig-1, but following
addition of sterols, the association of Insigs with SCAP displaces Insigs binding to gp78 (Yang et al.,
2002; Lee et al., 2006). Different Insig-associated complexes are therefore likely to co-exist within
the ER membrane, under both sterol-replete and -deplete conditions, and will reflect the sterol
microenvironment of the ER (Goldstein et al., 2006). Under these circumstances it might be advan-
tageous to have more than one ligase regulating HMGCR. Alternatively, gp78 may provide basal
control of the reductase, which can then be ‘fine-tuned’ by the sterol-responsive RNF145, reflecting
the sterol concentration of the local ER environment. Further understanding of the stoichiometry
and nature of the different Insig complexes within the ER membrane will be important. While all cells
need to regulate their intracellular cholesterol, the contribution of each ligase to sterol regulation
Figure 7 continued
gp78 double knockout cells blocks sterol-accelerated degradation of HMGCR. (B) WT and DRNF145 Dgp78 (DRDG #11) HMGCR-Clover cells transfected
with sgB2M (gCTR), a pool of 3-4 sgRNAs targeting either Hrd1 (gHrd1), TRC8 (gTRC8) or UBE2G2 (gUBE2G2), were sterol-depleted (SD, 20 hr) and
HMGCR-Clover expression assessed by FACS analysis ± sterols (S, 2 hr). (C) WT and RNF145/gp78 double knockout cells (DRDG #7) were transfected
with a pool of four Hrd1-specific sgRNAs or gCTR, sterol-depleted overnight before addition of sterols (4 hr) and analysis by SDS-PAGE and
immunoblotting. RNF145 and gp78 knockout validation is shown in Figure 3—figure supplement 1B (DRNF145 #1) and Figure 3—figure supplement
3B (DRDG #7), respectively. (D) RNF145, gp78 and Hrd1 are required for sterol-accelerated HMGCR ubiquitination. HMGCR was immunoprecipitated
(IP) from the indicated cell lines grown in sterol-depleted media (20 hr) ± sterols (1 hr). MG-132 (50 mM) was added 30 min before sterol
supplementation. Ubiquitinated HMGCR was detected using an anti-ubiquitin antibody.
DOI: https://doi.org/10.7554/eLife.40009.022
The following figure supplements are available for figure 7:
Figure supplement 1. Combinatorial depletion of E3 ubiquitin ligases.
DOI: https://doi.org/10.7554/eLife.40009.023
Figure supplement 2. TRC8 depletion does not affect HMGCR-Clover degradation.
DOI: https://doi.org/10.7554/eLife.40009.024
Menzies et al. eLife 2018;7:e40009. DOI: https://doi.org/10.7554/eLife.40009 17 of 30
Research Communication Cell Biology
Figure 8. Sterol-induced HMGCR degradation by RNF145, gp78 and Hrd1. (i) Under sterol-depleted conditions (shaded orange), HMGCR, Insigs and
RNF145 are transcriptionally induced leading to accumulation of RNF145 and HMGCR. Insigs are continually turned over by gp78-mediated
polyubiquitination, extracted from the membrane by VCP and degraded by the 26S proteasome. HMGCR stability is dramatically increased as it is not
engaged by either RNF145, gp78 or their shared E2 ubiquitin conjugating enzyme UBE2G2 (G2). In the presence of sterols (shaded blue), RNF145 and
gp78 are recruited to HMGCR in an Insig-assisted fashion, mediating the sterol-accelerated and UBE2G2-dependent degradation of HMGCR by the
ubiquitin-proteasome system. Under these conditions both RNF145 and gp78 can independently ubiquitinate HMGCR, which is then extracted from the
ER membrane in a VCP-dependent manner. The stoichiometry and make-up of the different Insig complexes within the ER membrane are unknown. (ii)
When both RNF145 and gp78 are not available (DRNF145 + Dgp78), Hrd1 and UBE2G2 can promote removal of HMGCR in the presence of sterols.
DOI: https://doi.org/10.7554/eLife.40009.025
Menzies et al. eLife 2018;7:e40009. DOI: https://doi.org/10.7554/eLife.40009 18 of 30
Research Communication Cell Biology
may also depend on their differential tissue expression. In this regard, liver-specific ablation of gp78
in mice has been reported to lead to increased steady-state levels of hepatocyte HMGCR (Liu et al.,
2012), whereas gp78 knockout MEFs show no apparent impairment in HMGCR degradation
(Tsai et al., 2012). Further delineation of the contribution of each ligase to HMGCR degradation in
different tissues and cell types will be important.
A role for the Hrd1 E3 ligase in HMGCR regulation was unanticipated, and both orthologues
(gp78 and Hrd1) of yeast Hrd1p, which regulates yeast HMGCR (Hmg2p), are therefore involved in
mammalian HMGCR turnover. The best recognised function of Hrd1 is the ubiquitination of mis-
folded or unassembled ER-lumenal and membrane proteins targeted for ERAD (Sato et al., 2009;
Tyler et al., 2012; Christianson et al., 2008). Our finding that Hrd1 is only involved in HMGCR reg-
ulation when the other two ligases are absent, suggests that under sterol-rich conditions, and in the
absence of RNF145 or gp78, conformational changes in the sterol-sensing domains of HMGCR may
lead to a less ordered state and be recognised and targeted by the Hrd1 quality control pathway.
Ligand-induced selective and reversible local misfolding in Hmg2p, dubbed ‘mallostery’, is a sug-
gested mode of recognition by Hrd1p (Wangeline et al., 2017; Wangeline and Hampton, 2018).
The mechanism underlying recognition of HMGCR by Hrd1 is unclear, and whether the Hrd1 com-
plex directly recognises sterol-induced structural changes as seen with Hmg2 degradation in yeast is
unknown. Hrd1 might utilise the Insig proteins as scaffolds for HMGCR binding. This is partially
borne out in the complete rescue of HMGCR in Insig-1 and 2 depleted cells (Figure 1F). These
mechanisms are not mutually exclusive and suggest that the contributions by different ligases may
represent a regulated misfolding event as part of a ligand-mediated control of HMGCR stability. Fur-
ther investigation is needed to clearly determine their contribution to HMGCR regulation.
In summary, our unbiased approach to identify proteins involved in sterol-regulated HMGCR deg-
radation resolves the ambiguity of the responsible E3 ubiquitin ligases, and uncovers additional con-
trol points in modulating the activity of this important enzyme in health and disease.
Materials and methods
Key resources table
Reagent type Designation Source Identifiers
Additional
information
Antibody anti-gp78
(rabbit polyclonal)
ProteinTech,
16675–1-AP
RRID:AB_2226463 WB (1:1000)
Antibody anti-ubiquitin
(mouse monoclonal)
Life Sensors,
VU101
RRID:AB_2716558 WB (1:1000)
Antibody anti-V5 tag
(mouse monoclonal)
Abcam,
ab27671
RRID:AB_471093 WB (1:1000)
Antibody anti-Insig-1
(rabbit polyclonal)
Abcam,
ab70784
RRID:AB_1269181 WB (1:1000)
Antibody anti-Hrd1
(rabbit polyclonal)
Abgent,
AP2184a
RRID:AB_2199838 WB (1:5000)
Antibody anti-TRC8
(rabbit polyclonal)
Santa Cruz,
sc-68373
RRID:AB_2238721 WB (1:2000)
Antibody anti-HMGCR
(mouse monoclonal)
Santa Cruz,
sc-271595
RRID:AB_10650274 WB (1:1000)
Antibody anti-UBE2G2
(mouse monoclonal)
Santa Cruz
Biotechnology,
sc-100613
RRID:AB_1130984 WB (1:1000)
Recombinant
DNA reagent
pSpCas9(BB)2A-
Puro V1 (plasmid)
Addgene #48139 n/a
Recombinant
DNA reagent
pSpCas9(BB)2A-
Puro V2 (plasmid)
Addgene #62988 n/a
Recombinant
DNA reagent
pKLV-U6gRNA(BbsI)-
PGKpuro2ABFP (plasmid)
Addgene # 50946 n/a
Continued on next page
Menzies et al. eLife 2018;7:e40009. DOI: https://doi.org/10.7554/eLife.40009 19 of 30
Research Communication Cell Biology
Continued
Reagent type Designation Source Identifiers
Additional
information
Recombinant
DNA reagent
genome-wide
sgRNA library
other n/a kind gift from
the Bassik lab
(Stanford University),
PMID: 28474669
Recombinant
DNA reagent
ubiquitome sgRNA library this study n/a Generated by Lehner
and Nathan labs
Peptide,
recombinant
protein
V5 peptide Sigma-Aldrich V7754-4MG
Chemical
compound, drug
lipoprotein-
deficient serum (LPDS)
Biosera FB-1001L/100
Chemical
compound, drug
digitonin Merck 300410–5 GM
Chemical
compound, drug
mevastatin Sigma-Aldrich M2537-5MG
Chemical
compound, drug
mevalonolactone Sigma-Aldrich M4467-1G
Chemical
compound, drug
cholesterol Sigma-Aldrich C3045-5G
Chemical
compound, drug
25-hydroxycholesterol Sigma-Aldrich H1015-10MG
Chemical
compound, drug
methyl-b-
cyclodextrin (MBCD)
Sigma-Aldrich 332615–1G
Chemical
compound, drug
NMS-873 Selleckchem s728501
Chemical
compound, drug
cycloheximide Sigma-Aldrich C-7698
Chemical
compound, drug
IgG Sepharose
6 Fast Flow
GE Healthcare 17-0969-01
Chemical
compound, drug
Protein
A-Sepharose
Sigma-Aldrich P3391-1.5G
Chemical
compound, drug
iodoacetamide Sigma-Aldrich I1149-5G
Chemical
compound, drug
cOmplete
protease inhibitor
Roche 27368400
Chemical
compound, drug
phenylmethyl
sulfonyl
fluoride (PMSF)
Roche 20039220
Chemical
compound, drug
N-ethylmaleimide
(NEM)
Sigma-Aldrich E3876-5G
Chemical
compound, drug
puromycin Cayman Chemicals 13884
Chemical
compound, drug
hygromycin B Invitrogen 10687010
Plasmids and expression constructs
Single guide RNAs (sgRNAs) were cloned into pSpCas9(BB)2A-Puro V1 (Addgene #48139, depos-
ited by Dr. Feng Zhang), pSpCas9(BB)2A-Puro V2 (Addgene #62988, deposited by Dr. Feng
Zhang) as previously described (Ran et al., 2013). The genome-wide sgRNA library (Morgens et al.,
2017) was a kind gift from the Bassik lab (Stanford University). To generate the ubiquitome sgRNA
library, sgRNAs (sgRNA sequences in Supplementary file 1) were cloned into pKLV-U6gRNA(BbsI)-
PGKpuro2ABFP (Addgene # 50946) as reported previously (Doench et al., 2016). To generate
RNF145 expression plasmids, the RNF145 CDS, PCR amplified from an RNF145 IMAGE clone
(Source Bioscience, Nottingham, UK), was cloned into pHRSIN-PSFFV-GFP-PPGK-Hygromycin
R (BamHI,
Menzies et al. eLife 2018;7:e40009. DOI: https://doi.org/10.7554/eLife.40009 20 of 30
Research Communication Cell Biology
NotI) (Demaison et al., 2002), replacing GFP with the transgene. To create RNF145-V5, the RNF145
CDS was Gibson-cloned into pHRSIN-PSFFV-PPGK-Hygromycin
R containing a downstream in-frame
V5-tag. RNF145-V5 RING domain mutations (C552A, H554A) were introduced by PCR amplification
of RNF145-V5 fragments with primers encoding C552A and H554A mutations and RNF145(C552A,
H554A)-V5 was introduced into pHRSIN-PSFFV-PPGK-Hygromycin
R by Gibson assembly. FLAG-NLS-
Cas9 was cloned from the lentiCRISPR v2 (Sanjana et al., 2014) (Addgene #49535, deposited by
Feng Zhang) into pHRSIN.pSFFV MCS(+) pSV40 Blast (BamHI, NotI).
Compounds
The following compounds were used in this study: Dulbecco’s Modified Eagle’s Medium high glu-
cose (DMEM; Sigma-Aldrich, 6429–500 ml), foetal calf serum (FCS; Seralab (catalogue no: EU-000,
SLI batch: E8060012, Supplier batch: A5020012) and Life Technologies (catalogue no: 10270, lot:
42G4179K)), lipoprotein-deficient serum (LPDS; biosera, FB-1001L/100), mevastatin (Sigma-Aldrich,
M2537-5MG), mevalonolactone (Sigma-Aldrich, M4467-1G), cholesterol (Sigma-Aldrich, C3045-5G),
25-hydroxycholesterol (Sigma-Aldrich, H1015-10MG), methyl-b-cyclodextrin (MBCD; Sigma-Aldrich,
332615–1G), GW3965 HCl (Sigma-Aldrich, G6295), bortezomib/PS-341 (BostonBiochem, I-200), (S)-
MG132 (Cayman Chemicals, 10012628), NMS-873 (Selleckchem, s728501), digitonin (Merck,
300410–5 GM) (1% digitonin for immunoprecipitation experiments was generated by using the solu-
ble supernatant of a 2% digitonin solution which had been left rotating with a small amount of CL4B
beads overnight), cycloheximide (Sigma-Aldrich, C-7698), IgG SepharoseTM 6 Fast Flow (GE Health-
care, 17-0969-01), ProLong Gold Antifade Mountant with DAPI (Thermo Fisher), bovine serum albu-
min (BSA; Sigma-Aldrich, A4503-10G), Protein A-SepharoseR (Sigma-Aldrich, P3391-1.5G),
iodoacetamide (IAA; Sigma-Aldrich, I1149-5G), cOmplete protease inhibitor (EDTA-free; Roche,
27368400), phenylmethylsulfonyl fluoride (PMSF; Roche, 20039220), V5 peptide (Sigma-Aldrich,
V7754-4MG), N-ethylmaleimide (NEM; Sigma-Aldrich, E3876-5G), puromycin (Cayman Chemicals,
13884), hygromycin B (Invitrogen, 10687010), Penicillin-Streptomycin (10,000 U/mL; Thermo Fisher,
15140122).
Antibodies
Antibodies specific for the following targets were used for immunoblotting analysis: Insig-1 (rabbit;
Abcam, ab70784), Hrd1 (rabbit; Abgent, AP2184a), TRC8 (rabbit; Santa Cruz, sc-68373), tubulin
(mouse; Sigma, T9026), VCP (mouse; abcam, ab11433), b-actin (mouse; Sigma-Aldrich, A5316), cal-
nexin (mouse; AF8, kind gift from M Brenner, Harvard Medical School), calreticulin (rabbit; Pierce,
PA3-900), HMGCR (mouse; Santa Cruz, sc-271595), HMGCR (rabbit; Abcam, ab174830), gp78 (rab-
bit; ProteinTech, 16675–1-AP), Insig-1 (rabbit; Abcam, ab70784), RNF145 (rabbit; ProteinTech,
24524-I-AP), V5 (mouse; Abcam, ab27671), VU-1 ubiquitin (mouse; Life Sensors, VU101), UBE2G2
(mouse; Santa Cruz, sc-100613), GFP (rabbit; Thermo Fisher Scientific, A11122), KDEL (mouse; Enzo,
10C3), HRP-conjugated anti-mouse and anti-rabbit (goat; Jackson ImmunoResearch), TrueBlot Anti-
Rabbit-HRP (Rockland, 18-8816-31), TrueBlot Anti-Mouse-HRP ULTRA (Rockland, 18-8817-30). Alexa
Fluor 488 (goat anti-rabbit; Thermo Fisher), Alexa Fluor 568 (goat anti-mouse; Thermo Fisher) were
used as secondary antibodies for immunofluorescence microscopy. Anti-MHC-I (W6/32; mouse) and
Alexa Fluor 647 (rabbit anti-mouse; Thermo Fisher) were used for cytofluorometric analysis.
Cell culture
HeLa, HEK-293T, and HepG2 cells were maintained in DMEM +10% FCS+penicillin/streptomycin
(5% CO2, 37˚C). HeLa cells were obtained from ECACC. HEK-293T and HepG2 cells were obtained
from ATCC. HeLa and HepG2 cells were authenticated by STR profiling (Eurofins Genomics). All cell
lines tested mycoplasma negative (Lonza MycoAlert). Transfection of HeLa cells was performed using
the TransIT-HeLa MONSTER kit (Mirus) according to the manufacturer’s instructions. In sort, cells
were seeded at low confluency in 12-well tissue culture plates and the next day transfection mix (1
mg DNA, 3 ml TransIT-HeLa reagent +2 ml MONSTER reagent in OptiMEM (Gibco)) was added. Alter-
natively, reverse transfection was performed by seeding 3.5*105 cells per well of a 12-well plate to
the transfection mix on the day of transfection. For co-transfection of multiple sgRNA plasmids,
equal amounts of each plasmid were added up to 1 mg.
Menzies et al. eLife 2018;7:e40009. DOI: https://doi.org/10.7554/eLife.40009 21 of 30
Research Communication Cell Biology
CRISPR/Cas9-mediated gene knockout
CRISPR/Cas9-mediated genomic editing was performed according to Ran et al. (Ran et al., 2013).
For generation of knockout cell lines, cells were transfected with pSpCas9(BB)2A-Puro (PX459)
V1.0 or V2.0 (Addgene #48139, and #62988 respectively; deposited by Dr. Feng Zhang) containing a
sgRNA specific for the targeted gene of interest. Guide RNA sequences are listed in
Supplementary file 2. Cells were cultured for an additional 24 hr before selection with puromycin (2
mg/ml) at low confluency for 72 hr. The resulting mixed knockout populations were used to generate
single-cell clones by limiting dilution or fluorescence-assisted single-cell sorting. A detailed list of sin-
gle cell knockout clones used in this study can be found in Supplementary file 3. Gene disruption
was validated by immunoblotting, immunoprecipitation and/or targeted genomic sequencing.
CRISPR/Cas9-mediated gene knock-in
An HMGCR-Clover knock-in donor template was created by Gibson assembly of ~1 kb flanking
homology arms, PCR-amplified from HeLa genomic DNA, and the NsiI and PciI digested backbone
from pMAX-GFP (Amaxa) cloned into the loxP-Ub-Puro cassette from pDonor loxP Ub-Puro (a kind
gift from Ron Kopito, Stanford University). Each arm was amplified using nested PCR. The 5’ arm
was amplified using 5’-GATGCAGCACAGAATGTTGGTAG-3’ and 5’-CAATGCCCATGTTCCAG
TTCAG-3’, followed by 5’-CAATGCCCATGTTCCAGTTCAG-3’ and 5’-CAGCTGCACCATGCCATCTA
TAG-3’. The 3’ arm was amplified using the following primer pairs: 5’-CCAAGGAGCTTGCACCAA-
GAAG-3’ and 5’-CTAAGGTCCCAGTCTTGCTTG-3’. The product served as template for a subse-
quent PCR step using the primers 5’-CCAAGGAGCTTGCACCAAGAAG-3’ and 5’-GTCACCCTCATC
TAAGCAAC-3’. Overhangs required for Gibson assembly were introduced by PCR. HeLa cells were
co-transfected with Cas9, sgRNA targeting immediately downstream of the HMGCR stop codon and
donor template. Three different donor templates were simultaneously transfected, each differing in
the drug resistance marker (puromycin, hygromycin and blasticidin). The transfected cells were
treated with the three antibiotics five days post transfection until only drug-resistant cells remained.
The resulting population was transfected with Cre-recombinase in pHRSIN MCS(+) IRES mCherry
pGK Hygro. mCherry positive cells were single-cell cloned by FACS.
Genetic validation of HMGCR-Clover knock-in cells
To confirm the knock-in of a myc- and Clover-tag downstream of the HMGCR coding sequence,
genomic DNA was isolated from HeLa HMGCR-Clover cells using the Quick-gDNA MicroPrep kit
(Zymo Research). The genomic sequence encoding the myc- and Clover-tags and flanking 5’ and 3’
homology regions were amplified using the following primer combination: 5’- ACTATTCATCTACTG
TAGTTCCAAGTTAAAATTCTACACTC-3’, 5’- GCATGTAAAGCACTAAACTGTGTTCAGATCTGAG-
GAGTC-3’. PCR products were separated by agarose gel electrophoresis, gel excised and analysed
by Sanger sequencing.
Lentivirus production and transductions
HEK-293T cells were transfected with a lentiviral expression vector, the packaging vectors
pCMVDR8.91 and pMD.G at a ratio of 1:0.7:0.3 using TransIT-293 (Mirus) as recommended by the
manufacturer. For production of CRISPR library virus, HEK-293T cells were transfected as above in
15 cm tissue culture plates. 48 hr post transfection, virus-containing media was collected, filtered
(0.45 mm pore size) and directly added to target cells or frozen (80˚C) for long-term storage. Typi-
cally, cells were transduced in 6-well tissue culture plates at an M.O.I. <1 and selected with puromy-
cin (2 mg/ml) or hygromycin B (200 mg/ml). To generate HeLa HMGCR-Clover stably expressing
Cas9, HeLa HMGCR-Clover cells were transduced with pHRSIN-PSFFV-Cas9-PPGK-Hygromycin
R and
stable integrants selected with hygromycin B. Cas9 activity was confirmed by transduction with pKLV
encoding a b2-microglobulin (B2M)-targeting sgRNA followed by puromycin selection. MHC-I sur-
face expression was assessed by flow cytometry in puromycin-resistant cells five days post transduc-
tion. Typically,~90% reduction of cell surface MHC-I expression was observed.
Fluorescent PCR
To identify CRISPR-induced frame-shift mutations, genomic DNA was extracted from wild type HeLa
cells and RNF145 CRISPR clones using the Quick-gDNA MicroPrep kit (Zymo Research) followed by
Menzies et al. eLife 2018;7:e40009. DOI: https://doi.org/10.7554/eLife.40009 22 of 30
Research Communication Cell Biology
nested PCR of the genomic region 5’ and 3’ of the predicted sgRNA binding site. One in each
primer pair for the second PCR was 5’ modified with 6-FAMTM (fluorescein, Sigma-Aldrich). Primer
sequences were as follows: For sgRNA #8 PCR1_Forward: CAGAATGCTCACTAGAAGATTAG,
PCR1_Reverse: GTAGTATACGTTCTCACATAG, PCR2_Forward: GTGATGTAGACACTCACCTAC
and PCR2_Reverse: GTGACAACCTATTAGATTCGTG. PCR products were detected using an ABI
3730xl DNA Analyser.
Flow cytometry and Fluorescence-activated cell sorting (FACS)
Cells were collected by trypsinisation and analysed using a FACS Calibur (BD) or an LSR Fortessa
(BD). Flow cytometry data was analysed using the FlowJo software package. Cells resuspended in
sorting buffer (PBS + 10 mM HEPES +2% FCS) were filtered through a 50 mm filter, and sorted on an
Influx machine (BD), or, for the ubiquitome CRISPR/Cas9 screen, on a FACS Melody (BD). Sorted
cells were collected in DMEM +50% FCS and subsequently cultured in DMEM +10% FCS+penicillin/
streptomycin. For MHC-I flow cytometric analysis, cells resuspended in cold PBS were incubated
with W6/32 (20 min, 4˚C), washed twice and then incubated with Alexa-647-labelled anti-mouse anti-
body (15 min, 4˚C). Cells were washed twice and resuspended in PBS.
CRISPR/Cas9 knockout screens
For genome-wide and ubiquitome-library CRISPR/Cas9 knockout screens, 108 and 1.2*107 HeLa
HMGCR-Clover (Cas9) or DRNF145 #6 (Cas9), respectively, were transduced at M.O.I. ~ 0.3 by spin-
fection (750xg, 60 min, 37˚C). Transduction efficiency was determined via flow-cytometry-based
measurement of mCherry (genome-wide screen) or BFP (ubiquitome screen) expression 48–72 hr
post infection. Transduced cells were enriched by puromycin selection (2 mg/ml (genome-wide
screen), 1 mg/ml (ubiquitome-library screen)). On day 8 (genome-wide screen) or day 7 (ubiquitome-
library screen) post transduction, cells were rinsed extensively with PBS and cultured overnight in
starvation medium (DMEM +10% LPDS+10 mM mevastatin +penicillin/streptomycin) before sterol
addition (2 mg/ml 25-hydroxycholesterol and 20 mg/ml cholesterol for 5 hr). An initial FACS selection
(‘sort #1’) on cells expressing high levels (~0.3–0.6% of overall population) of HMGCR-Clover
(HMGCR-Cloverhigh) was performed. 2*105 (genome-wide screen) and ~105 (ubiquitome-library
screen) sorted cells were pelleted and DNA was extracted using the Quick-gDNA MicroPrep kit
(Zymo Research). To gauge sgRNA enrichment, DNA was extracted from 3*106 (genome-wide
library screen) or 6*106 (ubiquitome library screen) cells pre-sort using the Gentra Puregene Core kit
A (Qiagen). Cells in the genome-wide screen were subjected to a second round of sterol deprivation
and sort (see above) after expansion of initially 2.5*105 sorted cells for 8 days. Sorted cells were cul-
tured until 5*106 cells could be harvested for genomic DNA extraction using the Gentra Puregene
Core kit A (Qiagen). Individual integrated sgRNA sequences were amplified by two sequential
rounds of PCR, the latter introducing adaptors for Illumina sequencing (Supplementary file 4).
Sequencing was carried out using the Illumina HighSeq (genome-wide screen) and MiniSeq (ubiqui-
tome-library screen) platforms. Illumina HiSeq data was analysed as described previously
(Timms et al., 2016). Guide RNA counts were analysed with the RSA algorithm under default set-
tings (Ko¨nig et al., 2007). Of note, a gene’s calculated high significance value and therefore high
enrichment in the selected population does not necessarily reflect its importance relative to genes
with lower significance values/enrichment, since gene disruption can be incomplete or lethal pheno-
types might evade enrichment.
Quantitative PCR
Whole-cell RNA was isolated with the RNeasy Plus Mini Kit (Qiagen, Venlo, Netherlands) and reverse
transcribed using Oligo(dT)15 primer (Promega, C110A) and SuperScriptTM III reverse transcriptase
(Invitrogen). Transcript levels were determined in triplicate using SYBR Green PCR Master Mix
(Applied Biosystems) in a real time PCR thermocycler (7500 Real Time PCR System, Applied Biosys-
tems). Primers used for target amplification can be found in Supplementary file 5. RNA quantifica-
tion was performed using the DDCT method. GAPDH transcript levels were used for normalization.
Raw data can be found in Figure 5—source data 1 and Figure 5—figure supplement 2—source
data 1.
Menzies et al. eLife 2018;7:e40009. DOI: https://doi.org/10.7554/eLife.40009 23 of 30
Research Communication Cell Biology
Sterol depletion assays
Typically, HeLa cells at ~50% confluency were washed five times with PBS and cultured for 16–20 hr
in starvation medium (DMEM +10% LPDS+10 mM mevastatin +50 mM mevalonate +penicillin/strep-
tomycin) before addition of 25-hydroxycholesterol (2 mg/ml) and cholesterol (20 mg/ml) to analyse
sterol-accelerated protein degradation.
Chol:MBCD complex preparation
Complexation of cholesterol (2.5 mM) with MBCD (25 mM) was performed according to Christian
et al. (Christian et al., 1997). An emulsion of cholesterol powder (final: 2.5 mM) and an MBCD solu-
tion (25 mM) was produced by vortexing and tip sonication (1 min in 10 s intervals), and continuously
mixed for 16 hr at 37˚C. The solution was sterile filtered (0.45 mm PVDF pore size) and stored at
20˚C.
Preparation of sterols and mevalonate
Sterols were prepared by resuspension in ethanol or complexation with MBCD (see above). Mevalo-
nate was prepared by adding 385 ml 2.04 M KOH to 100 mg mevalonolactone (Sigma). The solution
was heated (1 hr, 37˚C) and adjusted to a 50 mM stock solution.
SDS-PAGE and immunoblotting
Cells were collected mechanically in cold PBS or by trypsinisation, centrifuged (1000xg, 4 min, 4˚C),
and cell pellets resuspended in lysis buffer (1% (w/v) digitonin, 1x cOmplete protease inhibitor, 0.5
mM PMSF, 10 mM IAA, 2 mM NEM, 10 mM TRIS, 150 mM NaCl, pH 7.4). After 40 min incubation
on ice, lysates were centrifuged (17.000xg, 15 min, 4˚C), the post-nuclear fraction isolated and pro-
tein concentration determined by Bradford assay. Samples were adjusted with lysis buffer and 6 x
Laemmli buffer +100 mM dithiothreitol (DTT) and heated at 50˚C (15 min). Samples were separated
by SDS-PAGE and transferred to PVDF membranes (Merck) for immunodetection. Membranes were
blocked in 5% milk +PBST (PBS + 0.2% (v/v) Tween-20) (1 hr) and incubated with primary antibody in
PBST +2% (w/v) BSA at 4˚C overnight. For detection from whole-cell lysate, membranes were incu-
bated in peroxidase (HRP)-conjugated secondary antibodies. For detection of immunoprecipitated
proteins, TrueBlot HRP-conjugated secondary antibodies (Rockland) were used. Immunoprecipitated
RNF145 was detected using Protein A-conjugated HRP.
Immunoprecipitation
Cells were seeded to 15 cm tissue culture plates (4*106 cells per plate). The following day, cells were
washed five times with PBS and cultured in starvation medium (DMEM +10% LPDS+10 mM mevasta-
tin +50 mM mevalonate +penicillin/streptomycin) for 20 hr. To prevent HMGCR membrane extrac-
tion and degradation, starved cells were treated with NMS-873 (50 mM) 0.5 hr prior to sterol
addition (2 mg/ml 25-hydroxycholesterol and 20 mg/ml cholesterol for 1 hr) and collection in cold
PBS. Cells were lysed in IP buffer 1 (1% (w/v) digitonin, 10 mM ZnCl2, 1x cOmplete protease inhibi-
tor, 0.5 mM PMSF, 10 mM IAA, 2 mM NEM, 10 mM TRIS, 150 mM NaCl, ph 7.4), post-nuclear frac-
tions isolated by centrifugation (17.000xg, 4˚C, 15 min) adjusted to 0.5% (w/v) digitonin and pre-
cleared with IgG SepharoseTM 6 Fast Flow (1 hr). Endogenous RNF145 and V5-tagged RNF145 were
immunoprecipitated at 4˚C overnight from 3 to 6 mg whole-cell lysate using Protein A-Sepharose
and anti-RNF145 or V5 antibody, respectively. Beads were collected by centrifugation (1500xg, 4
min, 4˚C), washed for 5 min with IP buffer 2 (0.5% (w/v) digitonin, 10 mM ZnCl2, 10 mM Tris, 150 mM
NaCl, pH 7.4) and 4  5 min with IP buffer 3 (0.1% (w/v) digitonin, 10 mM ZnCl2, 10 mM TRIS, 150
mM NaCl, pH 7.4). Proteins whose interaction with RNF145 was labile in the presence of 1% (v/v) Tri-
ton X-100 were recovered by eluting twice for 30 min with 20 ml TX100 elution buffer (1% (v/v) Triton
X-100 +2 x cOmplete protease inhibitor in 10 mM TRIS, 150 mM NaCl pH 7.4) at 37˚C under con-
stant agitation. Immunoprecipitated RNF145 was subsequently eluted in 30 ml 2x Laemmli buffer +3%
(w/v) DTT at 50˚C (15 min). RNF145-V5 and associated complexes were recovered by two sequential
elutions with V5 elution buffer (1 mg/ml V5 peptide +2 x cOmplete protease inhibitor in 10 mM
TRIS, 150 mM NaCl pH 7.4) for 30 min at 37˚C under continuous agitation. Eluted samples were
adjusted with Laemmli buffer and denatured at 50˚C (15 min).
Menzies et al. eLife 2018;7:e40009. DOI: https://doi.org/10.7554/eLife.40009 24 of 30
Research Communication Cell Biology
Ubiquitination assays
Cells were sterol-depleted (20 hr), treated with 20 mM MG132 and left for 30 min before addition of
sterols (2 mg/ml 25-hydroxycholesterol and 20 mg/ml cholesterol for 1 hr) or EtOH (vehicle control).
Immunoprecipitation of ubiquitinated HMGCR was performed as described above from 1 mg whole-
cell lysate and using rabbit a-HMGCR (Abcam, ab174830). Proteins were eluted in 30 ml 2x Laemmli
buffer +100 mM DTT at 50˚C (15 min). For immunoblotting of ubiquitin with mouse VU-1 a-ubiquitin
(Life Sensors, VU101), the PVDF membrane was incubated with 0.5% (v/v) glutaraldehyde/PBS pH
7.0 (20 min) and washed 3x with PBS prior to blocking in 5% (w/v) milk +PBS + 0.1% (v/v) Tween-20.
Indirect immunofluorescence confocal microscopy
Cells were grown on coverslips, fixed in 4% PFA (15 min), permeabilised in 0.2% (v/v) Triton X-100 (5
min) and blocked with 3% (w/v) BSA/PBS (30 min). Cells were stained with primary antibody diluted
in 3% (w/v) BSA/PBS (1 hr), washed with 0.1% (w/v) BSA/PBS, followed by staining with secondary
antibody in 3% BSA/PBS (1 hr), an additional washing step (0.1% (w/v) BSA/PBS) and embedded
using ProLong Gold Antifade Mountant with DAPI (Thermo Fisher). Images were acquired using an
LSM880 confocal microscope (Zeiss) at 64x magnification.
Statistical analysis
Statistical significance was calculated using the unpaired Student’s t-test.
Data deposition
Sequencing data from CRISPR/Cas9 knockout screens presented in this study have been deposited
at the Sequence Read Archive (SRA) (genome-wide screen: SRP151225; ubiquitome screen:
SRP151107).
Acknowledgements
We are grateful to the following for their help in this study: Michael Bassik (Stanford University)
kindly shared the genome-wide CRISPR/Cas9 sgRNA library. Ron Kopito (Stanford University) kindly
donated the pDonor loxP Ub-Puro plasmid. FACS experiments were enabled by R Schulte and his
FACS core facility team in CIMR. Stuart Bloor (CIMR), Gordon Dougan, Richard Rance and Nathalie
Smerdon (Sanger Institute) assisted with Illumina sequencing. This work was supported by the Well-
come Trust, through a Principal Research Fellowship to PJL (210688/Z/18/Z), a Wellcome Trust
Senior Clinical Research Fellowship to JAN (102770/Z/13/Z) and a Welcome Trust PhD studentship
to SM. The CIMR is in receipt of a Wellcome Trust strategic award (100140).
Additional information
Funding
Funder Grant reference number Author
Wellcome Trust 210688/Z/18/Z Paul J Lehner
Wellcome Trust 102770/Z/13/Z James A Nathan
Wellcome Trust PhD studentship Sam A Menzies
The funders had no role in study design, data collection and interpretation, or the
decision to submit the work for publication.
Author contributions
Sam A Menzies, Norbert Volkmar, Conceptualization, Data curation, Software, Formal analysis, Vali-
dation, Investigation, Visualization, Methodology, Writing—original draft, Project administration,
Writing—review and editing; Dick JH van den Boomen, Conceptualization, Data curation, Formal
analysis, Investigation, Methodology; Richard T Timms, Conceptualization, Writing—review and edit-
ing; Anna S Dickson, James A Nathan, Resources, Methodology, Writing—review and editing; Paul J
Menzies et al. eLife 2018;7:e40009. DOI: https://doi.org/10.7554/eLife.40009 25 of 30
Research Communication Cell Biology
Lehner, Conceptualization, Supervision, Funding acquisition, Writing—original draft, Project adminis-
tration, Writing—review and editing
Author ORCIDs
Norbert Volkmar http://orcid.org/0000-0003-0766-5606
James A Nathan http://orcid.org/0000-0002-0248-1632
Paul J Lehner http://orcid.org/0000-0001-9383-1054
Decision letter and Author response
Decision letter https://doi.org/10.7554/eLife.40009.037
Author response https://doi.org/10.7554/eLife.40009.038
Additional files
Supplementary files
. Supplementary file 1. sgRNA sequences and genes targeted by the CRISPR/Cas9 ubiquitome
library.
DOI: https://doi.org/10.7554/eLife.40009.026
. Supplementary file 2. sgRNA sequences for generation of knockout cell lines.
DOI: https://doi.org/10.7554/eLife.40009.027
. Supplementary file 3. Genetically modified cell lines used in this study.
DOI: https://doi.org/10.7554/eLife.40009.028
. Supplementary file 4. Primers used in CRISPR/Cas9 screens.
DOI: https://doi.org/10.7554/eLife.40009.029
. Supplementary file 5. Primer sequences used for qPCR.
DOI: https://doi.org/10.7554/eLife.40009.030
. Transparent reporting form
DOI: https://doi.org/10.7554/eLife.40009.031
Data availability
Sequencing data from CRISPR/Cas9 knockout screens presented in this study have been deposited
at the Sequence Read Archive (SRA) (genome-wide screen: SRP151225; ubiquitome screen:
SRP151107).
The following datasets were generated:
Author(s) Year Dataset title Dataset URL
Database and
Identifier
Sam A. Menzies,
Norbert Volkmar,
Dick J. van den
Boomen, Richard T.
Timms Anna S.
Dickson, James A.
Nathan and Paul J.
Lehner
2018 Genome-wide CRISPR screen in
HeLa HMGCR-Clover cells
https://www.ncbi.nlm.
nih.gov/sra/SRP151225
Sequence Read
Archive, SRP151225
Sam A. Menzies,
Norbert Volkmar,
Dick J. van den
Boomen, Richard T.
Timms Anna S.
Dickson, James A.
Nathan and Paul J.
Lehner
2018 Ubiquitome library screen in HeLa
HMGCR-Clover RNF145 KO cells
https://www.ncbi.nlm.
nih.gov/sra/SRP151107
Sequence Read
Archive, SRP151107
Menzies et al. eLife 2018;7:e40009. DOI: https://doi.org/10.7554/eLife.40009 26 of 30
Research Communication Cell Biology
References
Bays NW, Gardner RG, Seelig LP, Joazeiro CA, Hampton RY. 2001. Hrd1p/Der3p is a membrane-anchored
ubiquitin ligase required for ER-associated degradation. Nature Cell Biology 3:24–29. DOI: https://doi.org/10.
1038/35050524, PMID: 11146622
Brown MS, Dana SE, Goldstein JL. 1973. Regulation of 3-hydroxy-3-methylglutaryl coenzyme A reductase activity
in human fibroblasts by lipoproteins. PNAS 70:2162–2166. DOI: https://doi.org/10.1073/pnas.70.7.2162,
PMID: 4352976
Burr ML, Cano F, Svobodova S, Boyle LH, Boname JM, Lehner PJ. 2011. HRD1 and UBE2J1 target misfolded
MHC class I heavy chains for endoplasmic reticulum-associated degradation. PNAS 108:2034–2039.
DOI: https://doi.org/10.1073/pnas.1016229108, PMID: 21245296
Cano F, Bye H, Duncan LM, Buchet-Poyau K, Billaud M, Wills MR, Lehner PJ. 2012. The RNA-binding E3 ubiquitin
ligase MEX-3C links ubiquitination with MHC-I mRNA degradation. The EMBO Journal 31:3596–3606.
DOI: https://doi.org/10.1038/emboj.2012.218, PMID: 22863774
Carette JE, Guimaraes CP, Varadarajan M, Park AS, Wuethrich I, Godarova A, Kotecki M, Cochran BH, Spooner
E, Ploegh HL, Brummelkamp TR. 2009. Haploid genetic screens in human cells identify host factors used by
pathogens. Science 326:1231–1235. DOI: https://doi.org/10.1126/science.1178955, PMID: 19965467
Chen B, Mariano J, Tsai YC, Chan AH, Cohen M, Weissman AM. 2006. The activity of a human endoplasmic
reticulum-associated degradation E3, gp78, requires its Cue domain, RING finger, and an E2-binding site.
PNAS 103:341–346. DOI: https://doi.org/10.1073/pnas.0506618103, PMID: 16407162
Chiang JY. 2013. Bile acid metabolism and signaling. Comprehensive Physiology 3:1191–1212. DOI: https://doi.
org/10.1002/cphy.c120023, PMID: 23897684
Christian AE, Haynes MP, Phillips MC, Rothblat GH. 1997. Use of cyclodextrins for manipulating cellular
cholesterol content. Journal of Lipid Research 38:2264–2272. PMID: 9392424
Christianson JC, Shaler TA, Tyler RE, Kopito RR. 2008. OS-9 and GRP94 deliver mutant alpha1-antitrypsin to the
Hrd1-SEL1L ubiquitin ligase complex for ERAD. Nature Cell Biology 10:272–282. DOI: https://doi.org/10.1038/
ncb1689, PMID: 18264092
Christianson JC, Olzmann JA, Shaler TA, Sowa ME, Bennett EJ, Richter CM, Tyler RE, Greenblatt EJ, Harper JW,
Kopito RR. 2011. Defining human ERAD networks through an integrative mapping strategy. Nature Cell
Biology 14:93–105. DOI: https://doi.org/10.1038/ncb2383, PMID: 22119785
Christianson JC, Ye Y. 2014. Cleaning up in the endoplasmic reticulum: ubiquitin in charge. Nature Structural &
Molecular Biology 21:325–335. DOI: https://doi.org/10.1038/nsmb.2793, PMID: 24699081
Cook EC, Nelson JK, Sorrentino V, Koenis D, Moeton M, Scheij S, Ottenhoff R, Bleijlevens B, Loregger A, Zelcer
N. 2017. Identification of the ER-resident E3 ubiquitin ligase RNF145 as a novel LXR-regulated gene. PLOS
ONE 12:e0172721. DOI: https://doi.org/10.1371/journal.pone.0172721, PMID: 28231341
Costet P. 2000. Sterol-dependent transactivation of the human ABC1 promoter by LXR/RXR. Journal of
Biological Chemistry 275:28240–28245. DOI: https://doi.org/10.1074/jbc.M003337200
Demaison C, Parsley K, Brouns G, Scherr M, Battmer K, Kinnon C, Grez M, Thrasher AJ. 2002. High-level
transduction and gene expression in hematopoietic repopulating cells using a human immunodeficiency
[correction of imunodeficiency] virus type 1-based lentiviral vector containing an internal spleen focus forming
virus promoter. Human Gene Therapy 13:803–813. DOI: https://doi.org/10.1089/10430340252898984,
PMID: 11975847
Doench JG, Fusi N, Sullender M, Hegde M, Vaimberg EW, Donovan KF, Smith I, Tothova Z, Wilen C, Orchard R,
Virgin HW, Listgarten J, Root DE. 2016. Optimized sgRNA design to maximize activity and minimize off-target
effects of CRISPR-Cas9. Nature Biotechnology 34:184–191. DOI: https://doi.org/10.1038/nbt.3437, PMID: 267
80180
Dong XY, Tang SQ, Chen JD. 2012. Dual functions of Insig proteins in cholesterol homeostasis. Lipids in Health
and Disease 11:173. DOI: https://doi.org/10.1186/1476-511X-11-173, PMID: 23249523
Dong XY, Tang SQ. 2010. Insulin-induced gene: a new regulator in lipid metabolism. Peptides 31:2145–2150.
DOI: https://doi.org/10.1016/j.peptides.2010.07.020, PMID: 20817058
Edwards PA, Kennedy MA, Mak PA. 2002. LXRs; oxysterol-activated nuclear receptors that regulate genes
controlling lipid homeostasis. Vascular Pharmacology 38:249–256. DOI: https://doi.org/10.1016/S1537-1891
(02)00175-1, PMID: 12449021
Fang S, Ferrone M, Yang C, Jensen JP, Tiwari S, Weissman AM. 2001. The tumor autocrine motility factor
receptor, gp78, is a ubiquitin protein ligase implicated in degradation from the endoplasmic reticulum. PNAS
98:14422–14427. DOI: https://doi.org/10.1073/pnas.251401598, PMID: 11724934
Goldstein JL, Brown MS. 1990. Regulation of the mevalonate pathway. Nature 343:425–430. DOI: https://doi.
org/10.1038/343425a0, PMID: 1967820
Goldstein JL, DeBose-Boyd RA, Brown MS. 2006. Protein sensors for membrane sterols. Cell 124:35–46.
DOI: https://doi.org/10.1016/j.cell.2005.12.022, PMID: 16413480
Haines TH. 2001. Do sterols reduce proton and sodium leaks through lipid bilayers? Progress in Lipid Research
40:299–324. DOI: https://doi.org/10.1016/S0163-7827(01)00009-1, PMID: 11412894
Hampton RY, Gardner RG, Rine J. 1996. Role of 26S proteasome and HRD genes in the degradation of 3-
hydroxy-3-methylglutaryl-CoA reductase, an integral endoplasmic reticulum membrane protein. Molecular
Biology of the Cell 7:2029–2044. DOI: https://doi.org/10.1091/mbc.7.12.2029, PMID: 8970163
Menzies et al. eLife 2018;7:e40009. DOI: https://doi.org/10.7554/eLife.40009 27 of 30
Research Communication Cell Biology
Hannich JT, Umebayashi K, Riezman H. 2011. Distribution and functions of sterols and sphingolipids. Cold Spring
Harbor Perspectives in Biology 3:a004762. DOI: https://doi.org/10.1101/cshperspect.a004762, PMID: 2145424
8
Heart Protection Study Collaborative Group. 2002. MRC/BHF Heart Protection Study of cholesterol lowering
with simvastatin in 20,536 high-risk individuals: a randomised placebo-controlled trial. The Lancet 360:7–22.
DOI: https://doi.org/10.1016/S0140-6736(02)09327-3, PMID: 12114036
Horton JD, Goldstein JL, Brown MS. 2002. SREBPs: activators of the complete program of cholesterol and fatty
acid synthesis in the liver. Journal of Clinical Investigation 109:1125–1131. DOI: https://doi.org/10.1172/
JCI0215593, PMID: 11994399
Hsu JL, van den Boomen DJ, Tomasec P, Weekes MP, Antrobus R, Stanton RJ, Ruckova E, Sugrue D, Wilkie GS,
Davison AJ, Wilkinson GW, Lehner PJ. 2015. Plasma membrane profiling defines an expanded class of cell
surface proteins selectively targeted for degradation by HCMV US2 in cooperation with UL141. PLOS
Pathogens 11:e1004811. DOI: https://doi.org/10.1371/journal.ppat.1004811, PMID: 25875600
Jiang LY, Jiang W, Tian N, Xiong YN, Liu J, Wei J, Wu KY, Luo J, Shi XJ, Song BL. 2018. Ring finger protein 145
(RNF145) is a ubiquitin ligase for sterol-induced degradation of HMG-CoA reductase. Journal of Biological
Chemistry 293:4047–4055. DOI: https://doi.org/10.1074/jbc.RA117.001260, PMID: 29374057
Jo Y, Lee PC, Sguigna PV, DeBose-Boyd RA. 2011. Sterol-induced degradation of HMG CoA reductase depends
on interplay of two Insigs and two ubiquitin ligases, gp78 and Trc8. PNAS 108:20503–20508. DOI: https://doi.
org/10.1073/pnas.1112831108, PMID: 22143767
Jo Y, Hartman IZ, DeBose-Boyd RA. 2013. Ancient ubiquitous protein-1 mediates sterol-induced ubiquitination of
3-hydroxy-3-methylglutaryl CoA reductase in lipid droplet-associated endoplasmic reticulum membranes.
Molecular Biology of the Cell 24:169–183. DOI: https://doi.org/10.1091/mbc.e12-07-0564, PMID: 23223569
Johnson BM, DeBose-Boyd RA. 2018. Underlying mechanisms for sterol-induced ubiquitination and ER-
associated degradation of HMG CoA reductase. Seminars in Cell & Developmental Biology 81:121–128.
DOI: https://doi.org/10.1016/j.semcdb.2017.10.019, PMID: 29107682
Kaneko M, Iwase I, Yamasaki Y, Takai T, Wu Y, Kanemoto S, Matsuhisa K, Asada R, Okuma Y, Watanabe T,
Imaizumi K, Nomura Y. 2016. Genome-wide identification and gene expression profiling of ubiquitin ligases for
endoplasmic reticulum protein degradation. Scientific Reports 6:30955. DOI: https://doi.org/10.1038/
srep30955, PMID: 27485036
Kikkert M, Doolman R, Dai M, Avner R, Hassink G, van Voorden S, Thanedar S, Roitelman J, Chau V, Wiertz E.
2004. Human HRD1 is an E3 ubiquitin ligase involved in degradation of proteins from the endoplasmic
reticulum. Journal of Biological Chemistry 279:3525–3534. DOI: https://doi.org/10.1074/jbc.M307453200,
PMID: 14593114
Klemm EJ, Spooner E, Ploegh HL. 2011. Dual role of ancient ubiquitous protein 1 (AUP1) in lipid droplet
accumulation and endoplasmic reticulum (ER) protein quality control. Journal of Biological Chemistry 286:
37602–37614. DOI: https://doi.org/10.1074/jbc.M111.284794, PMID: 21857022
Ko¨nig R, Chiang CY, Tu BP, Yan SF, DeJesus PD, Romero A, Bergauer T, Orth A, Krueger U, Zhou Y, Chanda SK.
2007. A probability-based approach for the analysis of large-scale RNAi screens. Nature Methods 4:847–849.
DOI: https://doi.org/10.1038/nmeth1089, PMID: 17828270
Lam AJ, St-Pierre F, Gong Y, Marshall JD, Cranfill PJ, Baird MA, McKeown MR, Wiedenmann J, Davidson MW,
Schnitzer MJ, Tsien RY, Lin MZ. 2012. Improving FRET dynamic range with bright green and red fluorescent
proteins. Nature Methods 9:1005–1012. DOI: https://doi.org/10.1038/nmeth.2171, PMID: 22961245
Lee JN, Song B, DeBose-Boyd RA, Ye J. 2006. Sterol-regulated degradation of Insig-1 mediated by the
membrane-bound ubiquitin ligase gp78. Journal of Biological Chemistry 281:39308–39315. DOI: https://doi.
org/10.1074/jbc.M608999200, PMID: 17043353
Lee PC, Nguyen AD, Debose-Boyd RA. 2007. Mutations within the membrane domain of HMG-CoA reductase
confer resistance to sterol-accelerated degradation. Journal of Lipid Research 48:318–327. DOI: https://doi.
org/10.1194/jlr.M600476-JLR200, PMID: 17090658
Liu TF, Tang JJ, Li PS, Shen Y, Li JG, Miao HH, Li BL, Song BL. 2012. Ablation of gp78 in liver improves
hyperlipidemia and insulin resistance by inhibiting SREBP to decrease lipid biosynthesis. Cell Metabolism 16:
213–225. DOI: https://doi.org/10.1016/j.cmet.2012.06.014, PMID: 22863805
Miao H, Jiang W, Ge L, Li B, Song B. 2010. Tetra-glutamic acid residues adjacent to Lys248 in HMG-CoA
reductase are critical for the ubiquitination mediated by gp78 and UBE2G2. Acta Biochimica et Biophysica
Sinica 42:303–310. DOI: https://doi.org/10.1093/abbs/gmq022, PMID: 20458442
Moon YA, Horton JD. 2003. Identification of two mammalian reductases involved in the two-carbon fatty acyl
elongation cascade. Journal of Biological Chemistry 278:7335–7343. DOI: https://doi.org/10.1074/jbc.
M211684200, PMID: 12482854
Morgens DW, Wainberg M, Boyle EA, Ursu O, Araya CL, Tsui CK, Haney MS, Hess GT, Han K, Jeng EE, Li A,
Snyder MP, Greenleaf WJ, Kundaje A, Bassik MC. 2017. Genome-scale measurement of off-target activity using
Cas9 toxicity in high-throughput screens. Nature Communications 8:15178. DOI: https://doi.org/10.1038/
ncomms15178, PMID: 28474669
Morito D, Hirao K, Oda Y, Hosokawa N, Tokunaga F, Cyr DM, Tanaka K, Iwai K, Nagata K. 2008. Gp78
cooperates with RMA1 in endoplasmic reticulum-associated degradation of CFTRDeltaF508. Molecular Biology
of the Cell 19:1328–1336. DOI: https://doi.org/10.1091/mbc.e07-06-0601, PMID: 18216283
Nadav E, Shmueli A, Barr H, Gonen H, Ciechanover A, Reiss Y. 2003. A novel mammalian endoplasmic reticulum
ubiquitin ligase homologous to the yeast Hrd1. Biochemical and Biophysical Research Communications 303:91–
97. DOI: https://doi.org/10.1016/S0006-291X(03)00279-1, PMID: 12646171
Menzies et al. eLife 2018;7:e40009. DOI: https://doi.org/10.7554/eLife.40009 28 of 30
Research Communication Cell Biology
Naslavsky N, Rahajeng J, Rapaport D, Horowitz M, Caplan S. 2007. EHD1 regulates cholesterol homeostasis and
lipid droplet storage. Biochemical and Biophysical Research Communications 357:792–799. DOI: https://doi.
org/10.1016/j.bbrc.2007.04.022, PMID: 17451652
Naslavsky N, Caplan S. 2011. EHD proteins: key conductors of endocytic transport. Trends in Cell Biology 21:
122–131. DOI: https://doi.org/10.1016/j.tcb.2010.10.003, PMID: 21067929
Osborne TF. 1991. Single nucleotide resolution of sterol regulatory region in promoter for 3-hydroxy-3-
methylglutaryl coenzyme A reductase. The Journal of Biological Chemistry 266:13947–13951. PMID: 1856223
Payne AH, Hales DB. 2004. Overview of steroidogenic enzymes in the pathway from cholesterol to active steroid
hormones. Endocrine Reviews 25:947–970. DOI: https://doi.org/10.1210/er.2003-0030, PMID: 15583024
Ran FA, Hsu PD, Wright J, Agarwala V, Scott DA, Zhang F. 2013. Genome engineering using the CRISPR-Cas9
system. Nature Protocols 8:2281–2308. DOI: https://doi.org/10.1038/nprot.2013.143, PMID: 24157548
Ravid T, Doolman R, Avner R, Harats D, Roitelman J. 2000. The ubiquitin-proteasome pathway mediates the
regulated degradation of mammalian 3-hydroxy-3-methylglutaryl-coenzyme A reductase. Journal of Biological
Chemistry 275:35840–35847. DOI: https://doi.org/10.1074/jbc.M004793200, PMID: 10964918
Sanjana NE, Shalem O, Zhang F. 2014. Improved vectors and genome-wide libraries for CRISPR screening.
Nature Methods 11:783–784. DOI: https://doi.org/10.1038/nmeth.3047, PMID: 25075903
Sato BK, Schulz D, Do PH, Hampton RY. 2009. Misfolded membrane proteins are specifically recognized by the
transmembrane domain of the Hrd1p ubiquitin ligase. Molecular Cell 34:212–222. DOI: https://doi.org/10.
1016/j.molcel.2009.03.010, PMID: 19394298
Schwientek T, Bennett EP, Flores C, Thacker J, Hollmann M, Reis CA, Behrens J, Mandel U, Keck B, Scha¨fer MA,
Haselmann K, Zubarev R, Roepstorff P, Burchell JM, Taylor-Papadimitriou J, Hollingsworth MA, Clausen H.
2002. Functional Conservation of Subfamilies of Putative UDP- N -acetylgalactosamine:Polypeptide N -
Acetylgalactosaminyltransferases in Drosophila, Caenorhabditis elegans, and Mammals. Journal of Biological
Chemistry 277:22623–22638. DOI: https://doi.org/10.1074/jbc.M202684200
Sever N, Song BL, Yabe D, Goldstein JL, Brown MS, DeBose-Boyd RA. 2003a. Insig-dependent ubiquitination
and degradation of mammalian 3-hydroxy-3-methylglutaryl-CoA reductase stimulated by sterols and
geranylgeraniol. Journal of Biological Chemistry 278:52479–52490. DOI: https://doi.org/10.1074/jbc.
M310053200, PMID: 14563840
Sever N, Yang T, Brown MS, Goldstein JL, DeBose-Boyd RA. 2003b. Accelerated degradation of HMG CoA
reductase mediated by binding of insig-1 to its sterol-sensing domain. Molecular Cell 11:25–33. DOI: https://
doi.org/10.1016/S1097-2765(02)00822-5, PMID: 12535518
Song BL, Sever N, DeBose-Boyd RA. 2005. Gp78, a membrane-anchored ubiquitin ligase, associates with Insig-1
and couples sterol-regulated ubiquitination to degradation of HMG CoA reductase. Molecular Cell 19:829–
840. DOI: https://doi.org/10.1016/j.molcel.2005.08.009, PMID: 16168377
Spandl J, Lohmann D, Kuerschner L, Moessinger C, Thiele C. 2011. Ancient ubiquitous protein 1 (AUP1) localizes
to lipid droplets and binds the E2 ubiquitin conjugase G2 (Ube2g2) via its G2 binding region. Journal of
Biological Chemistry 286:5599–5606. DOI: https://doi.org/10.1074/jbc.M110.190785, PMID: 21127063
Stagg HR, Thomas M, van den Boomen D, Wiertz EJ, Drabkin HA, Gemmill RM, Lehner PJ. 2009. The TRC8 E3
ligase ubiquitinates MHC class I molecules before dislocation from the ER. The Journal of Cell Biology 186:
685–692. DOI: https://doi.org/10.1083/jcb.200906110, PMID: 19720873
Stefanovic-Barrett S, Dickson AS, Burr SP, Williamson JC, Lobb IT, van den Boomen DJ, Lehner PJ, Nathan JA.
2018. MARCH6 and TRC8 facilitate the quality control of cytosolic and tail-anchored proteins. EMBO Reports
19:e45603. DOI: https://doi.org/10.15252/embr.201745603, PMID: 29519897
Timms RT, Menzies SA, Tchasovnikarova IA, Christensen LC, Williamson JC, Antrobus R, Dougan G, Ellgaard L,
Lehner PJ. 2016. Genetic dissection of mammalian ERAD through comparative haploid and CRISPR forward
genetic screens. Nature Communications 7:11786. DOI: https://doi.org/10.1038/ncomms11786, PMID: 272
83361
Tsai YC, Leichner GS, Pearce MM, Wilson GL, Wojcikiewicz RJ, Roitelman J, Weissman AM. 2012. Differential
regulation of HMG-CoA reductase and Insig-1 by enzymes of the ubiquitin-proteasome system. Molecular
Biology of the Cell 23:4484–4494. DOI: https://doi.org/10.1091/mbc.e12-08-0631, PMID: 23087214
Tyler RE, Pearce MM, Shaler TA, Olzmann JA, Greenblatt EJ, Kopito RR. 2012. Unassembled CD147 is an
endogenous endoplasmic reticulum-associated degradation substrate. Molecular Biology of the Cell 23:4668–
4678. DOI: https://doi.org/10.1091/mbc.e12-06-0428, PMID: 23097496
van de Weijer ML, Bassik MC, Luteijn RD, Voorburg CM, Lohuis MA, Kremmer E, Hoeben RC, LeProust EM,
Chen S, Hoelen H, Ressing ME, Patena W, Weissman JS, McManus MT, Wiertz EJ, Lebbink RJ. 2014. A high-
coverage shRNA screen identifies TMEM129 as an E3 ligase involved in ER-associated protein degradation.
Nature Communications 5:3832. DOI: https://doi.org/10.1038/ncomms4832, PMID: 24807418
van de Weijer ML, Schuren ABC, van den Boomen DJH, Mulder A, Claas FHJ, Lehner PJ, Lebbink RJ, Wiertz E.
2017. Multiple E2 ubiquitin-conjugating enzymes regulate human cytomegalovirus US2-mediated
immunoreceptor downregulation. Journal of Cell Science 130:2883–2892. DOI: https://doi.org/10.1242/jcs.
206839, PMID: 28743740
van den Boomen DJ, Lehner PJ. 2015. Identifying the ERAD ubiquitin E3 ligases for viral and cellular targeting of
MHC class I. Molecular Immunology 68:106–111. DOI: https://doi.org/10.1016/j.molimm.2015.07.005,
PMID: 26210183
Wakashima T, Abe K, Kihara A. 2014. Dual functions of the trans-2-enoyl-CoA reductase TER in the sphingosine
1-phosphate metabolic pathway and in fatty acid elongation. Journal of Biological Chemistry 289:24736–
24748. DOI: https://doi.org/10.1074/jbc.M114.571869, PMID: 25049234
Menzies et al. eLife 2018;7:e40009. DOI: https://doi.org/10.7554/eLife.40009 29 of 30
Research Communication Cell Biology
Wang T, Wei JJ, Sabatini DM, Lander ES. 2014. Genetic screens in human cells using the CRISPR-Cas9 system.
Science 343:80–84. DOI: https://doi.org/10.1126/science.1246981, PMID: 24336569
Wangeline MA, Vashistha N, Hampton RY. 2017. Proteostatic tactics in the strategy of sterol regulation. Annual
Review of Cell and Developmental Biology 33:467–489. DOI: https://doi.org/10.1146/annurev-cellbio-111315-
125036, PMID: 28992438
Wangeline MA, Hampton RY. 2018. "Mallostery"-ligand-dependent protein misfolding enables physiological
regulation by ERAD. Journal of Biological Chemistry 293:14937–14950. DOI: https://doi.org/10.1074/jbc.
RA118.001808, PMID: 30018140
Yabe D, Brown MS, Goldstein JL. 2002. Insig-2, a second endoplasmic reticulum protein that binds SCAP and
blocks export of sterol regulatory element-binding proteins. PNAS 99:12753–12758. DOI: https://doi.org/10.
1073/pnas.162488899, PMID: 12242332
Yang T, Espenshade PJ, Wright ME, Yabe D, Gong Y, Aebersold R, Goldstein JL, Brown MS. 2002. Crucial step
in cholesterol homeostasis: sterols promote binding of SCAP to INSIG-1, a membrane protein that facilitates
retention of SREBPs in ER. Cell 110:489–500. DOI: https://doi.org/10.1016/S0092-8674(02)00872-3,
PMID: 12202038
Zelcer N, Hong C, Boyadjian R, Tontonoz P. 2009. LXR regulates cholesterol uptake through Idol-dependent
ubiquitination of the LDL receptor. Science 325:100–104. DOI: https://doi.org/10.1126/science.1168974,
PMID: 19520913
Zhang L, Rajbhandari P, Priest C, Sandhu J, Wu X, Temel R, Castrillo A, de Aguiar Vallim TQ, Sallam T, Tontonoz
P. 2017. Inhibition of cholesterol biosynthesis through RNF145-dependent ubiquitination of SCAP. eLife 6:
e28766. DOI: https://doi.org/10.7554/eLife.28766, PMID: 29068315
Menzies et al. eLife 2018;7:e40009. DOI: https://doi.org/10.7554/eLife.40009 30 of 30
Research Communication Cell Biology