*For correspondence: jan33@ cam.ac.uk †These authors contributed equally to this work Competing interests: The authors declare that no competing interests exist. Funding: See page 25 Received: 28 October 2016 Accepted: 09 March 2017 Published: 15 March 2017 Reviewing editor: Agnieszka Chacinska, International Institute of Molecular and Cell Biology, Poland Copyright Miles et al. This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited. The vacuolar-ATPase complex and assembly factors, TMEM199 and CCDC115, control HIF1a prolyl hydroxylation by regulating cellular iron levels Anna L Miles†, Stephen P Burr†, Guinevere L Grice, James A Nathan* Department of Medicine, Cambridge Institute for Medical Research, University of Cambridge, Cambridge, United Kingdom Abstract Hypoxia Inducible transcription Factors (HIFs) are principally regulated by the 2- oxoglutarate and Iron(II) prolyl hydroxylase (PHD) enzymes, which hydroxylate the HIFa subunit, facilitating its proteasome-mediated degradation. Observations that HIFa hydroxylation can be impaired even when oxygen is sufficient emphasise the importance of understanding the complex nature of PHD regulation. Here, we use an unbiased genome-wide genetic screen in near-haploid human cells to uncover cellular processes that regulate HIF1a. We identify that genetic disruption of the Vacuolar H+ ATPase (V-ATPase), the key proton pump for endo-lysosomal acidification, and two previously uncharacterised V-ATPase assembly factors, TMEM199 and CCDC115, stabilise HIF1a in aerobic conditions. Rather than preventing the lysosomal degradation of HIF1a, disrupting the V-ATPase results in intracellular iron depletion, thereby impairing PHD activity and leading to HIF activation. Iron supplementation directly restores PHD catalytic activity following V-ATPase inhibition, revealing important links between the V-ATPase, iron metabolism and HIFs. DOI: 10.7554/eLife.22693.001 Introduction HIFs are major transcriptional regulators of cellular responses to oxygen availability, promoting sev- eral metabolic adaptations to ensure cell survival. In aerobic conditions, the HIFa subunit is constitu- tively expressed but rapidly degraded by the proteasome, in a process requiring two post- translational modifications: (i) prolyl hydroxylation of the HIFa oxygen dependent degradation (ODD) domain by prolyl hydroxylases (PHDs) (Bruick and McKnight, 2001; Epstein et al., 2001), and (ii) subsequent ubiquitination by the von-hippel lindau (VHL) E3 ligase (Maxwell et al., 1999). Prolyl hydroxylation of HIFa acts as the recruitment signal for VHL, which rapidly ubiquitinates the ODD domain facilitating proteasomal degradation. Indeed, HIF1a (the ubiquitously expressed HIFa isoform) is a very short-lived protein (Berra et al., 2001), and the efficiency of VHL in promoting pro- teasomal degradation has led to the recent development of small molecules that hijack the VHL complex to selectively destroy target proteins as a potential therapeutic tool (Bondeson et al., 2015). Despite this clear role for proteasomal degradation of HIF, it has been reported that lyso- somal inhibitors can lead to stabilisation of the HIFa subunit in both normal oxygen levels and in hypoxia. Moreover, this stabilisation can lead to a functional HIF response (Lim et al., 2006), and upregulation of target genes to promote glucose metabolism and angiogenesis (Hubbi et al., 2013). Miles et al. eLife 2017;6:e22693. DOI: 10.7554/eLife.22693 1 of 28 RESEARCH ARTICLE Initial observations regarding lysosomal degradation and HIFs arose from studies using Bafilomy- cin A (BafA) to chemically inhibit the vacuolar H+ ATPase (V-ATPase), the main complex responsible for acidification of endosomal and lysosomal compartments. BafA treatment stabilised HIF1a and prevented its degradation (Lim et al., 2006). Others report similar findings, with several proposed mechanisms to explain the stabilisation of HIF1 upon BafA treatment, including chaperone-mediated autophagy (CMA) (Bremm et al., 2014; Ferreira et al., 2015; Hubbi et al., 2014, 2013; Selfridge et al., 2016), mitochondrial uncoupling (Zhdanov et al., 2012) and binding of the V-ATPase to VHL (Lim et al., 2007). However, the relative importance of these mechanisms com- pared to the canonical degradation of HIF1a by prolyl hydroxylation and VHL mediated proteasomal degradation was not clear. We recently developed a forward genetic screen in near-haploid KBM7 cells to identify genes that regulate HIF1a in aerobic conditions (Burr et al., 2016). Here, we used this screen to focus on cellular pathways enriched for gene-trapping insertions, and find that mutations in several V-ATPase subunits result in increased HIF1a levels. In addition, we identify two uncharacterised V-ATPase accessory proteins, TMEM199 and CCDC115, which we show are required for V-ATPase function and form the mammalian orthologue of the yeast Vma12p-Vma22p V-ATPase assembly complex. Although the V-ATPase is required for lysosomal degradation (Maxson and Grinstein, 2014), we find that the mechanism for HIF1a stabilisation following V-ATPase inhibition is through intracellular iron depletion, leading to decreased PHD activity. Iron supplementation to V-ATPase depleted cells directly restores PHD hydroxylation of HIF1a in cellular assays and in vitro. These findings support a novel role for the V-ATPase and its assembly factors in regulating HIF1a levels through the control of intracellular iron levels. eLife digest Most organisms have developed strategies to survive in low oxygen environments. Central to this response are proteins called Hypoxia Inducible Factors (HIFs), which activate genes involved in energy production and blood vessel growth when oxygen is scarce. When plenty of oxygen is present, HIFs are rapidly broken down. This is important because HIFs have also been linked to the growth and spread of cancers. Oxygen sensing enzymes, termed prolyl hydroxylases, play a principal role in controlling the break down of HIFs when oxygen is abundant. However, the activity of these prolyl hydroxylases can be reduced by changes in the nutrient or iron levels present in the cell. This raises questions about how other cell mechanisms help to control HIF levels. By using a technique called an unbiased forward genetic screen to study human cells, Miles, Burr et al. set out to identify the cellular pathways that regulate HIF levels when oxygen is still abundant. Disrupting a pump called the V-ATPase – which normally helps to break down unwanted proteins by acidifying the cellular compartments where they are destroyed – stabilised HIFs. Moreover, Miles, Burr et al. identified two previously uncharacterised genes that are required for the V-ATPase to work correctly. While the V-ATPase is typically associated with the destruction of proteins, a different, unexpected aspect of its activity is responsible for stabilising HIFs. Blocking activity of the V-ATPase reduces levels of iron inside the cell. This inhibits the activity of the prolyl hydroxylases, resulting in HIFs being activated. Overall, the findings presented by Miles, Burr et al. show key links between oxygen sensing, the use of iron and the V-ATPase. Further work is now needed to investigate how V-ATPase activity affects levels of HIFs found inside cells during diseases such as cancer. DOI: 10.7554/eLife.22693.002 Miles et al. eLife 2017;6:e22693. DOI: 10.7554/eLife.22693 2 of 28 Research article Biochemistry Cell Biology Figure 1. Depletion or inhibition of the V-ATPase stabilises HIF1a in aerobic conditions. (A) Bubble plot depicting genes enriched in the forward genetic screen. Bubbles represent the genes enriched in the GFPHIGH population compared to unmutagenised KBM7 cells expressing the HIF1a- GFPODD reporter. Proteins involved in V-ATPase assembly and function (green), canonical HIF1a regulation (purple), and the oxoglutarate dehydrogenase complex (blue) are highlighted, with the number of independent gene trap insertions indicated (brackets). (B) Pathway analysis of Figure 1 continued on next page Miles et al. eLife 2017;6:e22693. DOI: 10.7554/eLife.22693 3 of 28 Research article Biochemistry Cell Biology Results Depletion or inhibition of the V-ATPase stabilises HIF1a in aerobic conditions We developed a forward genetic screening approach to identify genes involved in the regulation of HIF1a under aerobic conditions using near haploid human KBM7 cells expressing a HIF1a-specific fluorescent reporter (HIF1a-GFPODD) (Burr et al., 2016). Briefly, this screen involved randomly muta- genising a clonal population of KBM7 HIF1a-GFPODD reporter cells with a gene-trapping retrovirus, fluorescence activated cell sorting (FACS) to enrich for rare mutations that resulted in increased GFP expression, and mapping the insertion sites in these GFPHIGH cells with Illumina HiSeq. This approach successfully identified genes involved in the canonical proteasomal degradation of HIF1a (PHD2 and VHL) as well as genes involved in mitochondrial regulation of HIF1a (oxoglutarate dehy- drogenase and lipoic acid synthase) (Figure 1A) (Burr et al., 2016). In addition, we noted that sev- eral other genes were enriched for trapping insertions compared to the control library, although their significance levels were lower (Figure 1A). Therefore, we ranked genes most enriched for trap- ping insertions according to biological process and molecular function (Figure 1B, Supplementary file 1). As expected, the HIF pathway was ranked highly, due to the enrichment of trapping insertions in genes such as PHD2, VHL and CUL2. However, the top ranked biological pro- cess was transferrin transport and V-ATPase function (Figure 1B), principally relating to mutagenesis of genes encoding five V-ATPase subunits: ATP6AP1, ATP6V1A, ATP6V1G1, ATP6V0A2 and ATP6V0D1 (Figure 1A). Subsequent analysis of the location of V-ATPase gene-trap inserts confirmed that these genes were enriched for mutations in a trapping orientation (Figure 1C), consistent with mutations resulting in deletion phenotypes. We validated whether disrupting the V-ATPase genes stabilised HIF1a using CRISPR (Clustered regularly-interspaced short palindromic repeats)-Cas9 gene-editing in wildtype HeLa cells and those expressing the HIF1a-GFPODD reporter (Figure 1D,E). Several single guide RNAs (sgRNA) were designed for each V-ATPase subunit, and transduced along with Cas9 into the HIF1a-GFPODD reporter or wildtype HeLa cells. GFP or endogenous HIF1a levels were measured by flow cytometry or immunoblot at least ten days after transduction. Depletion of all of the V-ATPase subunits identi- fied in the screen increased GFP levels in the sgRNA-targeted cells compared with the wildtype cells and control sgRNA to MHC Class I (b2 microglobulin, b2m) (Figure 1D), but to a lesser extent than depletion of the main PHD enzyme for HIF1a, PHD2 (Figure 1D). Depletion of the V-ATPase subu- nits also increased endogenous HIF1a, depending on the efficiency of the sgRNA (Figure 1E). Fur- thermore, chemical inhibition of V-ATPase activity with the inhibitor Bafilomycin A (BafA) activated the GFP reporter, increasing HIF1a levels in aerobic conditions (Figure 1F,G) without affecting HIF1a mRNA expression (see Figure 9J). TMEM199 and CCDC115 are the human orthologues of the yeast Vma12p-Vma22p V-ATPase assembly complex, and their depletion stabilises HIF1a In addition to the V-ATPase subunits detected in the screen, we identified that TMEM199 was signif- icantly enriched for gene-trapping insertions (Figure 2A). TMEM199 is a putative transmembrane protein with homology (24% sequence identity) to the yeast V-ATPase assembly protein Vma12p Figure 1 continued enriched genes in the KBM7 forward genetic screen. The top 114 genes enriched for multiple independent gene-trapping integrations in the GFPHIGH population compared to unmutagenised KBM7 cells expressing the HIF1a-GFPODD reporter were analysed by gene ontology clustering for pathways significantly targeted in the screen. An individual gene enrichment p value < 0.1 was used as a threshold value for genes to be included in the pathway analysis. (C) Schematic of enriched gene trap insertion sites in the 5 V-ATPase subunits (ATP6V0D1, ATP6V1G1, ATP6AP1, ATP6V1A, ATP6V0A2) identified in the forward genetic screen. (Red = sense insertions, Blue = antisense insertions). (D, E) Validation of the V-ATPase subunits identified in the screen using CRISPR-Cas9 targeted gene editing in HIF1a-GFPODD reporter (D) and wildtype (E) HeLa cells. Cells were simultaneously transduced with Cas9 and sgRNAs to ATP6V0D1, ATP6V1G1, ATP6AP1, ATP6V1A1, or ATP6V0A2. GFP levels were assessed by flow cytometry after 10 days (% GFPHIGH cells indicated) (D), and HIF1a levels measured by immunoblot (E). PHD2 and b2m were used as positive and negative controls respectively. (F, G) Chemical perturbation of V-ATPase function. Wildtype and HIF1a-GFPODD HeLa cells were cultured in the presence of BafA (10 nM or 100 nM) for 24 hr and HIF1a levels measured by GFP fluorescence (F) or immunoblot (G). DOI: 10.7554/eLife.22693.003 Miles et al. eLife 2017;6:e22693. DOI: 10.7554/eLife.22693 4 of 28 Research article Biochemistry Cell Biology Figure 2. TMEM199 and CCDC115 are the human orthologues of the yeast Vma12p-Vma22p V-ATPase assembly complex. (A) Enriched gene trap insertion sites in TMEM199 identified in the forward genetic screen. (Red = sense insertions, Blue = antisense insertions). (B) Schematic for TMEM199 (left) and Vma12p (right) membrane topology. TMEM199 and Vma12p demonstrate 23.89% sequence identity (Clustal Omega tool (EMBL-EBI)). (C, D) HIF1a-GFPODD reporter cells transduced with Cas9/TMEM199 sgRNA were sorted into GFPLOW (Lo) and GFPHIGH (Hi) populations by FACS (C), lysed, Figure 2 continued on next page Miles et al. eLife 2017;6:e22693. DOI: 10.7554/eLife.22693 5 of 28 Research article Biochemistry Cell Biology (also known as Vph2p) (Hirata et al., 1993) (Figure 2B). Depletion of TMEM199 resulted in accumu- lation of the HIF1a reporter (Figure 2C), similarly to levels observed for depletion of the V-ATPase subunits (Figure 1D). FACS of the GFPLOW and GFPHIGH TMEM199 sgRNA-targeted cells followed by immunoblot showed that endogenous HIF1a only accumulated in the GFPHIGH population (Figure 2C,D). Moreover, when we overexpressed a CRISPR resistant TMEM199 in these TMEM199 sgRNA-targeted cells, the accumulation of HIF1a was reversed (Figure 2E). We also isolated TMEM199 knockout (KO) clones, and while most TMEM199 knockouts were lethal after three weeks, a small number of clones that showed undetectable levels of endogenous TMEM199 by immunoblot had elevated HIF1a levels despite several passages (Figure 2F). Reconstituting these clonal cells with overexpressed TMEM199 decreased HIF1a levels (Figure 2F), further confirming the effect of TMEM199 depletion on HIF1a accumulation. Human TMEM199 mutations have been recently associated with glycosylation defects (Jansen et al., 2016c), but the role of TMEM199 in V-ATPase function was not known. To determine if TMEM199 was involved in the V-ATPase complex, we immunoprecipitated endogenous TMEM199 from wildtype HeLa cells and analysed the associated proteins by mass spectrometry, using the TMEM199 KO HeLa clones as a control (Figure 2G). Six proteins were identified as associating with TMEM199 with high confidence compared to the TMEM199 KO cells (Figure 2G). Of these, two were V-ATPase subunits, ATP6V0D1 and ATP6V0A2, which were also identified in the genetic screen (Figure 1A,C), and have been shown to associate with Vma12p in yeast (Graham et al., 1998). A fur- ther protein, CCDC115 (coiled-coil domain-containing protein 115), was of particular interest as a 3- dimensional structural prediction analysis (Kelley et al., 2015) showed high structural homology to the yeast V-ATPase assembly factor Vma22p (Figure 2H) known to bind Vma12p (Graham et al., 1998), and human mutations in CCDC115 have been recently reported to show glycosylation defects (Jansen et al., 2016b) similarly to the TMEM199 mutations. Immunoprecipitation of endoge- nous TMEM199 with FLAG-tagged CCDC115 confirmed the interaction identified by mass spec- trometry (Figure 2I), and depleting CCDC115 from HeLa HIF1a-GFPODD cells stabilised the fluorescent reporter and endogenous HIF1a similarly to TMEM199 deletion (Figure 2J,K). Thus, it was likely that TMEM199 and CCDC115 were mammalian homologues of the yeast V-ATPase assem- bly proteins. TMEM199 and CCDC115 localise to the ER and are required for endolysosomal acidification and lysosomal degradation Yeast Vma12p-Vma22p localise to the endoplasmic reticulum (ER), where they are thought to be involved in V-ATPase assembly (Graham et al., 1998). Using cell fractionation experiments we observed that TMEM199 was only present in the total membrane pool and not in the soluble fraction (Figure 3A). Furthermore, immunofluorescence microscopy showed endogenous TMEM199 local- ised predominantly to the ER, rather than endosomal or lysosomal compartments (Figure 3B,C). While it was not possible to visualise endogenous CCDC115 by immunoblot or fluorescence micros- copy, we observed co-localisation of endogenous TMEM199 with HA-CCDC115 at the ER, although CCDC115 is mostly cytosolic (Figure 3D,E). These results suggest that TMEM199 and CCDC115 Figure 2 continued and immunoblotted for endogenous HIF1a and TMEM199 (D). PHD2 and b2m were used as positive and negative controls respectively, and b-actin served as a loading control. (E, F) TMEM199 reconstitution decreases HIF1a levels in TMEM199 deficient cells. TMEM199 KO clones were isolated following lentiviral transduction with sgRNA to TMEM199/Cas9 and serial dilution. Null clones were identified by immunoblot. A CRISPR resistant TMEM199 was overexpressed by lentiviral transduction in mixed populations of TMEM199 deficient cells (E) or clonal cells (F). HIF1a and TMEM199 levels were measured by immunoblot, and short and long exposures of TMEM199 levels are shown (E). (G) Co-immunoprecipitation coupled mass spectrometry. Wildtype HeLa cells and TMEM199 null cells were lysed in 1% NP-40 and immunoprecipitated for TMEM199 for 3 hr. Samples were validated by immunoblotting and submitted for mass spectrometry analysis. Proteins immunoprecipitated in wildtype HeLa compared to TMEM199 KO cells with a unique peptide count >2 are shown. (H) PyMOL structural alignment of CCDC115 (pink) and Vma22p (green) based on Phyre2 predictions. (I) Immunoprecipitation of FLAG-CCDC115 with endogenous TMEM199 in wildtype (+) or TMEM199 deficient (-) HeLa cells. An unrelated FLAG tagged protein (FLAG-Ct) was used as a control. The lysate inputs and immunoprecipitated samples are shown. *non-specific band. (J, K) HIF1a-GFPODD reporter cells were depleted of CCDC115 by transduction with Cas9 and sgRNA. After 12 days, cells were sorted into GFPLOW (Lo, grey box, left) and GFPHIGH (Hi, grey box, right) populations by FACS (J), and immunoblotted for endogenous HIF1a (K). b-actin served as a loading control. DOI: 10.7554/eLife.22693.004 Miles et al. eLife 2017;6:e22693. DOI: 10.7554/eLife.22693 6 of 28 Research article Biochemistry Cell Biology Figure 3. TMEM199 and CCDC115 localise to the ER. (A) HeLa cells were homogenised and separated into membrane and cytosolic fractions by ultra- centrifugation. The samples were analysed by immunoblotting for TMEM199. Calnexin was used as a loading control for membrane compartments, whilst tubulin was used as a control for cytosolic fractions. (B, C) Representative immunocytochemical staining for endogenous TMEM199 (red) with the ER marker KDEL, the golgi apparatus marker TGN46, early endosome marker EEA1, late endosome marker M6PR and lysosomal marker LAMP-1 (all in Figure 3 continued on next page Miles et al. eLife 2017;6:e22693. DOI: 10.7554/eLife.22693 7 of 28 Research article Biochemistry Cell Biology form a complex at the ER, analogous to the yeast Vma12p-Vma22p V-ATPase assembly proteins (Graham et al., 1998). As a major function of the V-ATPase is facilitating the lysosomal degradation of proteins by acidi- fication of endosomal-lysosomal compartments, we examined whether TMEM199 or CCDC115 were required for the degradation of a known lysosomal substrate, epidermal growth factor receptor (EGFR). We sorted for TMEM199 or CCDC115 KOs in HIF1a-GFPODD reporter Hela cells by FACS, and measured EGFR degradation following EGF stimulation using BafA as a control (Figure 4A–C). EGF treatment stimulated the degradation of EGFR at 45 min in the control cells, with near com- plete loss of the receptor by 3 hr, consistent with prior reports (Mizuno et al., 2005) (Figure 4A–C). This degradation was prevented with BafA treatment (Figure 4A), confirming the role of the V-ATPase in the degradation of EGFR. However, EGF had no effect on the levels of EGFR in the TMEM199 or CCDC15 null cells, and no degradation was detected over 3 hr (Figure 4B,C). Indeed, TMEM199 and CCDC115 deficient cells prevented EGFR degradation similarly to BafA treatment (Figure 4A). The requirement for TMEM199 and CCDC115 in lysosomal degradation was not limited to EGFR, as we observed impaired degradation of another lysosomal substrate, Major Histocompatibility Complex (MHC) Class I. The degradation of cell surface MHC Class I molecules by the Kaposi Sar- coma Herpesvirus (KSHV) gene product K3 is a well characterised pathway dependent on ubiquitina- tion and lysosomal degradation (Coscoy and Ganem, 2000; Hewitt et al., 2002; Ishido et al., 2000). Therefore, we used HeLa cells expressing K3, which have low resting levels of cell surface MHC Class I (Figure 4D), and transduced these cells with sgRNA targeting TMEM199, CCDC115 or core V-ATPase subunits (ATP6V1A1, ATP6V0D1). Mixed populations of TMEM199 or CCDC115 defi- cient cells partially rescued MHC Class I at the cell surface (Figure 4D). Similar findings were observed with depletion of the core V-ATPase subunits, consistent with a role for TMEM199 and CCDC115 in V-ATPase facilitated lysosomal degradation (Figure 4D). As the V-ATPase is also required to acidify endosomal compartments, we explored the role of TMEM199 and CCDC115 in endosomal acidification using a fluorescent pH sensitive transferrin receptor (Tfnr-phl) (Merrifield et al., 2005). This construct encodes a super-ecliptic GFP phlourin attached to the extracellular domain of the receptor, which is quenched on transition from pH 7 to 5 (Merrifield et al., 2005) (Figure 5—figure supplement 1A), and therefore not visible in acidified compartments. To examine how endosomal pH (e.g. Tfnr-phl fluorescence) was associated with HIF1a stabilisation, we substituted GFP in our HIF1a reporter construct to generate HIF1a-mCher- ryODD reporter cells. Live cell microscopy of these cells expressing Tfnr-phl showed GFP fluorescence only at the cell surface (Figure 5A,B), as the transferrin receptor typically recycles between the plasma membrane and recycling vesicles (Maxfield and McGraw, 2004), and is quenched in the acidic endosomal compartments. Confocal fluorescence microscopy of fixed Tfnr-phl expressing cells (i.e. no longer pH sensitive) confirmed that the receptor was still present in endosomal compart- ments (Figure 5—figure supplement 1B). However, live cell microscopy of HIF1a-mCherryODD reporter cells treated with BafA revealed Tfnr-phl within intracellular vesicles, confirming that V-ATPase inhibition prevented acidification of endosomal compartments (Figure 5A,B). Indeed, the localisation of Tfnr-phl following BafA treatment was similar to the confocal fluorescence microscopy of fixed Tfnr-phl expressing cells (Figure 5—figure supplement 1B). Moreover, mCherry fluores- cence was only observed in the BafA treated cells (Figure 5A), confirming that V-ATPase inhibition led to decreased endosomal acidification and HIF1a stabilisation. We next examined the effect of TMEM199 or CCDC115 depletion on Tfnr-phl intracellular fluo- rescence in HIF1a-mCherryODD HeLa reporter cells (Figure 5C), using mCherry accumulation to iden- tify cells where V-ATPase formation was disrupted. Mixed KO populations of the core V-ATPase subunits ATP6V1A1 or ATP6V0D1 were used as a control. Live cell imaging of transiently transfected Figure 3 continued green) (B). Scale bar represents 5 mm. Quantification of colocalisation for TMEM199 and the respective organelle markers using Pearson’s Correlation Coefficient (C) n  16 cells. (D, E) Confocal immunofluorescence microscopy of HeLa cells transduced with HA-CCDC115 (green) and endogenous TMEM199 (red, top) or KDEL (red, bottom) (D). Scale bar represents 10 mm. Quantification of colocalisation for CCDC115 with TMEM199 or KDEL using Pearson’s Correlation Coefficient (E) n  50 cells. DOI: 10.7554/eLife.22693.005 Miles et al. eLife 2017;6:e22693. DOI: 10.7554/eLife.22693 8 of 28 Research article Biochemistry Cell Biology Figure 4. TMEM199 and CCDC115 and are required for lysosomal degradation of EGFR and MHC Class I. (A) EGFR degradation assay for wildtype and BafA treated cells. HeLa cells were cultured in the presence or absence of 10 nM BafA for 24 hr. Cells were stimulated with EGF and lysed at the indicated times. Lysates were subjected to SDS-PAGE and immunoblotted for EGFR. b-actin was used as a loading control. (B, C) EGFR degradation assay for TMEM119 and CCDC115 deficient cells. HIF1a-GFPODD cells were transduced with Cas9 and sgRNA to TMEM199 (B) or CCDC115 (C). After Figure 4 continued on next page Miles et al. eLife 2017;6:e22693. DOI: 10.7554/eLife.22693 9 of 28 Research article Biochemistry Cell Biology Tfnr-phl in mixed KO populations of TMEM199, CCDC115, or the core V-ATPase subunits showed that Tfnr-phl intracellular fluorescence was almost entirely observed in cells that stabilised the HIF1a-mCherryODD reporter (Figure 5C,D and Figure 5—figure supplement 1C). Thus, TMEM199 and CCDC115 depletion prevents acidification of endosomes, similarly to BafA treatment or deple- tion of core V-ATPase subunits. V-ATPase depletion activates HIF1 by preventing HIF1a prolyl hydroxylation The identification of V-ATPase components as regulators of HIF1a levels by a genetic approach was unexpected, given that depletion of PHD2 and VHL, the principal genes involved in the canonical pathway for HIF1a proteasomal degradation, are sufficient for HIF1 activation. We therefore mea- sured the levels of HIF1a in HeLa cells treated with different V-ATPase inhibitors in comparison to the proteasome inhibitor, MG132 (Figure 6A). Surprisingly, we observed similar levels of HIF1a accumulation following treatment with either V-ATPase inhibitors or MG132. Furthermore, BafA treatment increased HIF1a levels after just 4 hr (Figure 6B). Rather than observing HIF1a accumula- tion within endosomal-lysosomal compartments, as would be expected following disruption of the V-ATPase, HIF1a was only observed in the nuclei of cells treated with BafA (Figure 6C) or depleted of TMEM199 (Figure 6D). This nuclear increase in HIF1a was sufficient to activate HIF responsive genes, demonstrated by an increase in cell surface and total Carbonic Anhydrase 9 (CA9) when cells were depleted of TMEM199, CCDC115 or core V-ATPase subunits (Figure 6E,F). V-ATPase inhibi- tion or depletion also stabilised HIF2a in HeLa cells and the HIF target gene Heme oxygenase 1 (HO-1) (Bertout et al., 2009) (Figure 6G). Prior studies suggest that CMA may contribute to the degradation of HIF1a (Hubbi et al., 2013). To determine if CMA or macroautophagy played a significant role in the regulation of HIF1a in aero- bic conditions, we examined the effect of depletion of HSC70, LAMP2A and ATG16 on HIF1a levels. Depletion of the CMA mediators, HSC70 and LAMP2A, or loss of the macroautophagy protein, ATG16, had no effect on HIF1a stabilisation in aerobic conditions (Figure 7A–C). Moreover, BafA treatment still stabilised HIF1a even when LAMP2A, HSC70 or ATG16 were depleted (Figure 7A,C, D). We therefore sought alternative explanations to account for the accumulation of HIF1a following V-ATPase inhibition, and focused on the principle mechanism for regulating HIF1a stability, prolyl- hydroxylation. We measured the levels of total and prolyl-hydroxylated HIF1a in HeLa cells treated with several V-ATPase inhibitors, the proteasome inhibitor MG132, or the PHD inhibitor DMOG (dimethyloxaloyl- glycine) using a HIF1a prolyl hydroxyl-specific antibody (Figure 7E,F). While all inhibitors increased total HIF1a levels, only MG132 resulted in the accumulation of prolyl-hydroxylated HIF1a (Figure 7E,F). Conversely, BafA and chloroquine stabilised HIF1a in a non-hydroxylated form, simi- larly to DMOG treatment (Figure 7E,F). To directly measure if PHD activity was reduced following V-ATPase inhibition, we used an in vitro assay of HIF1a prolyl-hydroxylation (Burr et al., 2016), which allows measurements for PHD activity from cell lysates without the addition of excess cofactors (Figure 7G,H). Lysates from wildtype HeLa cells or cells treated with BafA for 24 hr were incubated with a purified His-tagged HIF1aODD protein for 15 min, and hydroxylation measured using the hydroxyprolyl-specific antibody. While HIF1aODD was rapidly hydroxylated in the wildtype HeLa lysate, BafA treatment markedly reduced hydroxyl- ation (Figure 7G,H). Thus, rather than preventing the lysosomal degradation of HIF1a, the V-ATPase inhibition stabilised HIF1a by decreasing PHD enzymatic activity. Figure 4 continued 14 days, cells were sorted into TMEM199 or CCDC115 sufficient (+/+, GFPLOW), and TMEM199 or CCDC115 null (/, GFPHIGH) populations as described. Cells were then cultured for 24 hr before stimulation with EGF (100 ng/ml), harvested at indicated times and immunoblotted for EGFR. (D) MHC Class I degradation in HeLa cells expressing K3. HeLa-K3 cells were transduced with Cas9 and sgRNA to TMEM199, CCDC115, ATP6V1A1 or ATP6V0D1. After 14 days, cell surface MHC Class I levels were measured by flow cytometry (mAb W6/32). Wildtype HeLa cells were used as a control for total MHC Class I. Percentages of cells with MHC Class I at the cell surface are shown. DOI: 10.7554/eLife.22693.006 Miles et al. eLife 2017;6:e22693. DOI: 10.7554/eLife.22693 10 of 28 Research article Biochemistry Cell Biology Figure 5. TMEM199 and CCDC115 are required for acidification of endosomal compartments. (A, B) Live cell confocal microscopy of HIF1a- mCherryODD reporter cells transfected with the pH sensitive Tfnr-phl. HIF1a-mCherryODD reporter cells were transfected with Tfnr-phl and treated with or without 10 nM BafA for 24 hr. Lower (LM) and Higher (HM) magnifications of representative BafA treated cells are shown (A). Quantification of intracellular Tfnr-phl/total Tfnr-phl fluorescence in BafA treated cells compared to no treatment (9 cells) (B). Additional control experiments are shown Figure 5 continued on next page Miles et al. eLife 2017;6:e22693. DOI: 10.7554/eLife.22693 11 of 28 Research article Biochemistry Cell Biology Disrupting the V-ATPase decreases intracellular iron levels and prevents HIF1a prolyl hydroxylation PHDs are 2-oxoglutarate (2-OG) dependent dioxygenases, which aside from molecular oxygen, require Fe(II) and 2-OG as cofactors for catalytic activity. As hydroxylation of HIF1a was impaired by V-ATPase inhibition in aerobic conditions, it was possible that V-ATPase activity altered the level of PHD cofactors. We focused on iron as: (i) iron chelators and iron metabolism can alter PHD activity (Wang and Semenza, 1993), and (ii) the V-ATPase is implicated in iron homeostasis via clathrin- mediated endocytosis of transferrin (Kozik et al., 2013), the conversion of ferric to ferrous iron within endosomes (Dautry-Varsat et al., 1983; Straud et al., 2010), and the release of iron from fer- ritin stores (Mancias et al., 2014). To examine if V-ATPase inhibition resulted in cytosolic iron depletion, we treated the cells with BafA and measured the levels of IRP2 (also known as IREB2); a sensitive maker of intracellular free iron that is rapidly ubiquitinated and undergoes proteasomal degradation in iron-replete cells, but accumulates in iron deficient conditions (Iwai et al., 1995; Salahudeen et al., 2009; Vashisht et al., 2009). The iron chelator, desferrioxamine (DFO), which has an established role in inhibiting PHD activity and activating the hypoxia pathway, was used as a control for intracellular iron depletion, (Jaakkola et al., 2001; Wang and Semenza, 1993). BafA treatment stabilised IRP2 similarly to cells treated with DFO (Figure 8A), consistent with V-ATPase inhibition leading to depletion of intracellu- lar iron. DFO and particularly BafA treatment also increased NCOA4, the main cargo receptor for the autophagic degradation of ferritin (ferritinophagy) and mobilisation of intracellular iron stores (Mancias et al., 2014). However, while NCOA4 promoted ferritinophagy in DFO treated cells, ferri- tin levels were unchanged in BafA treated cells, consistent with a complete block in autophagy when the V-ATPase was inhibited (Figure 8A). Similar increases in IRP2 and NCOA4 were observed in FACS GFPHIGH populations of TMEM199, CCDC115, ATP6V0D1 or ATP6V1A1 deficient HIF1a- GFPODD reporter cells (Figure 8B). Together, these findings demonstrate that disrupting V-ATPase integrity and assembly results in intracellular iron depletion. We next asked if replenishing ferrous iron levels directly restored HIF1a prolyl hydroxylation. We first validated that ferrous iron restored in vitro prolyl hydroxylation of the HIF1aODD in DFO treated lysates (Figure 8C,D). We then examined the effect of ferrous iron treatment on PHD activity in extracts from BafA treated HeLa cells (Figure 8E,F). The addition of 1 mM Fe(II) completely restored prolyl hydroxylation of the HIF1aODD (Figure 8E,F). Indeed, the levels of HIF1a hydroxylation were slightly higher than observed in wildtype cells, although this increase was not significant. Iron supplementation restores HIF1a turnover in cells when V-ATPase activity is disrupted To explore if iron supplementation was sufficient to restore HIF1a turnover in cells where the V-ATPase had been inhibited, BafA treated HIF1a-GFPODD reporter or wildtype HeLa cells were sup- plemented with or without 50 mM iron (Fe(III)) citrate for 24 hr, and HIF1a levels measured by flow cytometry and immuoblot (Figure 9A,B). While BafA treatment stabilised the GFP reporter and endogenous HIF1a, this was completely prevented by the addition of iron to the media. Similar find- ings were observed in cells treated with DFO and iron citrate (Figure 9C,D), although the concentra- tion of iron needed to restore HIF1a degradation was higher (200 mM Fe(III)). Iron supplementation also restored HIF1a turnover in BafA treated primary human dermal fibroblasts, HEK293ET cells and RCC10 cells that had been reconstituted with VHL (Figure 9E–G). Furthermore, iron citrate also Figure 5 continued in Figure 5—figure supplement 1. (C, D) Live cell confocal microscopy of Tnfr-phl fluorescence in HIF1a-mCherryODD reporter cells depleted for TMEM199, CCDC115 or core V-ATPase subunits. TMEM199, CCDC115, ATP6V1A1 or ATP6V0D1 were depleted by sgRNA as described. After 10–12 days the cells were transfected with Tfnr-phl and live cell fluorescence measured after a further 24 to 48 hr (C). Quantification of intracellular Tfnr-phl/ total Tfnr-phl fluorescence is shown (12 cells) (D). Representative wide field images are shown in Figure 5—figure supplement 1C. Scale bars represent 10 mm (A) or 5 mm (C). Values are mean±SEM. DOI: 10.7554/eLife.22693.007 The following figure supplement is available for figure 5: Figure supplement 1. TMEM199 and CCDC115 are required for acidification of endosomal compartments. DOI: 10.7554/eLife.22693.008 Miles et al. eLife 2017;6:e22693. DOI: 10.7554/eLife.22693 12 of 28 Research article Biochemistry Cell Biology Figure 6. Disrupting the V-ATPase activates HIF1 and HIF2. (A) Immunoblot of HIF1a levels in response to the proteasome inhibitor MG132, the V-ATPase inhibitor BafA, the lysosomotropic agent Chloroquine, and the oxidative metabolism inhibitor NH4Cl. (B) Immunoblot of HIF1a levels in HeLa cells in response to BafA treatment at 0.5, 1, 2, 4, 8 and 24 hr. (C) Confocal immunofluorescence microscopy of WT (top) and BafA (bottom) treated HeLa cells stained for endogenous HIF1a. Cells were treated in the presence or absence of 10 nM BafA for 24 hr before immunofluorescence staining Figure 6 continued on next page Miles et al. eLife 2017;6:e22693. DOI: 10.7554/eLife.22693 13 of 28 Research article Biochemistry Cell Biology prevented the downstream activation of several HIF1 target genes (GLUT1, VEGF and carbonic anhydrase 9) following BafA treatment without affecting HIF1a mRNA levels (Figure 9J). Consistent with iron supplementation only affecting HIF1a levels following V-ATPase inhibition, iron citrate did not affect HIF1a stabilisation following proteasome inhibition or in VHL null RCC10 cells (Figure 9G, H). Iron citrate had no direct effect on lysosomal degradation, as EGFR turnover was still impaired in BafA treated cells following iron supplementation (Figure 9I). Although iron citrate restored HIF1a to basal levels following BafA treatment, it was unclear whether HIF1a stabilisation following genetic disruption of the V-ATPase could be prevented by iron supplementation. Therefore, iron citrate was supplemented to the media of mixed KO populations of individual V-ATPase subunits (TMEM199, CCDC115 or ATP6V1A1) and HIF1a levels measured by immunoblot (Figure 9K–M). Iron treatment reversed the HIF1a stabilisation in the sgRNA-targeted cells (Figure 9K–M), confirming that iron supplementation was sufficient to restore HIF1a degrada- tion following genetic disruption of the V-ATPase. While it was evident that V-ATPase inhibition resulted in iron depletion, we wanted to explore the relative importance of disrupting iron uptake compared to mobilisation of iron stores. Moreover, the contribution of transferrin independent iron uptake to the intracellular pool was unclear (Liuzzi et al., 2006; Oudit et al., 2006). We examined if treating cells with ferric iron prior to BafA treatment prevented HIF1a accumulation and conversely, also measured if iron supplementation after BafA treatment affected HIF1a levels (Figure 10A). Pre-conditioning the media with iron citrate did not prevent the accumulation of HIF1a following BafA treatment (Figure 10A). However, iron supplementation at the time of BafA treatment or after 12 hr did decrease HIF1a levels (Figure 10A), suggesting that iron supplementation restores HIF1a turnover following disruption of the V-ATPase by a transferrin independent mechanism. To further explore the relative contributions of iron uptake and ferritin turnover to intracellular iron homeostasis, we depleted cells of transferrin receptor, IRP2 or NCOA4 by sgRNA, and used HIF1a stability as a sensitive functional measure of iron levels. Mixed KO populations of NCOA4 cells had no effect on HIF1a levels (Figure 10B,C – Figure 10—figure supplement 1A). Interestingly, NCOA4 depletion did increase IRP2 levels after 12 days, suggesting that IRP2 may increase iron flux through the endosomal pathway, but cell surface transferrin receptor and total ferritin levels did not change (Figure 10B,C) Depletion of either IPR2 or the transferrin receptor stabilised the HIF1a- GFPODD reporter and endogenous HIF1a, although this was most marked in the transferrin receptor null cells (Figure 10D–F,H – Figure 10—figure supplement 1B–D). IRP2 depletion also did not alter cell surface transferrin receptor levels (Figure 10D), consistent with IRP2 regulating iron flux rather than just transferrin receptor expression. Thus, ferritinophagy does not seem to contribute signifi- cantly to cytosolic Fe(II) levels when the transferrin pathway is functional. Lastly, we examined if iron supplementation restored HIF1a turnover in transferrin receptor defi- cient cells. Mixed transferrin receptor KO populations were treated with iron citrate for 24 hr and HIF1a levels measured. Iron treatment decreased HIF1a levels and increased ferritin stores without altering NCOA4 levels (Figure 10G,H – Figure 10—figure supplement 1E). Thus, when the trans- ferrin pathway is impaired, either by depletion of the transferrin receptor or disrupting V-ATPase activity, increasing the availability of extracellular Fe(III) is sufficient to restore PHD activity and HIF1a degradation. Discussion The use of a forward genetic approach to examine cellular processes that regulate HIF1a revealed that disruption of the V-ATPase complex stabilised HIF1a in aerobic conditions. HIF1a accumulation Figure 6 continued with HIF1a (white). Cells were mounted using DAPI (blue) and visualised by confocal microscopy. Scale bar represents 10 mm. (D) Immunocytochemical staining to examine HIF1a stabilisation in TMEM199 depleted HIF1a-GFPODD reporter cells. HIF1a-GFPODD reporter cells were depleted of TMEM199 using CRISPR-Cas9 genetics and stained for HIF1a (white), TMEM199 (red) and DAPI (blue). Scale bar represents 20 mm. (E–G) Levels of HIF1a or HIF2a and their target genes in cells depleted of V-ATPase subunits. HIF1a-GFPODD reporter cells were transduced with sgRNA to the indicated V-ATPase subunits as described. After 14 days, cell surface CA9 was measured by flow cytometry (E). Levels of HIF1a, HIF2a and their targets CA9 and HO-1 were measured by immunoblot (F, G). DOI: 10.7554/eLife.22693.009 Miles et al. eLife 2017;6:e22693. DOI: 10.7554/eLife.22693 14 of 28 Research article Biochemistry Cell Biology Figure 7. V-ATPase depletion or inhibition stabilises HIF1a in a non-prolyl hydroxylated form. (A) HIF1a stabilisation in ATG16 null HeLa cells. HeLa cells and ATG16 null cells were treated with increasing concentrations of BafA (10 nM and 100 nM) before immunoblotting for HIF1a. (B) HIF1a levels following depletion of HSC70 and LAMP2A in aerobic conditions. HSC70 and LAMP2A depleted cells were generated using CRISPR-Cas9 gene editing with three individual sgRNAs (g1, g2, g3). HIF1a, LAMP2A and HSC70 levels were visualised by immunoblot. Untreated (Ct) and BafA treated HeLa cells Figure 7 continued on next page Miles et al. eLife 2017;6:e22693. DOI: 10.7554/eLife.22693 15 of 28 Research article Biochemistry Cell Biology following inhibition of V-ATPase activity was unexpected, given the clear role for the proteasome in degrading ubiquitinated HIF1a in normal oxygen tensions. Rather than V-ATPase inhibition directly preventing HIF1a degradation, we find that HIF1a is stabilised due to depletion of intracellular iron, which results from decreased transferrin uptake and reduced conversion to ferrous iron within endo- somal compartments. These findings may have diverse physiological implications, particularly as germline mutations in V-ATPase subunits are associated with several human diseases. Homozygous mutations in a V0 subunit isoform (ATP6V0A3) cause infantile osteopetrosis (failure of bone resorption) (Kornak et al., 2000), while mutations in kidney specific isoforms (ATP6V0A4) cause dis- tal tubular renal acidosis (Karet et al., 1999; Smith et al., 2000). Furthermore, several cancer cell types express V-ATPase complexes at the plasma membrane (Capecci and Forgac, 2013), possibly as a mechanism for regulating cytosolic pH, which appear to render tumour cells more susceptible to cell death when the V-ATPase is inhibited (Perut et al., 2014). Given the diverse role of the V-ATPase, it will be of future interest to examine whether known germline or somatic human muta- tions in V-ATPase subunits impact on the HIF pathway in animal models. While HIF1a degradation by proteasome independent mechanisms, such as CMA, has been reported (Bremm et al., 2014; Ferreira et al., 2013; Hubbi et al., 2014, 2013; Selfridge et al., 2016), we did not observe any effect on HIF1a levels in HeLa cells when key mediators of CMA were depleted (HSC70 and LAMP2A). The ability of iron treatment to completely restore HIF1a turn- over when the V-ATPase is inhibited, without altering the lysosomal degradation of EGFR or the autophagy cargo receptor NCOA4, also argues against a role for CMA in HIF1a regulation. It remains possible that non-proteasomal degradation of HIF1a may occur in certain cell types and under particular conditions. The requirement for the AAA ATPase P97 in HIF1a degradation sug- gests that it may be incorporated into larger complexes that require unfolding prior to proteolysis (Alexandru et al., 2008). Nevertheless, we find that the major consequence of V-ATPase inhibition is stabilisation of HIF1a by preventing prolyl hydroxylation. Our findings are consistent with prior studies showing impaired uptake of transferrin following V-ATPase inhibition (Kozik et al., 2013; Straud et al., 2010), and confirm the importance of V-ATPase activity in regulating iron through clathrin-mediated endocytosis (Kozik et al., 2013), endosomal acidification (Eckenroth et al., 2011; Ohgami et al., 2005) and ferritinophagy (Mancias et al., 2014). Directly measuring the levels of free intracellular iron within the cytosol is challenging, as reagents typically used for these assays rely on indirect enzymatic assays, and most Fe(II) is rapidly bound to enzymes or incorporated into the biosynthesis of iron-sulphur complexes. However, IRP2 is a sensitive marker of intracellular iron availability (Iwai et al., 1995; Salahudeen et al., 2009; Vashisht et al., 2009), and its induction following V-ATPase inhibition is consistent with depletion of ferrous iron. Furthermore, our in vitro hydroxylation assay clearly shows that supplementation with Fe(II) can completely restore prolyl hydroxylation of HIF1a, confirming that V-ATPase inhibition reduces the available pool of intracellular Fe(II). The V-ATPase is not only implicated in iron uptake and conversion to Fe(II), but also required for the release of iron from ferritin stores via ferritinophagy. Using HIF1a stabilisation as a sensitive marker for intracellular iron, we find that inhibition or disruption of the V-ATPase both alters iron uptake and degradation of ferritin. However, HIF1a was only stabilised in the transferrin receptor deficient cells, implying that increased ferritin turnover is not sufficient to compensate for prolonged loss of transferrin-mediated iron uptake. Conversely, while loss of NCOA4 activated IRP2, there was still sufficient intracellular iron for PHDs to function and HIF1a was not stabilised. These findings are consistent with decreased transferrin uptake and conversion of Fe(III) to Fe(II) being the predominant Figure 7 continued were used as controls. (C) HIF1a levels following siRNA-mediated depletion of HSC70. HeLa cells were transfected with siRNA to HSC70 or an siRNA control (Ct), and HIF1a or HSC70 levels measured by immunoblot after 96 hr. Cells were treated with or without 10 nM BafA for 24 hr prior to lysis. (D) LAMP2A deficient HeLa cells were treated with or without 10 nM BafA for 24 hr. Three different sgRNAs were used (g1, g2, g3). (E, F) Immunoblot of total HIF1a and the prolyl hydroxylated form in response to MG132, DMOG, BafA and Chloroquine (E). Quantification of immunoblots represented using ImageJ analysis (F) (n = 3). (G, H) In vitro prolyl hydroxylation of the HIF1aODD protein following incubation with lysates from WT, BafA and DMOG treated HeLa cells. The levels of hydroxylated HIF1a were measured using a prolyl hydroxy-HIF1a specific antibody (G). Quantification of the in vitro hydroxylation assay using ImageJ analysis (H) (n = 3). Values are mean±SEM. *p<0.05, **p<0.01, ***p<0.001. DOI: 10.7554/eLife.22693.010 Miles et al. eLife 2017;6:e22693. DOI: 10.7554/eLife.22693 16 of 28 Research article Biochemistry Cell Biology Figure 8. Disrupting V-ATPase activity decreases intracellular iron levels. (A, B) V-ATPase inhibition leads to intracellular iron depletion. (A) HeLa cells were treated with BafA (10 nM or 100 nM) or 100 mM DFO for 24 hr. HIF1a, IRP2, NCOA4 and ferritin (ferritin heavy chain 1, FTH1) levels were measured by immunoblot. (B) HIF1a-GFPODD reporter cells transduced with Cas9 and sgRNA targeting V-ATPase components (TMEM199, CCDC115, ATP6V0D1 and ATP6V1A1) were sorted into GFPLOW (Lo) and GFPHIGH (Hi) populations as described. The lysates were immunoblotted for HIF1a, IRP2, or Figure 8 continued on next page Miles et al. eLife 2017;6:e22693. DOI: 10.7554/eLife.22693 17 of 28 Research article Biochemistry Cell Biology mechanisms for reduced PHD activity when the V-ATPase is inhibited, and highlight the relative importance of iron uptake versus release from intracellular stores. Interestingly, Fe(III) supplementa- tion to the media was sufficient to restore HIF1a turnover when the V-ATPase was inhibited or fol- lowing depletion of the transferrin receptor. Thus, transferrin-independent uptake of iron can occur when there is sufficient extracellular iron availability, presumably by transporters such as Zip14, which mediate non-transferrin bound iron uptake (Liuzzi et al., 2006). It will be of interest to explore the biological implications of transferrin-independent mechanisms and the role of ferritinophagy in future studies. Moreover, it is plausible that HIF activation and V-ATPase activity serve as a feedback mechanism to control intracellular iron, particularly as HIFs promote genes involved in iron metabo- lism (Pantopoulos et al., 2012; Peyssonnaux et al., 2008; Simpson and McKie, 2015). The identification of TMEM199 and CCDC115 as V-ATPase assembly proteins has interesting implications for our understanding of how the human V-ATPase complex forms. In yeast, Vma12p and Vma22p dimerise and are thought to promote the assembly of the membrane embedded com- plex (V0), which can subsequently associate with the peripheral complex (V1) (Graham et al., 1998; Hill and Stevens, 1995; Hirata et al., 1993; Jansen et al., 2016c). Similarly to the yeast Vma12 studies, we find that TMEM199 is predominantly localised to the endoplasmic reticulum, implying that it is likely to be involved in V-ATPase assembly, rather than forming part of the mature complex. Human germline mutations in TMEM199 and CCDC115 cause disorders with a liver storage disease phenotype (Jansen et al., 2016b, 2016c) and it remains to be determined how impaired glycosyla- tion relates to V-ATPase function, or if these defects relate to other roles of TMEM199 and CCDC115. However, it is of interest that all described TMEM199 and CCDC115 human mutations have impaired glycosylation of transferrin, suggesting a role for the V-ATPase associated factors in iron metabolism (Jansen et al., 2016b, 2016c). ATP6AP1 (also known as Ac45) was also identified in our forward genetic screen and has recently been identified as the human orthologue of the yeast Voa1 V-ATPase assembly factor (Jansen et al., 2016a). Human mutations in ATP6AP1 have a distinct phenotype to that of TMEM199 and CCDC115 mutations, resulting in immunodeficiency as well as abnormal glycosylation (Jansen et al., 2016a). Furthermore, human mutations in another V-ATPase assembly factor, VMA21, cause an autophagic myopathy (Ramachandran et al., 2013). The explana- tion for the diverse nature of human diseases caused by mutations in V-ATPase assembly factors is unclear. Moreover, while yeast studies support the role of Vma12p, Vma21p and Vma22p in V-ATPase assembly, this has not been studied in mammalian cells, where they may serve additional regulatory functions on V-ATPase activity. Addressing the pathological role of these human V-ATPase mutations on iron metabolism and HIFs in animal models will be important in future stud- ies. Nevertheless, our findings show that V-ATPase activity can alter HIF signalling through regulat- ing intracellular iron. Materials and methods Cell culture, antibodies and reagents HeLa, HEK293T and RCC10 cells were cultured and maintained at 37˚C with 5% (v/v) CO2 in Dulbec- co’s modified Eagle Medium supplemented with 10% (v/v) Fetal Calf Serum (HyClone) and 100IU/ml Penicillin G and 100 mg/ml Streptomycin. Primary dermal fibroblasts (Lonza) were cultured under the same conditions but with 20% (v/v) FCS. ATG16 null HeLa cells were a kind gift from David Rubinsz- tein (University of Cambridge). HeLa and HEK293 cells were originally a gift from Paul Lehner (Uni- versity of Cambridge). RCC10 cells were a gift from Patrick Maxwell (University of Cambridge). HeLa, HEK293 and RCC10 cells were authenticated by STR profiling (Eurofins Genomics). Human Figure 8 continued NCOA4. b-actin served as a loading control. (C) Iron chelation prevents HIF1a hydroxylation. In vitro prolyl hydroxylation of the HIF1aODD protein following incubation with lysates from WT or DFO treated lysates (100 mM for 24 hr) as previously described. DMOG served as a control for PHD inhibition. (D–F) In vitro hydroxylation of PHD activity in DFO or BafA treated lysates supplemented with ferrous iron. Lysates from control, DFO (D) or BafA (E) treated HeLa cells were extracted as previously described, incubated with the HIF1aODD protein, and supplemented with increasing concentrations of iron chloride (FeCl2, Fe(II)). Prolyl-hydroxylated HIF1a ODD levels were visualised by immunoblot and quantified by densitometry for the BafA treated lysate (F) (n = 3). Values are mean±SEM. *p<0.05, **p<0.01 Fe(II) compared to no treatment in BafA treated cells. NS=not significant. DOI: 10.7554/eLife.22693.011 Miles et al. eLife 2017;6:e22693. DOI: 10.7554/eLife.22693 18 of 28 Research article Biochemistry Cell Biology Figure 9. Iron supplementation restores HIF1 activity to basal levels following V-ATPase inhibition in cell lines and primary cells. (A–D) Iron reconstitution in BafA or DFO treated HeLa cells. (A, C) HIF1a-GFPODD reporter cells were treated with BafA (10 nM or 100 nM), or 100 mM DFO for 24 hr with 50 mM iron citrate (Fe(III)) (red), 200 mM Fe(III) (blue) or no iron (green), and GFP levels analysed by flow cytometry. (B, D) Wildtype HeLa cells were treated with or without BafA (10 nM or 100 nM) or DFO (100 mM) and Fe(III) (50–200 mM) as described, and endogenous HIF1a levels were Figure 9 continued on next page Miles et al. eLife 2017;6:e22693. DOI: 10.7554/eLife.22693 19 of 28 Research article Biochemistry Cell Biology primary dermal fibroblasts were authenticated by Lonza. All cells were confirmed to be mycoplasma negative (Lonza MycoAlert). Primary antibodies were prepared for immunoblotting as follows: TMEM199 (Atlas, HPA027051, 1:2000), LAMP2A (Abcam, ab18528, 1:1000), HSC70 (Abcam, ab19136, 1:1000), EGFR (Santa Cruz, Sc-03, 1:500), HIF1a (BD Transduction Laboratories, 610959, 1:1000), b-actin (Sigma, A228, 1:30000), Calnexin (Abcam, ab75801, 1:1000), Tubulin (eBioscience 14–4502, 1:1000), ATG16L (MBL, PMO40, 1:1000, Gift from Rubinzstein lab, CIMR), M2-FLAG (Sigma, F3165, 1:5000), CCDC115 (Atlas, HPA034598, 1:1000), PHD2 (Novus bioscience, NB100-137, 1:5000), Hydroxy-HIF-1a (Cell sig- naling technology, 3434, 1:2000), b2M (Dako, A00072, gift from Paul Lehner, CIMR, 1:10000), NCOA4 (ARA70, Bethyl Laboratories, A302-272A-T, 1:2000), IRP2 (IREB2, Cell Signalling Technol- ogy, 37135, 1:1000), Ferritin heavy chain (FTH1, Cell Signalling Technology, 3998, 1:1000), Carbonic anhydrase 9 (CA9, clone M75, gift from Egbert Oosterwijk, Radboud, 1:5000). Immunofluorescence antibodies: LAMP1 (Santa Cruz, SC-20011, 1:100), TGN46 (AbD Serotec, AHP500GT, 1:200), KDEL (gift from Geoff Butcher, Babraham Institute, 1:400), EEA1 (gift from Evan Reid, 1:250), M6PR (gift from Evan Reid, 1:500), HIF1a (1:100), TMEM199 (1:50), HA-11 (Ms Covance, MMS-101P, 1:100), rabbit polyclonal to HA-11 (gift from Paul Lehner, 1:100). Antibodies for cell-surface staining: MHC Class I (W6/32, gift from Paul Lehner, CIMR, 1:100), Transferrin receptor (TFRC, CD71, BD Pharmi- gen, 555534, 1:500), CA9 (1:500). The following reagents were used: MG132 (Sigma-Aldrich, 20 mM), Bafilomycin A1 (Alfa Aesar, J61835, 10 nM-100nM), Ammonium Chloride (Sigma-Aldrich, A9434, 10 mM), DMOG (Sigma- Aldrich, D3695, 0.5 mM), Chloroquine (Sigma-Aldrich, C6628, 50 mM), DFO (Sigma-Aldrich, D9533, 100 mM). Puromycin, Hygromycin, and Blasticidin were purchased from Cambridge Bioscience (all used at 10 mg/ml). ProLong Gold Antifade Reagent with DAPI (8961, Cell signaling technology, 8961). Plasmids The following plasmids were used. LentiCRISPR v2 (sgRNA/Cas9, F. Zhang Addgene #52961), pHRSIN-pSFFV-FLAG-MPP8-pPGK-Blasto (Gift from Paul Lehner), TMEM199 Image Clone (Source Bioscience). CCDC115 Image Clone (Source Bioscience), pHRSIN-pSFFV-HA-Ube2J2 -pPGK-Puro (gift from Paul Lehner). pMD.G (Lentiviral VSVG), pMD.GagPol (lentiviral Gag/Pol). Lentiviral plas- mids used the pHRSIN backbone (Demaison et al., 2002). The HIF1a-GFPODD reporter was gener- ated as described (Burr et al., 2016). The HIF1a-mCherryODD reporter was generated by excising the GFP and subcloning mCherry CL1 using the BamHI and NotI restriction sites. Tfnr-phl was a gift from Christien Merrifield (Merrifield et al., 2005). Forward genetic screen and bioinformatic analyses The KBM7 forward genetic screen was carried out as previously described (Burr et al., 2016). Bioin- formatic pathway analyses were performed by taking genes enriched for trapping insertions with an adjusted Fisher Exact test p-value<0.1 and running an ’express analysis’ using Metascape 1.0 (Tripathi et al., 2015). All statistically enriched terms were identified (accumulative hypergeometric p-values and enrichment factors were calculated and used for filtering), and were hierarchically clus- tered into a tree based on Kappa-statistical similarities among their gene memberships. Then 0.3 kappa score was applied as the threshold to cast the tree into term clusters. We selected a term Figure 9 continued measured by immunoblot. (E–G) HEK293T cells (E), human dermal fibroblasts (F) and RCC10 VHL null and VHL reconstituted cells (G) were treated with BafA (10 nM) with or without the addition of 50 mM iron citrate (Fe(III)). HIF1a levels were visualised by immunoblot. b-actin served as a loading control. (H) HeLa cells were treated with 20 mM MG132 for 2 hr or 10 nM BafA for 24 hr with or without the addition of 50 mM iron citrate. (I) EGFR degradation assay for BafA treated cells following iron treatment. HeLa cells were cultured with 10 nM BafA for 24 hr, with or without 50 mM iron citrate (Fe(III)), and stimulated with EGF as previously described. EGFR, NCOA4, and ferritin (FTH1) levels were visualised by immunoblot. b-actin was used as a loading control. (J) RT-qPCR analysis of HIF1a and its target genes in response to BafA and iron citrate treatment (n  2). (K–M) Populations of mixed CRISPR KO cells for ATP6V1A1 (K), TMEM199 (L) and CCDC115 (M) were treated with 50 mM iron citrate for 24 hr and HIF1a levels measured by immunoblot. Values are mean±SEM. *p<0.05, **p<0.01. NS = not significant. DOI: 10.7554/eLife.22693.012 Miles et al. eLife 2017;6:e22693. DOI: 10.7554/eLife.22693 20 of 28 Research article Biochemistry Cell Biology Figure 10. Disrupting transferrin uptake leads to iron-dependent HIF1 activation. (A) The effect of iron treatment on HIF1a stabilisation in the presence or absence of BafA. HeLa cells were treated with 50 mM iron citrate (red) or 10 nM BafA (blue) for the indicated times and HIF1a levels measured by immunoblot. b-actin served as a loading control. (B–E) The effect of NCOA4 or IRP2 depletion on HIF1a levels and intracellular iron levels. HIF1a- GFPODD reporter HeLa cells were transduced with Cas9 and sgRNAs to NCOA4 (B, C) or IRP2 (D, E) and HIF1a levels measured by GFP accumulation Figure 10 continued on next page Miles et al. eLife 2017;6:e22693. DOI: 10.7554/eLife.22693 21 of 28 Research article Biochemistry Cell Biology with the best p-value as the representative term for each cluster and show the p-values of all clusters in a bar graph. Structures of CCDC115 and Vma22p were predicted using the Protein Homology/Analogy Rec- ognition Engine v2.0 (Phyre2) (Kelley et al., 2015). These were then imported into the PyMOL Molecular Graphics System (Schro¨dinger LLC). Images were rendered using the ‘cartoon’ function and aligned using the ‘align’ function. Lentiviral production and transduction Lentivirus was prepared by transfection using Mirus Trans-IT293 Transfection Reagent in Hek293ET cells. Cells were triple transfected with pMD.G (VSVG envelope), the suitable lentiviral transgene vector and pCMVR8.91 (gag/pol) at a ratio 2:3:4. Transfection was performed in six well plates at 70–80% confluency. The resultant viral supernatant was harvested at 48 hr, filtered through a 0.45 mm filter and stored at 80˚C. To achieve stable integration by transduction, cells were seeded to 24 well plates in 500 ml DMEM. Viral supernatant (500 ml) was added to each well and plates spun at 1800 rpm for 1 hr at 37˚C. Plates were incubated post spin and selected for antibiotic resistance after 48 hr. Flow cytometry Cells were harvested, washed in PBS before fixing in 1% paraformaldehyde, PBS and analysed on a FACSCalibur (BD). For FACS, cells were harvested, washed in 10 mM Hepes PBS and re-suspended in sorting medium (10 mM Hepes, 2% FCS, PBS). Cell suspensions were filtered prior to sorting in a High speed Influx Cell Sorter (BD Biosciences). For cell surface staining, cells were washed in PBS and incubated with the appropriate primary antibody for 30 min at 4˚C. After a further PBS wash the cells were incubated with secondary antibody for 30 min at 4˚C. A final PBS wash was performed and cells were fixed in PBS with 1% paraformaldehyde (PFA) and analysed as described. CRISPR-Cas9 targeted deletions Gene-specific CRISPR sgRNA oligonucleotide sequences were selected using the GeCKO v2 library. Sense and antisense sgRNAs oligonucleotides were designed with 5’ CACC and 3’ CAAA overhangs respectively. The subsequent sgRNAs were cloned into the LentiCRISPRv2 backbone (Sanjana et al., 2014) or pKLV-U6gRNA(BbsI)-PGKpuro2ABFP. The following sgRNAs were used: TMEM199 TATGGCGTCCTCTTTGCTTG ATP6V0D1 TCGATGACTGACACCGTCAG ATP6AP1 GCTGACTGCATACCAGTCGA ATP6V1A1 GTAACTTACATTGCTCCACC ATP6V0A2 GCGACACTCACGTCTCGGAAC ATP6V1G1 GTGAAAACAGGAAAGAACCG Figure 10 continued (B, D) top) and immunoblot after 8 (IRP2) or 12 days (NCOA4) (C, E). Cell surface transferrin levels were measured by flow cytometry (B, D) bottom). IRP2 and ferritin (FTH1) levels were visualised by immunoblot (C, E). An sgRNA to PHD2 was used as a control. (F) HIF1 activation following depletion of the transferrin receptor. HIF1a-GFPODD reporter HeLa cells were transduced with Cas9 and sgRNAs to the transferrin receptor. HIF1 activation was measured by GFP accumulation and cell surface expression of CA9 (top). Depletion of the transferrin receptor was measured by flow cytometry (bottom) (G, H) Iron reconstitution restores HIF1a turnover in transferrin receptor deficient cells. HIF1a-GFPODD reporter HeLa cells were transduced with Cas9 and sgRNAs to the transferrin receptor as described, and 50 mM ferrous citrate added to media for 24 hr. HIF1a levels were measured by flow cytometry for GFP fluorescence (G) or immunoblot (H). IRP2, NCOA4 and FTH1 were visualised to measure intracellular iron. b-actin served as a loading control. Additional experimental examples with alternative sgRNAs to NCOA4, IRP2 or the transferrin receptor are shown in Figure 10—figure supplement 1. TFR=transferrin receptor. DOI: 10.7554/eLife.22693.013 The following figure supplement is available for figure 10: Figure supplement 1. Disrupting transferrin uptake leads to iron-dependent HIF1 activation. DOI: 10.7554/eLife.22693.014 Miles et al. eLife 2017;6:e22693. DOI: 10.7554/eLife.22693 22 of 28 Research article Biochemistry Cell Biology B2M GGCCGAGATGTCTCGCTCCG PHD2 ATGCCGTGCTTGTTCATGCA CCDC115 GGGGGCTCACCTGCTTCGCG HSC70 sgRNA1 ACCATAGAAGACACCTCCTC HSC70 sgRNA2 CTAGACTGTTACCAATGCTG HSC70 sgRNA 3 GACAGATGCCAAACGTCTGAT LAMP2A sgRNA1 ACCAGAACGAGCCCTGAGCC LAMP2A sgRNA2 TCCGGGCTCAGGGCTCGTTC LAMP2A sgRNA3 CAAGAACATCCCAGTAGTGT NCOA4 sgRNA1 GGTATGGCTGTATGAACAGG NCOA4 sgRNA2 CAATCTCCACACCTTTGGGC NCOA4 sgRNA3 TAGCTGTCCCTTTCAGCGAA IRP2 sgRNA1 AATGCACCAAATCCTGGAGG IRP2 sgRNA2 TGAGCCATTCCAGTTCCAGG IRP2 sgRNA3 GCATAAGCTACCACTAAGGG Transferrin Receptor sgRNA1 AAAGTCTCCAGCACTCCAAC Transferrin Receptor sgRNA2 GCTCTGGAGATTGTCTGGAC siRNA-mediated depletion 100 nM HSC70 siRNA (Dharmacon Smartpool, L-017609-00-0005) or MISSION siRNA Universal Neg- ative Control (control) was transfected into 3  105 HeLa cells using Oligofectamine Transfection Reagent (Invitrogen) according to the manufacturer’s protocol. Cells were harvested after 96 hr for further analysis by immunoblot. Immunofluorescence Cells were cultured on glass coverslips, washed in PBS and fixed in 4% (w/v) PFA, PBS at room tem- perature for 20 min. Cells were then blocked and permeabilised in 3% BSA, 0.3% TritonX-100, PBS. For observing endosomal compartments, cells were permeabilised in 3% BSA, 0.05% Saponin, PBS. Coverslips were incubated with primary antibody for 1 hr, washed in PBS and fluorophore-conju- gated secondary antibodies applied for 30 min. Coverslips were mounted to microscope slides using ProLong Gold antifade with DAPI. Imaging was performed on a Zeiss LSM880 inverted confocal microscope. Cytoplasmic colocalisation analyses of stains were performed using CellProfiler image analysis software (Carpenter et al., 2006). The analysis was performed blinded. Nuclear and cell boundaries were identified manually, with the area between the nuclear and cell peripheries classified as the cytoplasm. The ‘Measure Correlation’ module was used to calculate the Pearson’s Correlation Coef- ficient between the pixel intensities for the described stains. For the Tfnr-phl experiments, wildtype or HIF1a-mCherryODD reporter HeLa cells were trans- fected with TfR-pHluorin using TransIT-HeLaMONSTER Transfection kit (Mirus Bio LLC) according to manufacturer’s protocol. To perform fixed cell immunofluorescence, cells were cultured on glass cov- erslips, washed in PBS and fixed in 4% (w/v) PFA, PBS as previously described. Cells were permeabi- lised in PBS with 3% BSA, 0.05% Saponin, and coverslips mounted to microscope slides using ProLong Gold antifade with DAPI. Imaging was performed on a Zeiss LSM880 confocal microscope. Live cell imaging was performed on a Zeiss LSM780 inverted confocal microscope equipped with a 63x objective. To examine Tfnr-phl localization cells were treated with or without 10 nM BafA for 24 hr prior to imaging. pH clamping was performed during live cell imaging by incubating cells with 25 mM sodium acetate buffer (pH 5), 25 mM MES buffer (pH 6) and 25 mM Hepes buffer (pH 7) con- taining 5 mM NaCl, 1 mM CaCl2, 115 mM KCl, 1.2 mM MgSO4, 10 mM glucose, 10 mM nigericin and 10 mM monensin for 5 min at 37˚C as previously described (Bright et al., 2016). Fluorescence inten- sity measurements of Tfnr-phl were performed using CellProfiler image analysis software (Carpenter et al., 2006). The analysis was performed blinded. Cell surface and cytoplasmic Miles et al. eLife 2017;6:e22693. DOI: 10.7554/eLife.22693 23 of 28 Research article Biochemistry Cell Biology boundaries were identified manually and the ratio between cytoplasmic fluorescent intensity and whole cell fluorescence was calculated. Immunoblotting Cells were lysed in SDS lysis buffer (1% SDS, 50 mM Tris pH7.4, 150 mM NaCl, 10% glycerol and 5ml/ml benzonase nuclease) for 10 min on ice, heated at 90˚C for 5 min and centrifuged at 14,000 rpm for 10 min. Proteins were separated by SDS-PAGE, transferred to methanol activated Immobi- lon-P 0.45 mm PVDF membrane, probed with appropriate primary and secondary antibodies, and developed using SuperSignal West Pico or Dura Chemiluminescent Substrates (Thermo Scientific). Membrane fractionation HeLa cells (3  106) were harvested, washed and resuspended in 1 ml break buffer (20 mM Hepes pH7.4, 1 mM EDTA, 0.5 mM MgCl2, 0.13 M sucrose, 50 mM NaCl, 1 mM PMSF supplemented with Roche complete EDTA free protease inhibitors), and passed through an equilibrated ball bearing homogenizer at 1 mm diameter for 20 passes. The homogenized lysate was collected and centri- fuged at 3000 rpm for 10 min to pellet nuclei. The post nuclear supernatant was ultracentrifuged at 50,000 rpm for 1 hr to pellet intracellular membranes before resuspension in SDS loading buffer for separation by SDS-PAGE and immunoblot. EGFR degradation assay This assay was performed as previously described (Almeida et al., 2006), with some modifications. HeLa cells were cultured in the presence or absence of BafA on six well plates prior to serum starva- tion for 90 min in DMEM supplemented with 2% FCS and cyclohexamide (100 mg/ml). Following star- vation, cells remained in 2% FCS and were stimulated with 100 ng/ml EGF (Cabiochem). The reaction proceeded for 0, 10, 45, 90 and 180 min until quenched on ice. The cells were washed in ice cold PBS and lysed on ice in SDS lysis buffer. EGFR expression levels were probed by immunoblotting. Immunoprecipitation and mass spectrometry coupled immunoprecipitation HeLa cells (5  106) were lysed in 1% NP-40, TBS supplemented with 1x Roche cOmplete EDTA-free protease inhibitor cocktail for 30 min at 4˚C before centrifugation at 14,000 rpm for 10 min. The supernatants were then diluted to 0.1% detergent and pre-cleared with SP sepharose Fast-Flow (GE Healthcare) for 1 hr. The pre-cleared supernatant was incubated with 40 ml anti-FLAG M2 magnetic beads (M8823, Sigma Aldrich) for 3 hr at 4˚C. The resins were then washed and the bound proteins eluted with 100 mg/ml FLAG peptide (30 min). The eluted proteins were then separated by SDS- PAGE and immunoblotted as described. For mass spectrometry analysis of TMEM199 associated proteins, wildtype or TMEM199 KO HeLa cells (1  108) were immunoprecipitated with the TMEM199 antibody conjugated to Dynabeads Pro- tein G for 3 hr at 4˚C. The resins were then washed and sample eluted with SDS lysis buffer at 70˚C for 10 min. Samples were resolved a short distance into an SDS-polyacrylamide gel, the lanes excised and subjected to in-gel tryptic digestion. The resulting peptides were analysed using a Q Exactive (Thermo Scientific) coupled to an RSLC3000nano UPLC (Thermo Scientific). Files were searched against a Uniprot human database (downloaded 09/06/14, 20,264 entries) using Mascot with peptide and protein validation performed in Scaffold. Quantitative real-time PCR Total cellular RNA was isolated and purified using the Qiagen RNeasy Plus Mini Kit (Qiagen, UK) according to manufacturer’s protocol followed by reverse transcription using SuperRT (HT Biotech- nology Ltd). PCR reactions (15 ml) were prepared using SYBR Green PCR Master Mix (Applied Bio- systems) with 125 ng starting cDNA template. The reaction proceeded in an ABI 7900 HT Real-Time PCR system (Applied Biosystems) and the resultant Ct values were normalized to housekeeping genes (GAPDH and RPS2). The following primers were used: GAPDH F:ATGGGGAAGGTGAAGGTCG R: CTCCACGACGTACTCAGCG HIF1a F: CCAGTTACGTTCCTTCGATCAGT R: TTTGAGGACTTGCGCTTTCA Miles et al. eLife 2017;6:e22693. DOI: 10.7554/eLife.22693 24 of 28 Research article Biochemistry Cell Biology GLUT1 F: TGGCATGGCGGGTTGT R: CCAGGGTAGCTGCTCCAGC VEGF F: TGCCAAGTGGTCCCAG R: GTGAGGTTTGATCCGC In vitro hydroxylation assay Prolyl hydroxylation of the HIF1aODD protein was performed as described in Burr et al. (2016). Briefly, the hydroxylation assay was performed by incubating 10 mM HIF1aODD with 50 ml HeLa cell extract for 15 min at 37˚C. The reaction was stopped by addition of SDS loading buffer, and the pro- teins separated by SDS-PAGE. Hydroxylation was measured using the HIF prolyl hydroxylation spe- cific antibody. Measurements of HIF1a hydroxylation following the addition of Fe(II) were performed similarly, except the lysate was pre-incubated with iron chloride for 10 min at 4˚C before the addition of the HIF1aODD protein. Statistical analyses Data were expressed as mean ± s.e.m. and P values were calculated using two-tailed Student’s t-test for pairwise comparisons, unless otherwise stated. The cytofluorometric colocalisation studies were analysed as described and performed blinded. No statistical method or power analysis was used to predetermine sample size. Acknowledgements ALM, SPB, GLG and JAN designed the studies and performed the experiments. ALM, SPB and JAN wrote the manuscript. We thank Ian Lobb for assistance with quantification of the fluorescence microscopy and generating the HIF1a-mCherryODD construct, and Peter Sterk with the bioinformat- ics analysis. We also thank Paul Luzio, Nick Bright, Luther Davis, Symeon Siniossoglou, and the Nathan laboratory for their helpful discussions. This work was supported by a Wellcome Trust Senior Clinical Research Fellowship to JAN (102770/Z/13/Z), and an MRC Award to ALM (MR/K50127X/1). The Cambridge Institute for Medical Research is in receipt of a Wellcome Trust Strategic Award (100140). Additional information Funding Funder Grant reference number Author Wellcome 102770/Z/13/Z Stephen P Burr Guinevere L Grice James A Nathan Medical Research Council MR/K50127X/1 Anna L Miles James A Nathan The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication. Author contributions ALM, SPB, Conceptualization, Data curation, Formal analysis, Validation, Investigation, Visualization, Methodology, Writing—original draft, Project administration, Writing—review and editing; GLG, Val- idation, Investigation, Visualization, Methodology; JAN, Conceptualization, Resources, Data cura- tion, Formal analysis, Supervision, Funding acquisition, Investigation, Writing—original draft, Project administration, Writing—review and editing Author ORCIDs James A Nathan, http://orcid.org/0000-0002-0248-1632 Miles et al. eLife 2017;6:e22693. DOI: 10.7554/eLife.22693 25 of 28 Research article Biochemistry Cell Biology Additional files Supplementary files . Supplemental file 1. List of genes enriched in the KMB7 genetic screen ranked according to biolog- ical process and function. DOI: 10.7554/eLife.22693.015 References Alexandru G, Graumann J, Smith GT, Kolawa NJ, Fang R, Deshaies RJ. 2008. UBXD7 binds multiple ubiquitin ligases and implicates p97 in HIF1alpha turnover. Cell 134:804–816. doi: 10.1016/j.cell.2008.06.048, PMID: 1 8775313 Almeida CG, Takahashi RH, Gouras GK. 2006. Beta-amyloid accumulation impairs multivesicular body sorting by inhibiting the ubiquitin-proteasome system. Journal of Neuroscience 26:4277–4288. doi: 10.1523/JNEUROSCI. 5078-05.2006, PMID: 16624948 Berra E, Roux D, Richard DE, Pouysse´gur J. 2001. Hypoxia-inducible factor-1 alpha (HIF-1 alpha) escapes O(2)- driven proteasomal degradation irrespective of its subcellular localization: nucleus or cytoplasm. EMBO Reports 2:615–620. doi: 10.1093/embo-reports/kve130, PMID: 11454738 Bertout JA, Majmundar AJ, Gordan JD, Lam JC, Ditsworth D, Keith B, Brown EJ, Nathanson KL, Simon MC. 2009. HIF2alpha inhibition promotes p53 pathway activity, tumor cell death, and radiation responses. PNAS 106:14391–14396. doi: 10.1073/pnas.0907357106, PMID: 19706526 Bondeson DP, Mares A, Smith IE, Ko E, Campos S, Miah AH, Mulholland KE, Routly N, Buckley DL, Gustafson JL, Zinn N, Grandi P, Shimamura S, Bergamini G, Faelth-Savitski M, Bantscheff M, Cox C, Gordon DA, Willard RR, Flanagan JJ, et al. 2015. Catalytic in vivo protein knockdown by small-molecule PROTACs. Nature Chemical Biology 11:611–617. doi: 10.1038/nchembio.1858, PMID: 26075522 Bremm A, Moniz S, Mader J, Rocha S, Komander D. 2014. Cezanne (OTUD7B) regulates HIF-1a homeostasis in a proteasome-independent manner. EMBO Reports 15:1268–1277. doi: 10.15252/embr.201438850, PMID: 25355043 Bright NA, Davis LJ, Luzio JP. 2016. Endolysosomes are the principal intracellular sites of acid hydrolase activity. Current Biology 26:2233–2245. doi: 10.1016/j.cub.2016.06.046, PMID: 27498570 Bruick RK, McKnight SL. 2001. A conserved family of prolyl-4-hydroxylases that modify HIF. Science 294:1337– 1340. doi: 10.1126/science.1066373, PMID: 11598268 Burr SP, Costa AS, Grice GL, Timms RT, Lobb IT, Freisinger P, Dodd RB, Dougan G, Lehner PJ, Frezza C, Nathan JA. 2016. Mitochondrial protein lipoylation and the 2-Oxoglutarate dehydrogenase complex controls HIF1a stability in aerobic conditions. Cell Metabolism 24:740–752. doi: 10.1016/j.cmet.2016.09.015, PMID: 27923773 Capecci J, Forgac M. 2013. The function of vacuolar ATPase (V-ATPase) a subunit isoforms in invasiveness of MCF10a and MCF10CA1a human breast Cancer cells. Journal of Biological Chemistry 288:32731–32741. doi: 10.1074/jbc.M113.503771, PMID: 24072707 Carpenter AE, Jones TR, Lamprecht MR, Clarke C, Kang IH, Friman O, Guertin DA, Chang JH, Lindquist RA, Moffat J, Golland P, Sabatini DM. 2006. CellProfiler: image analysis software for identifying and quantifying cell phenotypes. Genome Biology 7:R100. doi: 10.1186/gb-2006-7-10-r100, PMID: 17076895 Coscoy L, Ganem D. 2000. Kaposi’s sarcoma-associated herpesvirus encodes two proteins that block cell surface display of MHC class I chains by enhancing their endocytosis. PNAS 97:8051–8056. doi: 10.1073/pnas. 140129797, PMID: 10859362 Dautry-Varsat A, Ciechanover A, Lodish HF. 1983. pH and the recycling of transferrin during receptor-mediated endocytosis. PNAS 80:2258–2262. doi: 10.1073/pnas.80.8.2258, PMID: 6300903 Demaison C, Parsley K, Brouns G, Scherr M, Battmer K, Kinnon C, Grez M, Thrasher AJ. 2002. High-level transduction and gene expression in hematopoietic repopulating cells using a human immunodeficiency [correction of imunodeficiency] virus type 1-based lentiviral vector containing an internal spleen focus forming virus promoter. Human Gene Therapy 13:803–813. doi: 10.1089/10430340252898984, PMID: 11975847 Eckenroth BE, Steere AN, Chasteen ND, Everse SJ, Mason AB. 2011. How the binding of human transferrin primes the transferrin receptor potentiating iron release at endosomal pH. PNAS 108:13089–13094. doi: 10. 1073/pnas.1105786108, PMID: 21788477 Epstein AC, Gleadle JM, McNeill LA, Hewitson KS, O’Rourke J, Mole DR, Mukherji M, Metzen E, Wilson MI, Dhanda A, Tian YM, Masson N, Hamilton DL, Jaakkola P, Barstead R, Hodgkin J, Maxwell PH, Pugh CW, Schofield CJ, Ratcliffe PJ. 2001. C. elegans EGL-9 and mammalian homologs define a family of dioxygenases that regulate HIF by prolyl hydroxylation. Cell 107:43–54. doi: 10.1016/S0092-8674(01)00507-4, PMID: 115951 84 Ferreira JV, Foˆfo H, Bejarano E, Bento CF, Ramalho JS, Gira˜o H, Pereira P. 2013. STUB1/CHIP is required for HIF1A degradation by chaperone-mediated autophagy. Autophagy 9:1349–1366. doi: 10.4161/auto.25190, PMID: 23880665 Ferreira JV, Soares AR, Ramalho JS, Pereira P, Girao H. 2015. K63 linked ubiquitin chain formation is a signal for HIF1A degradation by Chaperone-Mediated autophagy. Scientific Reports 5:10210. doi: 10.1038/srep10210, PMID: 25958982 Miles et al. eLife 2017;6:e22693. DOI: 10.7554/eLife.22693 26 of 28 Research article Biochemistry Cell Biology Graham LA, Hill KJ, Stevens TH. 1998. Assembly of the yeast vacuolar H+-ATPase occurs in the endoplasmic reticulum and requires a Vma12p/Vma22p assembly complex. The Journal of Cell Biology 142:39–49. doi: 10. 1083/jcb.142.1.39, PMID: 9660861 Hewitt EW, Duncan L, Mufti D, Baker J, Stevenson PG, Lehner PJ. 2002. Ubiquitylation of MHC class I by the K3 viral protein signals internalization and TSG101-dependent degradation. The EMBO Journal 21:2418–2429. doi: 10.1093/emboj/21.10.2418, PMID: 12006494 Hill KJ, Stevens TH. 1995. Vma22p is a novel endoplasmic reticulum-associated protein required for assembly of the yeast vacuolar H(+)-ATPase complex. Journal of Biological Chemistry 270:22329–22336. doi: 10.1074/jbc. 270.38.22329, PMID: 7673216 Hirata R, Umemoto N, Ho MN, Ohya Y, Stevens TH, Anraku Y. 1993. VMA12 is essential for assembly of the vacuolar H(+)-ATPase subunits onto the vacuolar membrane in Saccharomyces cerevisiae. The Journal of Biological Chemistry 268:961–967. PMID: 8419376 Hubbi ME, Hu H, Kshitiz, Ahmed I, Levchenko A, Semenza GL. 2013. Chaperone-mediated autophagy targets hypoxia-inducible factor-1a (HIF-1a) for lysosomal degradation. Journal of Biological Chemistry 288:10703– 10714. doi: 10.1074/jbc.M112.414771, PMID: 23457305 Hubbi ME, Gilkes DM, Hu H, Kshitiz, Ahmed I, Semenza GL. 2014. Cyclin-dependent kinases regulate lysosomal degradation of hypoxia-inducible factor 1a to promote cell-cycle progression. PNAS 111:E3325–E3334. doi: 10.1073/pnas.1412840111, PMID: 25071185 Ishido S, Wang C, Lee BS, Cohen GB, Jung JU. 2000. Downregulation of major histocompatibility complex class I molecules by kaposi’s sarcoma-associated herpesvirus K3 and K5 proteins. Journal of Virology 74:5300–5309. doi: 10.1128/JVI.74.11.5300-5309.2000, PMID: 10799607 Iwai K, Klausner RD, Rouault TA. 1995. Requirements for iron-regulated degradation of the RNA binding protein, iron regulatory protein 2. The EMBO Journal 14:5350–5357. PMID: 7489724 Jaakkola P, Mole DR, Tian YM, Wilson MI, Gielbert J, Gaskell SJ, von Kriegsheim A, Hebestreit HF, Mukherji M, Schofield CJ, Maxwell PH, Pugh CW, Ratcliffe PJ. 2001. Targeting of HIF-alpha to the von Hippel-Lindau ubiquitylation complex by O2-regulated prolyl hydroxylation. Science 292:468–472. doi: 10.1126/science. 1059796, PMID: 11292861 Jansen EJ, Timal S, Ryan M, Ashikov A, van Scherpenzeel M, Graham LA, Mandel H, Hoischen A, Iancu TC, Raymond K, Steenbergen G, Gilissen C, Huijben K, van Bakel NH, Maeda Y, Rodenburg RJ, Adamowicz M, Crushell E, Koenen H, Adams D, et al. 2016a. ATP6AP1 deficiency causes an immunodeficiency with hepatopathy, cognitive impairment and abnormal protein glycosylation. Nature Communications 7:11600. doi: 10.1038/ncomms11600, PMID: 27231034 Jansen JC, Cirak S, van Scherpenzeel M, Timal S, Reunert J, Rust S, Pe´rez B, Vicogne D, Krawitz P, Wada Y, Ashikov A, Pe´rez-Cerda´ C, Medrano C, Arnoldy A, Hoischen A, Huijben K, Steenbergen G, Quelhas D, Diogo L, Rymen D, et al. 2016b. CCDC115 deficiency causes a disorder of golgi homeostasis with abnormal protein glycosylation. The American Journal of Human Genetics 98:310–321. doi: 10.1016/j.ajhg.2015.12.010, PMID: 26 833332 Jansen JC, Timal S, van Scherpenzeel M, Michelakakis H, Vicogne D, Ashikov A, Moraitou M, Hoischen A, Huijben K, Steenbergen G, van den Boogert MA, Porta F, Calvo PL, Mavrikou M, Cenacchi G, van den Bogaart G, Salomon J, Holleboom AG, Rodenburg RJ, Drenth JP, et al. 2016c. TMEM199 deficiency is a disorder of golgi homeostasis characterized by elevated aminotransferases, alkaline phosphatase, and cholesterol and abnormal glycosylation. The American Journal of Human Genetics 98:322–330. doi: 10.1016/j.ajhg.2015.12. 011, PMID: 26833330 Karet FE, Finberg KE, Nayir A, Bakkaloglu A, Ozen S, Hulton SA, Sanjad SA, Al-Sabban EA, Medina JF, Lifton RP. 1999. Localization of a gene for autosomal recessive distal renal tubular acidosis with normal hearing (rdRTA2) to 7q33-34. The American Journal of Human Genetics 65:1656–1665. doi: 10.1086/302679, PMID: 10577919 Kelley LA, Mezulis S, Yates CM, Wass MN, Sternberg MJ. 2015. The Phyre2 web portal for protein modeling, prediction and analysis. Nature Protocols 10:845–858. doi: 10.1038/nprot.2015.053, PMID: 25950237 Kornak U, Schulz A, Friedrich W, Uhlhaas S, Kremens B, Voit T, Hasan C, Bode U, Jentsch TJ, Kubisch C. 2000. Mutations in the a3 subunit of the vacuolar H(+)-ATPase cause infantile malignant osteopetrosis. Human Molecular Genetics 9:2059–2063. doi: 10.1093/hmg/9.13.2059, PMID: 10942435 Kozik P, Hodson NA, Sahlender DA, Simecek N, Soromani C, Wu J, Collinson LM, Robinson MS. 2013. A human genome-wide screen for regulators of clathrin-coated vesicle formation reveals an unexpected role for the V-ATPase. Nature Cell Biology 15:50–60. doi: 10.1038/ncb2652, PMID: 23263279 Lim JH, Park JW, Kim MS, Park SK, Johnson RS, Chun YS. 2006. Bafilomycin induces the p21-mediated growth inhibition of Cancer cells under hypoxic conditions by expressing hypoxia-inducible factor-1alpha. Molecular Pharmacology 70:1856–1865. doi: 10.1124/mol.106.028076, PMID: 16940187 Lim JH, Park JW, Kim SJ, Kim MS, Park SK, Johnson RS, Chun YS. 2007. ATP6V0C competes with von Hippel- Lindau protein in hypoxia-inducible factor 1alpha (HIF-1alpha) binding and mediates HIF-1alpha expression by bafilomycin A1. Molecular Pharmacology 71:942–948. doi: 10.1124/mol.106.030296, PMID: 17178925 Liuzzi JP, Aydemir F, Nam H, Knutson MD, Cousins RJ. 2006. Zip14 (Slc39a14) mediates non-transferrin-bound iron uptake into cells. PNAS 103:13612–13617. doi: 10.1073/pnas.0606424103, PMID: 16950869 Mancias JD, Wang X, Gygi SP, Harper JW, Kimmelman AC. 2014. Quantitative proteomics identifies NCOA4 as the cargo receptor mediating ferritinophagy. Nature 509:105–109. doi: 10.1038/nature13148, PMID: 24695223 Maxfield FR, McGraw TE. 2004. Endocytic recycling. Nature Reviews Molecular Cell Biology 5:121–132. doi: 10. 1038/nrm1315, PMID: 15040445 Miles et al. eLife 2017;6:e22693. DOI: 10.7554/eLife.22693 27 of 28 Research article Biochemistry Cell Biology Maxson ME, Grinstein S. 2014. The vacuolar-type H+-ATPase at a glance - more than a proton pump. Journal of Cell Science 127:4987–4993. doi: 10.1242/jcs.158550, PMID: 25453113 Maxwell PH, Wiesener MS, Chang GW, Clifford SC, Vaux EC, Cockman ME, Wykoff CC, Pugh CW, Maher ER, Ratcliffe PJ. 1999. The tumour suppressor protein VHL targets hypoxia-inducible factors for oxygen-dependent proteolysis. Nature 399:271–275. doi: 10.1038/20459, PMID: 10353251 Merrifield CJ, Perrais D, Zenisek D. 2005. Coupling between clathrin-coated-pit invagination, cortactin recruitment, and membrane scission observed in live cells. Cell 121:593–606. doi: 10.1016/j.cell.2005.03.015, PMID: 15907472 Mizuno E, Iura T, Mukai A, Yoshimori T, Kitamura N, Komada M. 2005. Regulation of epidermal growth factor receptor down-regulation by UBPY-mediated deubiquitination at endosomes. Molecular Biology of the Cell 16: 5163–5174. doi: 10.1091/mbc.E05-06-0560, PMID: 16120644 Ohgami RS, Campagna DR, Greer EL, Antiochos B, McDonald A, Chen J, Sharp JJ, Fujiwara Y, Barker JE, Fleming MD. 2005. Identification of a ferrireductase required for efficient transferrin-dependent iron uptake in erythroid cells. Nature Genetics 37:1264–1269. doi: 10.1038/ng1658, PMID: 16227996 Oudit GY, Trivieri MG, Khaper N, Liu PP, Backx PH. 2006. Role of L-type Ca2+ channels in iron transport and iron-overload cardiomyopathy. Journal of Molecular Medicine 84:349–364. doi: 10.1007/s00109-005-0029-x, PMID: 16604332 Pantopoulos K, Porwal SK, Tartakoff A, Devireddy L. 2012. Mechanisms of mammalian iron homeostasis. Biochemistry 51:5705–5724. doi: 10.1021/bi300752r, PMID: 22703180 Perut F, Avnet S, Fotia C, Baglı`o SR, Salerno M, Hosogi S, Kusuzaki K, Baldini N. 2014. V-ATPase as an effective therapeutic target for sarcomas. Experimental Cell Research 320:21–32. doi: 10.1016/j.yexcr.2013.10.011, PMID: 24416789 Peyssonnaux C, Nizet V, Johnson RS. 2008. Role of the hypoxia inducible factors HIF in iron metabolism. Cell Cycle 7:28–32. doi: 10.4161/cc.7.1.5145, PMID: 18212530 Ramachandran N, Munteanu I, Wang P, Ruggieri A, Rilstone JJ, Israelian N, Naranian T, Paroutis P, Guo R, Ren ZP, Nishino I, Chabrol B, Pellissier JF, Minetti C, Udd B, Fardeau M, Tailor CS, Mahuran DJ, Kissel JT, Kalimo H, et al. 2013. VMA21 deficiency prevents vacuolar ATPase assembly and causes autophagic vacuolar myopathy. Acta Neuropathologica 125:439–457. doi: 10.1007/s00401-012-1073-6, PMID: 23315026 Salahudeen AA, Thompson JW, Ruiz JC, Ma HW, Kinch LN, Li Q, Grishin NV, Bruick RK. 2009. An E3 ligase possessing an iron-responsive hemerythrin domain is a regulator of iron homeostasis. Science 326:722–726. doi: 10.1126/science.1176326, PMID: 19762597 Sanjana NE, Shalem O, Zhang F. 2014. Improved vectors and genome-wide libraries for CRISPR screening. Nature Methods 11:783–784. doi: 10.1038/nmeth.3047, PMID: 25075903 Selfridge AC, Cavadas MA, Scholz CC, Campbell EL, Welch LC, Lecuona E, Colgan SP, Barrett KE, Sporn PH, Sznajder JI, Cummins EP, Taylor CT. 2016. Hypercapnia suppresses the HIF-dependent adaptive response to hypoxia. Journal of Biological Chemistry 291:11800–11808. doi: 10.1074/jbc.M116.713941, PMID: 27044749 Simpson RJ, McKie AT. 2015. Iron and oxygen sensing: a tale of 2 interacting elements? Metallomics 7:223–231. doi: 10.1039/C4MT00225C, PMID: 25385426 Smith AN, Skaug J, Choate KA, Nayir A, Bakkaloglu A, Ozen S, Hulton SA, Sanjad SA, Al-Sabban EA, Lifton RP, Scherer SW, Karet FE. 2000. Mutations in ATP6N1B, encoding a new kidney vacuolar proton pump 116-kD subunit, cause recessive distal renal tubular acidosis with preserved hearing. Nature Genetics 26:388–389. doi: 10.1038/82492, PMID: 10973252 Straud S, Zubovych I, De Brabander JK, Roth MG. 2010. Inhibition of iron uptake is responsible for differential sensitivity to V-ATPase inhibitors in several Cancer cell lines. PLoS One 5:e11629. doi: 10.1371/journal.pone. 0011629, PMID: 20661293 Tripathi S, Pohl MO, Zhou Y, Rodriguez-Frandsen A, Wang G, Stein DA, Moulton HM, DeJesus P, Che J, Mulder LC, Ya´ngu¨ez E, Andenmatten D, Pache L, Manicassamy B, Albrecht RA, Gonzalez MG, Nguyen Q, Brass A, Elledge S, White M, et al. 2015. Meta- and orthogonal integration of influenza "OMICs" Data Defines a Role for UBR4 in Virus Budding. Cell Host & Microbe 18:723–735. doi: 10.1016/j.chom.2015.11.002, PMID: 2665194 8 Vashisht AA, Zumbrennen KB, Huang X, Powers DN, Durazo A, Sun D, Bhaskaran N, Persson A, Uhlen M, Sangfelt O, Spruck C, Leibold EA, Wohlschlegel JA. 2009. Control of iron homeostasis by an iron-regulated ubiquitin ligase. Science 326:718–721. doi: 10.1126/science.1176333, PMID: 19762596 Wang GL, Semenza GL. 1993. Desferrioxamine induces erythropoietin gene expression and hypoxia-inducible factor 1 DNA-binding activity: implications for models of hypoxia signal transduction. Blood 82:3610–3615. PMID: 8260699 Zhdanov AV, Dmitriev RI, Papkovsky DB. 2012. Bafilomycin A1 activates HIF-dependent signalling in human Colon cancer cells via mitochondrial uncoupling. Bioscience Reports 32:587–595. doi: 10.1042/BSR20120085, PMID: 22943412 Miles et al. eLife 2017;6:e22693. DOI: 10.7554/eLife.22693 28 of 28 Research article Biochemistry Cell Biology