1     Wnt inhibition facilitates RNA-mediated reprogramming of human somatic cells to naïve pluripotency Nicholas Bredenkamp1♯, Jian Yang3,1,8♯, James Clarke1♯, Giuliano Giuseppe Stirparo1♯, Ferdinand von Meyenn4,5♯, Sabine Diemann1, Duncan Baker6, Rosalind Drummond1, Yongming Ren7, Dongwei Li3, Chuman Wu3, Maria Rostovskaya1, Sarah Eminli-Meissner7, Austin Smith1,2* and Ge Guo1* 1Wellcome–MRC Cambridge Stem Cell Institute, University of Cambridge, Cambridge, CB2  0AW, United Kingdom. 2Department of Biochemistry, University of Cambridge, Cambridge, CB2 1QW, United Kingdom 3Guangzhou Institutes of Biomedicine and Health (GIBH), Chinese Academy of Sciences, Guangzhou, China, 510530; 4Department of Medical & Molecular Genetics, King's College London, London SE1 9RT, United Kingdom 5Institute of Food, Nutrition and Health, ETH Zurich, 8603 Schwerzenbach, Switzerland 6Sheffield Diagnostic Genetic Service, Sheffield Children’s NHS Foundation Trust, S10 2TH 7REPROCELL USA, 9000 Virginia Manor Rd #207, Beltsville, MD 20705, USA 8Present address: Key Laboratory of Arrhythmias, Ministry of Education, Shanghai East Hospital, Tongji University School of Medicine, Shanghai 200120, China. *Corresponding authors: Ge Guo, gg251@ cam.ac.uk; Austin Smith, austin.smith@cscr.cam.ac.uk ♯ These five authors contributed equally to this work 2     SUMMARY In contrast to conventional human pluripotent stem cells (hPSC) that are related to post-implantation embryo stages, naïve hPSC exhibit features of pre-implantation epiblast. Naïve hPSC are established by resetting conventional hPSC, or are derived from dissociated embryo inner cell masses. Here we investigate conditions for transgene-free reprogramming of human somatic cells to naïve pluripotency. We find that Wnt inhibition promotes RNA-mediated induction of naïve pluripotency. We demonstrate application to independent human fibroblast cultures and endothelial progenitor cells. We show that induced naïve hPSC can be clonally expanded with a diploid karyotype and undergo somatic lineage differentiation following formative transition. Induced naïve hPSC lines exhibit distinctive surface marker, transcriptome, and methylome properties of naïve epiblast identity. This system for efficient, facile, and reliable induction of transgene free naïve hPSC offers a robust platform, both for delineation of human reprogramming trajectories and for evaluating the attributes of isogenic naïve versus conventional hPSC. INTRODUCTION Human pluripotent stem cells (hPSC) provide a potent resource for fundamental research into early human development and in addition hold great promise for biomedical applications. hPSC have been derived by culture of explanted human embryo inner cell masses (ICM) (O'Leary et al., 2012; Thomson et al., 1998), and by reprogramming of somatic cells (Takahashi et al., 2007; Yu et al., 2007). The precise relationship between conventional hPSC and in vivo epiblast development is uncertain, but they have diverged from ICM (Yan et al., 2013) and appear to represent a post-implantation stage approaching gastrulation (Nakamura et al., 2016). Consequently these cells are often described as primed (Nichols and Smith, 2009; Rossant and Tam, 2017). A second type of hPSC has been isolated more recently using alternative culture conditions based on inhibition of the ERK pathway (Takashima et al., 2014; Theunissen et al., 2014). These cells are termed naïve because they show similarities to the pre-implantation epiblast (Guo et al., 2016; Stirparo et al., 2018; Theunissen et al., 2016) and may be analogous to the archetypal embryonic stem cells established in mouse (Nichols and Smith, 2012; Smith, 2001). Naïve hPSC are obtained by resetting the status of conventional hPSC using transgenes (Takashima et al., 2014) or by culture manipulation (Guo et al., 3     2017; Theunissen et al., 2014). Naïve cell lines can also be established directly from embryos after dissociation of the ICM (Guo et al., 2016). Somatic cell reprogramming directed by ectopic transcription factors can generate induced pluripotency (Takahashi and Yamanaka, 2006). The canonical Yamanaka reprogramming factors yield induced pluripotent stem cells (iPSC) that in mouse are naïve, but in human are primed (Okita et al., 2007; Silva et al., 2008; Takahashi et al., 2007). This difference may be determined by the appropriateness of the culture environment for capture of naïve versus primed states, respectively. Indeed, mouse primed iPSC can be obtained by reprogramming in medium containing FGF and Activin (Han et al., 2011), similar to culture conditions for propagation of conventional hPSC (Vallier et al., 2005). Induction of naïve pluripotency is relatively robust in the mouse system and is increasingly well characterized at the molecular level (Guo et al., 2019; Schiebinger et al., 2019; Stadhouders et al., 2018). Reprogramming of human fibroblasts to naïve iPSC has only recently been reported, however, and appears variable and inefficient (Kilens et al., 2018; Liu et al., 2017). The methods entailed protracted reprogramming factor expression from viral or episomal vectors and the iPSC frequently exhibited persisting transgenes. Moreover the reprogrammed cells obtained were heterogeneous with poorly characterized differentiation behavior. Very recently, reprogramming to the human naïve state was achieved using chemically modified mRNA vectors applied in a microfluidic apparatus (Giulitti et al., 2019). In that study the authors report that serial transfection with modified mRNAs over at least 7 days within microfluidic chambers are important for induction of naïve cells. Such findings for human naïve reprogramming contrast with observations in mouse in which naïve iPSC are readily obtained by multiple methods requiring only short-term exposure to reprogramming factors in standard tissue culture conditions. Here we sought to determine whether human naïve iPSC could be produced directly from somatic cells in bulk culture with simplicity and efficiency comparable to the generation of mouse iPSC. Integration and/or persisting expression of reprogramming factor transgenes is undesirable in principle, and specifically may perturb the naïve PSC state or subsequent differentiation. We therefore focused on producing transgene-free naïve hPSC by transient delivery of non-modified RNAs (Poleganov et al., 2015). 4     RESULTS RNA-mediated induction of naïve pluripotency is facilitated by inhibition of the canonical Wnt pathway RNA-directed reprogramming has previously been used to generate conventional human iPSC (Poleganov et al., 2015). We reasoned that the same system may induce naïve pluripotency under the appropriate culture conditions. We adopted the combination of mRNAs encoding six reprogramming factors, OCT4, SOX2, KLF4, c- MYC, NANOG and LIN28 (OSKMNL), augmented with microRNAs 302 and 367, and supplemented with Vaccinia virus immune evasion factors E3, K3, and B18R mRNAs to suppress the interferon response. Naïve hPSC were originally established and propagated in medium containing the MEK1/2 inhibitor PD0325901, the glycogen synthase kinase-3 (GSK3) inhibitor CH99021, the atypical protein kinase C inhibitor Gö6983 and the cytokine leukemia inhibitory factor (LIF), collectively termed t2iLGö (Guo et al., 2016; Takashima et al., 2014). More recently, however, we have found that the tankyrase inhibitor and Wnt pathway antagonist XAV939 (XAV) enhances transgene-free resetting of conventional PSC to naïve status (Bredenkamp et al., 2019; Guo et al., 2017). We therefore examined the respective effects of CH and XAV during RNA-mediated reprogramming. We plated 10,000 human dermal fibroblasts (HDFs) on Geltrex-coated 4-well tissue culture plates and after overnight incubation carried out transfections with the RNA cocktail for four consecutive days (Fig 1A). Cells were then cultured in medium containing FGF2 for two days before exchange to naïve reprogramming media. The naïve media each contained PD0325901 (1 µM), Gö6938 (2 µM) and human LIF (10 ng/mL), plus the Rho-associated kinase inhibitor Y27632 (1µM). To this base medium, termed PGL, we added either CH (1 µM), as in the original t2iLGö naïve hPSC culture formulation (Takashima et al., 2014), or XAV (2 µM), constituting PXGL. Fibroblasts grew to a near-confluent layer of cells after 4 days of mRNA cocktail transfection. Patches of cells undergoing mesenchymal epithelial transition became apparent from day 6 (Figure 1B, S1A). Following transfer to PGL-based naïve media we observed compact colonies of cells with smooth boundaries after a further 10 days (Figure S1A). Presence of XAV resulted in markedly more of these colonies and a corresponding reduction in alternative cell morphologies. 5     Sushi Domain Containing 2 (SUSD2) is a cell surface protein highly expressed by human pre-implantation epiblast cells and naïve hPSC (Bredenkamp et al., 2019). By in situ live staining we detected expression of SUSD2 on the majority of compact colonies in reprogramming cultures in the presence of XAV (Figure 1C, S1A). We quantified the effect of XAV or CH by flow cytometry using SUSD2 together with the pan-epithelial marker EpCAM. The proportion of SUSD2+EpCAM+ cells was substantially higher in the presence of XAV than in PGL. Conversely, CH reduced the number of SUSD2+EpCAM+ cells (Figure 1D). Consistent with SUSD2 analysis, cultures reprogrammed in the presence of XAV showed substantially higher expression of core pluripotency factors and of naive markers assayed by RT-qPCR (Figure 1E). Tankyrase inhibition blocks canonical Wnt signaling but may also affect other pathways. We therefore evaluated RNA reprogramming in PGL supplemented with IWP2, a PORCN inhibitor, which blocks Wnt signaling by inhibition of Wnt protein secretion(Chen et al., 2009). Similar to XAV, addition of IWP2 yielded an increased proportion of SUSD2+ EpCAM+ cells (Figure S1B&C). The culture expressed higher levels of naïve markers than cells reprogrammed in non-supplemented PGL (Fig S1D). We noted reduced expression of Wnt target genes AXIN1 and TBX3 in presence of XAV or IWP2 (Figure S1D). Reproducibility of reprogramming to naïve status Somatic cell reprogramming can vary between cell lines. To evaluate reproducibility of RNA-directed reprogramming to a naïve phenotype we applied the protocol using PXGL to two adult primary dermal fibroblasts (HDF16, HDF75) and one newborn foreskin fibroblast (BJ). The experiments were repeated at different passages and we tested three different batches of RNA cocktail. In all cases we obtained SUSD2 positive colonies. SUSD2 live staining after 12-14 days in PXGL typically revealed several hundred stained colonies per well of a 4-well plate (Figure 2A, S2A). To substantiate the character of these colonies we carried out immunostaining for diagnostic transcription factors. KLF17 is a transcription factor expressed in the early human embryo and in naïve PSC but completely absent from conventional PSC (Blakeley et al., 2015; Guo et al., 2016), and NANOG is a critical pluripotency factor expressed in both naïve and conventional hPSC. We detected co-expression of 6     KLF17 and NANOG proteins in the majority of reprogrammed colonies in PXGL (Figure 2B, S2B). Human naïve and conventional PSC are distinguished by differential expression of SUSD2 or CD24 surface markers respectively (Bredenkamp et al., 2019). Accordingly we quantified naïve reprogramming for HDF16, HDF75 and BJ cultures based on presence of SUSD2 and absence of CD24 after 14 days in PXGL (Figure 2C). For HDF16, the majority of the culture (56%) was composed of SUSD2+CD24- cells. BJ and HDF75 cells were more mixed at this stage; In addition to SUSD2 positive cells, a distinct SUSD2-/CD24+ population was also present. We purified these two populations and subjected them to RT-qPCR analysis. SUSD2+ cells express naïve markers KLF17, KLF4, TFCP2L1, DPPA5 and DNMT3L, while the CD24+SUSD2- populations only express general pluripotency markers OCT4 and NANOG at low levels but lack naïve hallmarks (Figure 2D). We performed parallel RNA reprogramming of HDF16 and HDF75 to primed or naïve iPSC status (Figure S2C &D). The primed PSC surface marker CD24 was expressed on >50% of cells 4 days after transfer to E7 medium (Figure S2E). During naive reprogramming in PXGL SUSD2 expression appears later during naive reprogramming in PXGL, but reached a similar final proportion. We then investigated reprogramming of an alternative somatic cell type, peripheral blood-outgrowth derived endothelial progenitor cells, EPC (Geti et al., 2012). EPC reprogramming requires more prolonged RNA transfection over 8 days (Poleganov et al., 2015) during which there is considerable cell death (Figure S3A). Surviving cells were transferred to PXGL and after three weeks we observed occasional patches of compact epithelial cells. SUSD2 was detected in only about 5% of surviving cells (Figure S3B). A low iPSC yield compared with fibroblasts has previously been noted during reprogramming of EPC to primed iPSC (Poleganov et al., 2015). Notably, after SUSD2 sorting we detected expression of KLF17 and NANOG proteins in EPC- derived iPSC culture (Figure S3C). Expansion of naïve iPSC generated by RNA-mediated reprogramming After 14 days in PXGL for HDF and 21 days for EPC, we bulk passaged cultures via dissociation with Accutase and replated onto feeder layers of mouse embryo fibroblasts (MEF) in PXGL plus ROCK inhibitor. Dome-shaped, refractile, colonies formed on MEF (Figure 3A). After 2 passages we obtained cultures with more than 7     90% SUSD2 positive cells from HDF16 and BJ (Figure 3B). HDF75- and EPC- derived cultures remained heterogeneous. In these cases we used flow cytometry to purify the SUSD2+/CD24- population. Thereafter we found that cells could readily be maintained with relatively homogeneous naïve colony morphology and SUSD2 expression (Figure 3C). Cultures were passaged every 4-5 days at a 1:3 or 1:5 split ratio for at least 6 weeks (> 10 passages). Expanded cultures display naïve transcription factor proteins KLF17, KLF4, and TFCP2L1 (Figure 3D). RT-qPCR analysis showed expression of naïve markers at comparable levels to naïve HNES cells derived from dissociated human ICM (Guo et al., 2016) (Figure 3E). We generated naïve iPSC from two further EPC lines and established stable lines by both SUSD2 sorting and bulk passaging. These cells expressed naive markers at comparable levels to HDF derived naïve iPSC (Figure S3D). We also investigated expansion of individual colonies from the primary reprogramming well. We manually picked 8 colonies from HDF75 cultures after 14 days in PXGL. Colonies were dissociated with Accutase and plated in PXGL plus ROCK inhibitor on MEF in a 96-well plate. Six colonies were expanded into stable naïve iPSC cultures that maintained naïve marker gene expression (Figure 4A). We previously noted incidences of polyploidy in naive cells cultured in t2iLGö medium (Guo et al., 2016). We therefore monitored DNA content in the expanded naïve iPSC colonies by propidium iodide staining and flow cytometry analysis. One clone, niPSC1, contained a fraction of hyperdiploid cells at passage 5 but the other five remained diploid at passage 10 (Figure 4B). We performed G-banding karyotype analysis on three diploid clones, niPSC2, niPSC3 and niPSC4 after further expansion. Two clones, niPSC2 and niPSC3, exhibited a normal 46XX diploid karyotype at passage 20 and 16 respectively (Figure 4C). The third clone, niPSC4, was predominantly diploid but with a subpopulation (10%) of cells showing trisomy for chromosome 5 at passage 17. Taken together, human naïve iPSC can be expanded in PXGL with a relatively stable genome. Somatic lineage differentiation of naïve iPSC Naïve PSCs represent pre-implantation epiblast and are not directly competent for somatic lineage induction (Rostovskaya et al., 2019; Smith, 2017). Formative transition of human naïve PSC can be achieved by transfer to N2B27 medium supplemented with XAV only, a process termed capacitation (Rostovskaya et al., 8     2019). We examined differentiation potential of niPSC2 and niPSC4 following 13 days capacitation. Capacitated HNES1 cells and isogenic primed iPSC were included for comparison. Both naïve iPSC clones differentiated efficiently to definitive endoderm, neuroectoderm and paraxial mesoderm upon directed lineage induction. For definitive endoderm, we quantified co-expression of SOX17 and CXCR4 in more than 80% of cells after three days by flow cytometry (Figure 5A). For each of the induced lineages, marker expression was detected by RT-qPCR and immunostaining (Figure 5 B-G) at comparable levels as for capacitated HNES1 and primed iPSC differentiation (Figure S4A-C). We also assessed directed differentiation after capacitation from niPSC populations generated from HDF75, HDF16 and EPC. In each case appropriate lineage markers were induced (Figure S4D-E). Global transcriptome and DNA methylome features of naïve human iPSC We carried out RNA-seq on niPSC2, niPSC4 and HNES1 cells passaged in PXGL on either Geltrex or laminin to exclude MEF. Two primed iPSC cultures generated by RNA-mediated reprogramming were examined in parallel. We applied quadratic programming (DeconRNAseq) to assess quantitatively the similarity between the PSC cultures and human pre-implantation development based on global transcriptome profiles (Gong and Szustakowski, 2013; Stirparo et al., 2018). HNES1, niPSC2 and niPSC4 have a median epiblast fraction of identity of 0.8, 0.81, and 0.78 respectively (Figure 6A). These values indicate very high resemblance to pre-implantation epiblast compared to other stages (zygote, 4-cell, 8-cell, compacted morula, early ICM, primitive endoderm). In contrast the primed iPSC show less than 50% fraction of identity to epiblast. We then compared these samples with other hPSC samples. Dimensionality reduction by principle component analysis (PCA) highlights that the naïve iPSC clones are very closely related to one another and to HNES1 cells cultured in PXGL, and also to naïve PSC cultured in a previous study in t2iLGö on laminin (Guo et al., 2017) (Figure 6B). Naïve PSC cultures on MEF in t2iLGö (Guo et al., 2017; Guo et al., 2016; Takashima et al., 2014) or 5iLA (Theunissen et al., 2014) are more dispersed but reside in the same major cluster that is unambiguously separated on PC1 from conventional or other hPSC cultures. 9     A large number of transposable elements (TE) are differentially expressed between human naïve and primed ESC (Guo et al., 2017; Theunissen et al., 2016). Subgroups of hominid-specific HERVK, LTR5-Hs and SVA are significantly up- regulated in HNES and chemically reset (cR) naïve cells while HERVH and LTR-7 are mostly suppressed. We performed differential expression analysis of transposable elements between naïve and primed iPSC. Naïve iPSC clustered together with HNES cells and apart from primed iPSC (Figure 6C). Consistent with our previous observation, HERVK, LTR5-Hs, and SVA-F families are up-regulated in naïve iPSC compared to primed iPSCs (Figure 6D, Figure S5A&B). Naïve hPSC have been found to be globally hypomethylated (Takashima et al., 2014; Theunissen et al., 2016), in common with mouse and human ICM cells (Guo et al., 2014; Lee et al., 2014; Smith et al., 2014). To evaluate genome methylation in naive iPSC, we performed whole genome bisulfite sequencing (BS-seq). Methylation profiles for naïve and primed iPSC generated by RNA reprogramming were compared with published datasets for primed hPSC, human ICM cells (Guo et al., 2014), transgene reset naïve PSC (H9-NK2; Takashima et al., 2014) and HNES1 cells (Guo et al., 2016). The primed iPSC showed high levels of DNA methylation (85-95%) as expected. In contrast, naïve iPSC were globally hypomethylated to levels comparable to ICM cells but slightly higher than previously analyzed cultures of transgene reset or embryo derived hPSC (Figure 6E). Using t-Distributed Stochastic Neighbor Embedding (t-SNE) analysis (van der Maaten and Hinton, 2008), we also found that methylation profiles of naïve and primed PSC cultures clustered apart, with naïve cultures adjacent to ICM samples (Figure 5F). We previously showed that the genome of naïve PSC is not uniformly hypomethylated, and exhibits a small number of regions that gain methylation compared to primed PSC (Guo et al., 2017). We therefore asked whether naïve iPSC displayed similar characteristics. We defined genomic regions (blue) which showed >10% hypermethylation between reset and primed H9-NK2 PSC(Takashima et al., 2014) and <30% methylation in primed conditions and examined their methylation state in the current datasets (Figure S5C). We found that a substantial number of these regions were also hypermethylated in naïve iPSC, indicating that they may be a specific feature of naïve stem cells. 10     We also assessed the methylation status of imprinted regions in the different iPSC cultures. As observed previously (Guo et al., 2017; Pastor et al., 2016), naïve conditions failed to preserve imprinted methylation, although a significant number of imprints also appeared to be eroded in primed iPSC (Fig. S5D). DISCUSSION The findings in this study establish that human somatic cells can be reprogrammed efficiently to the naïve PSC state by transient delivery of reprogramming factors using RNA transfection. Thereafter, naïve cells can reliably be expanded into stable diploid cell lines, either as bulk populations, by sorting for SUSD2 expression, or by picking individual colonies. Resulting naïve iPSC lines exhibit a consistent marker phenotype that is in common with previously characterized naïve hPSC produced by resetting or derived from embryos. Following formative transition, naïve iPSC display competence for differentiation into somatic lineages. Both transcriptome and DNA methylome of naïve iPSC show high global correlation with embryo derived naïve HNES cells and a corresponding relatedness to epiblast cells in the human blastocyst. Recent studies reported that human naïve iPSC can be generated by transgene- induced reprogramming but that the products may be heterogeneous and confounded by persisting transgenes (Kilens et al., 2018; Liu et al., 2017). Transgene-free naïve iPSC have also been produced using chemically modified RNAs, but the efficiency of this approach was reported to depend on cell confinement in a microfluidic chamber (Giulitti et al., 2019), which restricts general application. In contrast, our results demonstrate that reprogramming to the naïve state can be highly efficient using unmodified RNAs in standard cell culture conditions. For dermal fibroblasts, three or four daily transfections with mRNAs encoding OSKMNL reprogramming factors together with miRNAs 302 and 367 are sufficient to produce more than one hundred SUSD2+ naïve iPSC colonies starting from 10,000 cells in a single well of a 4-well plate. This result is qualitatively reproducible between three different human fibroblast cultures, although individual efficiency varies, as has been generally reported for human reprogramming. Of note, PXGL medium not only promotes establishment of naïve pluripotency, but is also relatively selective against other cell types. Consequently the majority of non- or incompletely reprogrammed cells die or growth arrest in these conditions, allowing 11     naïve iPSC cultures to be established by bulk passaging without need for colony picking or cell sorting, although both can also be deployed. Occasionally we noticed high levels of cell death during RNA transfection, in which case limiting the transfection period to three days preserves viability and naïve colonies are still generated in recoverable numbers. In the case of EPC, sustained transfection is required and reprogramming efficiency is lower, as also noted for conventional iPSC generation (Poleganov et al., 2015), but sorting for SUSD2+CD24- cells effectively purifies the naïve cell fraction and enables subsequent stable expansion. We found that supplementation with XAV markedly improves the efficiency of reprogramming to the naïve state, in line with observations during resetting of conventional PSC (Guo et al., 2017). This may be a key difference from previous reports that found low efficiency of naive reprogramming using media that typically included the GSK3 inhibitor CH (Giulitti et al., 2019; Kilens et al., 2018; Liu et al., 2017). Our analysis shows that the presence of CH inhibits reprogramming to naïve status. CH has the opposite effect to XAV or IWP2 of stimulating rather than suppressing canonical WNT signaling. We surmise that blockade of WNT signaling reduces activation of gene expression that can derail reprogramming and/or destabilise naïve hPSC, as evidenced during resetting (Guo et al., 2017). Thus insulation from WNT signaling appears beneficial for stabilisation of naïve pluripotency during induction and expansion. This is in line with the general proposition that naïve PSC are sustained primarily by preventing differentiation (Martello and Smith, 2014), though differs in detail from the mouse ground state system (Ying et al., 2008). The species difference may largely be explained by the fact that human naïve PSC, and in vivo human naïve epiblast cells, show very low expression of TCF3 (TCF7L1) and do not express ESRRB (Rostovskaya et al., 2019; Takashima et al., 2014), the key components regulated by GSK3 inhibition in mouse ES cells (Martello et al., 2012; Wray et al., 2011). In general, we find that stem cell cultures in PXGL exhibit equivalent naïve features to cells in our original t2iLGö formulation (Takashima et al., 2014), but appear more robust and stable. Overall, these analyses establish that human naïve iPSC generated by RNA-directed reprogramming are essentially indistinguishable globally from naïve PSC derived from human ICM or generated by resetting of conventional hPSC and are similarly closely related to human pre-implantation epiblast. Relatively facile but reliable generation of naïve iPSC will open up the fields of human reprogramming and naïve pluripotency for deeper investigation. In mouse it is well-established that somatic cell 12     reprogramming converges on the naïve PSC phenotype unless specific culture conditions are applied to capture primed pluripotency (Han et al., 2011). In human, however, the same reprogramming factors as used in mouse routinely generate PSC of the primed phenotype. Our findings substantiate the hypothesis that the final state of pluripotency obtained by molecular reprogramming is determined in human as in mouse by the culture environment. We speculate that reprogramming to the naïve state may be direct in the PXGL culture environment and not entail passage through a primed state. It will be of interest to examine this by determining the trajectories of RNA-mediated reprogramming to naïve or primed endpoints. The combination of high efficiency with limited duration of reprogramming factor expression makes the mRNA delivery system attractive for such studies applied to primary cells. Furthermore, as illustrated in the case of XAV, it is straightforward to combine small molecules with mRNA reprogramming and screen for accelerated or enhanced reprogramming, which can readily be visualized and quantified using SUSD2 live staining or flow cytometry (Bredenkamp et al., 2019). Finally, the ability to generate naïve iPSC rapidly and reliably from somatic cells provides a platform for comprehensive evaluation of the consistency, genomic stability, differentiation propensity, and other attributes of naïve hPSC compared to isogenic conventional hPSC generated from the same donor. 13     EXPERIMENTAL PROCEDURES Human PSC culture Naïve hPSC, including chemically reset (cR), embryo-derived (HNES1) and naïve iPSCs were propagated in N2B27 with PXGL [1 µM PD0325901 (P), 2 µM XAV939 (X), 2 µM Gö6983 (G) and 10 ng/mL human LIF (L),] on irradiated MEF feeders. ROCK inhibitor (Y-27632) and Geltrex (0.5 µL per cm2 surface area; hESC-Qualified, Thermo Fisher Scientific, A1413302,) were added to media during replating. Cells were cultured in 5% O2, 7% CO2 in a humidified incubator at 37°C and passaged by dissociation with Accutase (Biolegend, 423201) every 3-5 days. For capacitation, cells were passaged once without feeders in PXGL medium then exchanged into N2B27 containing 2 µM XAV(Rostovskaya et al., 2019). Conventional hPSC cultures were propagated on Geltrex in Essential 8 (E8) medium made in-house (Chen et al., 2011) or AFX medium (N2B27 basal medium with 5 ng/mL Activin A, 5 ng/mL FGF2 and 2 µM XAV). Cell lines were maintained without antibiotics and confirmed free of mycoplasma contamination by periodic in-house PCR assay. Somatic cell culture Adult human dermal fibroblasts (HDFa), HDFa16, HDFa75 (Thermo Fisher Scientific, C0135C), and BJ foreskin fibroblast (ATCC® CRL-2522™) were cultured in DMEM high glucose (Merck, D5546) with FBS (10%, Merck, F0804), L-glutamine (2 mM, Thermo Fisher Scientific, 25030024) and 2-mercaptoethanol (100 µM, Merck, M3148) on 0.1% gelatin-coated plates. Peripheral blood-derived endothelial progenitor cells (EPC; C26b, EPC1 and EPC2) were cultured as described(Ormiston et al., 2015) in endothelial cell basal medium (PromoCell, c-22210) supplemented with 10% FBS and cytokines, without heparin. RNA Reprogramming Reprogramming was performed using the StemRNA 3rd Gen Reprogramming Kit (Stemgent, 00-0076). A detailed protocol is provided in supplemental information. Briefly, fibroblasts were plated on Geltrex in culture medium with serum. The following day, RNAs were delivered by Lipofectamine® RNAiMAX™ (Thermo Fisher Scientific, 13778150) and transfection repeated daily for 3-4 days in medium supplemented with FGF2. From day 7, cultures were exchanged to naïve culture medium until naïve-type colonies formed. For EPC reprogramming, mRNA cocktails were delivered daily for 8 days in EPC expansion medium. The culture was then switched to PXGL plus Y-27632 medium for 14-20 days until dome shaped colonies 14     became pronounced. hPSC differentiation Naïve hPSC capacitation and tri-lineage differentiation were performed as described(Rostovskaya et al., 2019). In brief, naïve hPSC were capacitated for more than 10 days to prepare them for lineage induction. Definitive endoderm was induced over three days: day 1 in CDM2 basal medium supplemented with 100 ng/mL, activin A, 100 nM PI-103, 3 µM CHIR99021, 10 ng/mL FGF2, 3 ng/mL BMP4, 10 µg/mL heparin and followed by 2 days in CDM2 supplemented with 100 ng/mL activin A, 100 nM PI-103, 20 ng/mL FGF2, 250 nM LDN193189, 10 µg/mL heparin(Loh et al., 2014). Neuroectoderm was induced in N2B27 medium supplemented with 1 µM A83-01 and 500 nM LDN193189 for 10 days(Chambers et al., 2009). Differentiation to paraxial mesoderm was induced for 6 days in 3 µM CHIR99021 and 500 nM LDN193189, with addition of 20 ng/mL FGF2 from day 3- 6(Chal et al., 2015). Reverse transcription and real-time PCR Total RNA was extracted using ReliaPrep kit (Promega, Z6012) and cDNA synthesized with GoScript reverse transcriptase (Promega, A5004) and oligo(dT) adapter primers. TaqMan assays (Thermo Fisher Scientific) and Universal Probe Library (UPL) probes (Roche Molecular Systems) were used to perform gene quantification. Immunostaining Cells were fixed with 4% PFA for 10 min at room temperature and blocked/permeabilised in PBS with 0.1% Triton X-100, 3% Donkey serum for 30 min. Incubation with primary antibodies was overnight at 4°C. Wash was in 0.1% Triton X- 100 twice, 10 min each time. Secondary antibodies were added for 1 h at room temperature. The following antibodies were used for immunostaining of pluripotency markers: NANOG (Bio-Techne AF1997), OCT4 (Santa Cruz sc-5279), KLF4 (Santa Cruz sc-20691), KLF17 (Atlas Antibodies HPA024629), TFCP2L1 (Bio-Techne AF5726). Antibodies for immunostaining of differentiation markers were: FOXA2 (R&D Systems AF2400), SOX17 (Bio-Techne AF1924), SOX1 (Bio-Techne AF3369), PAX6 (Merck Millipore AB2237), TBX6 (Abcam ab38883). For live staining, cells were incubated with conjugated SUSD2 clone W5C5 (SUSD2-PE, BioLegend 327406) in culture media for 20 min before washing and imaging. 15     Flow cytometry Flow cytometry analysis was carried out on a CyAn ADP (Beckman Coulter) or BD LSR Fortessa instrument (BD Biosciences) with analysis using FlowJo software. For intracellular marker staining, cells were fixed with fixation buffer (Thermo Fisher Scientific,00-8222-49) for 30min at 4°C, washed with permeabilization buffer (Thermo Fisher Scientific, 00-8333-56), and incubated with SOX17 antibody diluted with permeabilization buffer and 5% donkey serum (Merck, D9663) for 1 h at 4°C. Cell sorting was performed using a MoFlo high-speed instrument (Beckman Coulter). The following antibodies were used for flow cytometry: SUSD2-PE (BioLegend 327406), CD24-APC (Thermo Fisher Scientific 17-0247-42), EpCAM-PE/Cy7 (BioLegend 324221), TRA-1-85-FITC (Miltenyi Biotec 130-107-106), CXCR4-PE (BD Pharmingen 555974), SOX17-APC (Bio-Techne IC1924A). Chromosome analysis G-banded karyotype analysis was performed following standard cytogenetic protocol at Sheffield Diagnostic Genetics Service. Typically 20 metaphases were scored. CGH array analysis using the Agilent ISCA 8x60K v2 array was carried out at the Cytogenetics Laboratory, Cambridge University Hospitals. Transcriptome sequencing and data analysis Naïve hPSCs were cultured on Geltrex or 10 µg/cm2 laminin (Merck, CC095) without MEF for three passages before harvesting for RNA. Total RNA was extracted from three biological replicates of each cell line using TRIzol/chloroform (Thermo Fisher Scientific, 15596018) and RNA integrity assessed by Qubit measurement and RNA nanochip Bioanalyzer. Ribosomal RNA was depleted from 1 µg of total RNA using Ribozero (Illumina kit). Sequencing libraries were prepared using the TruSeq RNA Sample Prep Kit (RS-122-2001, Illumina). Sequencing was performed on the Illumina NextSeq 500 High Output Kit v2 (75 cycles) (FC-404- 1005, Illumina), according to the manufacturer’s instructions. Reads were aligned to human genome build GRCh38/hg38 with STAR (Dobin et al., 2013) using the human gene annotation from Ensembl release 87(Yates et al., 2016). Alignments to gene loci were quantified with HTseq-count(Anders et al., 2014) based on annotation from Ensembl 87 and using option –m intersection-nonempty. Fractional identity between in vitro cultured cells and pre-implantation stages was computed using R package DeconRNASeq(Gong and Szustakowski, 2013) and method as described(Stirparo et al., 2018). External datasets used for comparative 16     analyses are detailed elsewhere(Guo et al., 2017; Stirparo et al., 2018). Principal component analyses were performed based on log2 FPKM values computed with the Bioconductor packages DESeq2(Love et al., 2014) or FactoMineR(Lê et al., 2008) in addition to custom scripts. Transposable element analysis Reads were trimmed and low-quality bases were removed using TrimGalore! (github.com/FelixKrueger/TrimGalore). Quality-trimmed reads were aligned to the human reference genome (UCSC hg38/NCBI GRCh38) using bowtie (bowtie- bio.sorceforge.net) with options “-a –best -M 1 -v 2”, allowing for two mismatches and randomly reporting one alignment for multi-mapping reads. ‘RepeatMasker’- annotated regions were obtained from the hg38 UCSC Table Browser, and counts per TE element were extracted using featureCounts (bioinf.wehi.edu.au/featureCounts) requiring at least 10 nt overlap and counting multi-mapping reads. ‘RepeatMasker’-annotated TE elements with at least 5 counts over all samples were considered for further analysis. Read counts per TEs were normalized and statistical significance for differential expression between all samples was evaluated using the R Bioconductor DESeq package (www.bioconductor.org). Expression values were further normalized by the size of TE elements (per 1 kB). Unsupervised hierarchical clustering was performed using the R hclust function. Whole genome bisulfite sequencing, mapping, and analysis Post-bisulfite adaptor tagging (PBAT) libraries for whole-genome DNA methylation analysis were prepared from purified genomic DNA(Miura et al., 2012; Smallwood et al., 2014; von Meyenn et al., 2016). Paired-end sequencing was carried out on HiSeq2500 instruments (Illumina). Raw sequence reads were trimmed to remove poor quality reads and adapter contamination using Trim Galore (v0.4.1) (Babraham Bioinformatics). The remaining sequences were mapped using Bismark (v0.14.4)(Krueger and Andrews, 2011) to the human reference genome GRCh37 in paired-end mode as described(von Meyenn et al., 2016). CpG methylation calls were analysed using SeqMonk software (Babraham Bioinformatics). Global CpG methylation levels of pooled replicates were illustrated using box plots. The SeqMonk build-in tSNE analysis was used to generate tSNE plots of the various datasets. The genome was divided into consecutive 20 kb tiles and percentage methylation was calculated using the bisulfite feature methylation pipeline in SeqMonk. Scatter plots 17     of methylation levels over 20 kb tiles were generated using R, highlighting hypermethylated DMRs. Annotations of human germline imprint control regions were obtained as described(Court et al., 2014). Pseudocolour heatmaps representing average methylation levels were generated using the R heatmap.2 function without further clustering, scaling or normalisation. Data availability RNA-seq and WGBS data are deposited in Gene Expression Omnibus under accession number GSE138304 and GSE130162. Acknowledgements We thank Jing Liu for RNA-sequencing. Peter Humphreys and Darran Clements supported imaging studies. Amer Rana kindly provided EPC line C26b. We are grateful to Duanqing Pei for support. Funding This research was funded by the Medical Research Council of the United Kingdom (G1001028 and MR/P00072X/1) and European Commission Framework 7 (HEALTH- F4-2013-602423, PluriMes). JY was supported by the Guangdong Provincial Key Laboratory, and FvM by a UKRI/MRC Rutherford Fund Fellowship. The Cambridge Stem Cell Institute receives core support from Wellcome and the Medical Research Council. AS is a Medical Research Council Professor. Author Contributions Conceptualization, G.G, A.S.; Methodology, G.G.; Investigation, G.G., N.B., J.Y., J.C., D.B., R.D., M.R. C.W., D.L., Y.L.; Formal analysis, G.G.S., F.vM. S.D.; Writing, A.S and G.G.; Supervision S.E-M, G.G. and A.S. Conflict of Interest A.S. and G.G. are inventors on a patent application relating to human naïve stem cells filed by the University of Cambridge. Y.L. and S.E-M are employees of 18     ReproCell. ReproCell provided RNA reprogramming materials on a collaborative basis but did not design or fund the study. 19     REFERENCES Anders, S., Pyl, P.T., and Huber, W. (2014). HTSeq — A Python framework to work with high-throughput sequencing data. bioRxiv. Blakeley, P., Fogarty, N.M.E., del Valle, I., Wamaitha, S.E., Hu, T.X., Elder, K., Snell, P., Christie, L., Robson, P., and Niakan, K.K. (2015). Defining the three cell lineages of the human blastocyst by single-cell RNA-seq. Development. Bredenkamp, N., Stirparo, G.G., Nichols, J., Smith, A., and Guo, G. (2019). The Cell Surface Marker Sushi Containing Domain 2 Facilitates Establishment Of Human Naïve Pluripotent Stem Cells. Stem Cell Reports. Chal, J., Oginuma, M., Al Tanoury, Z., Gobert, B., Sumara, O., Hick, A., Bousson, F., Zidouni, Y., Mursch, C., Moncuquet, P., et al. (2015). Differentiation of pluripotent stem cells to muscle fiber to model Duchenne muscular dystrophy. Nat Biotechnol 33, 962-969. Chambers, S.M., Fasano, C.A., Papapetrou, E.P., Tomishima, M., Sadelain, M., and Studer, L. (2009). Highly efficient neural conversion of human ES and iPS cells by dual inhibition of SMAD signaling. Nat Biotechnol 27, 275-280. Chen, B., Dodge, M.E., Tang, W., Lu, J., Ma, Z., Fan, C.W., Wei, S., Hao, W., Kilgore, J., Williams, N.S., et al. (2009). Small molecule-mediated disruption of Wnt- dependent signaling in tissue regeneration and cancer. Nat Chem Biol 5, 100-107. Chen, G., Gulbranson, D.R., Hou, Z., Bolin, J.M., Ruotti, V., Probasco, M.D., Smuga- Otto, K., Howden, S.E., Diol, N.R., Propson, N.E., et al. (2011). Chemically defined conditions for human iPSC derivation and culture. Nat Methods 8, 424-429. Court, F., Tayama, C., Romanelli, V., Martin-Trujillo, A., Iglesias-Platas, I., Okamura, K., Sugahara, N., Simon, C., Moore, H., Harness, J.V., et al. (2014). Genome-wide parent-of-origin DNA methylation analysis reveals the intricacies of human imprinting and suggests a germline methylation-independent mechanism of establishment. Genome Res 24, 554-569. Geti, I., Ormiston, M.L., Rouhani, F., Toshner, M., Movassagh, M., Nichols, J., Mansfield, W., Southwood, M., Bradley, A., Rana, A.A., et al. (2012). A practical and efficient cellular substrate for the generation of induced pluripotent stem cells from adults: blood-derived endothelial progenitor cells. Stem Cells Transl Med 1, 855-865. Giulitti, S., Pellegrini, M., Zorzan, I., Martini, P., Gagliano, O., Mutarelli, M., Ziller, M.J., Cacchiarelli, D., Romualdi, C., Elvassore, N., et al. (2019). Direct generation of human naive induced pluripotent stem cells from somatic cells in microfluidics. Nat Cell Biol 21, 275-286. 20     Gong, T., and Szustakowski, J.D. (2013). DeconRNASeq: a statistical framework for deconvolution of heterogeneous tissue samples based on mRNA-Seq data. Bioinformatics 29, 1083-1085. Guo, G., von Meyenn, F., Rostovskaya, M., Clarke, J., Dietmann, S., Baker, D., Sahakyan, A., Myers, S., Bertone, P., Reik, W., et al. (2017). Epigenetic resetting of human pluripotency. Development 144, 2748-2763. Guo, G., von Meyenn, F., Santos, F., Chen, Y., Reik, W., Bertone, P., Smith, A., and Nichols, J. (2016). Naive Pluripotent Stem Cells Derived Directly from Isolated Cells of the Human Inner Cell Mass. Stem Cell Reports 6, 437-446. Guo, H., Zhu, P., Yan, L., Li, R., Hu, B., Lian, Y., Yan, J., Ren, X., Lin, S., Li, J., et al. (2014). The DNA methylation landscape of human early embryos. Nature 511, 606- 610. Guo, L., Lin, L., Wang, X., Gao, M., Cao, S., Mai, Y., Wu, F., Kuang, J., Liu, H., Yang, J., et al. (2019). Resolving Cell Fate Decisions during Somatic Cell Reprogramming by Single-Cell RNA-Seq. Mol Cell 73, 815-829.e817. Han, D.W., Greber, B., Wu, G., Tapia, N., Arauzo-Bravo, M.J., Ko, K., Bernemann, C., Stehling, M., and Scholer, H.R. (2011). Direct reprogramming of fibroblasts into epiblast stem cells. Nat Cell Biol 13, 66-71. Kilens, S., Meistermann, D., Moreno, D., Chariau, C., Gaignerie, A., Reignier, A., Lelièvre, Y., Casanova, M., Vallot, C., Nedellec, S., et al. (2018). Parallel derivation of isogenic human primed and naive induced pluripotent stem cells. Nature Communications 9, 360. Krueger, F., and Andrews, S.R. (2011). Bismark: a flexible aligner and methylation caller for Bisulfite-Seq applications. Bioinformatics 27, 1571-1572. Lê, S., Josse, J., and Husson, F. (2008). FactoMineR: An R package for multivariate analysis. Journal of Statistical Software 25, 1-18. Lee, H.J., Hore, T.A., and Reik, W. (2014). Reprogramming the methylome: erasing memory and creating diversity. Cell Stem Cell 14, 710-719. Liu, X., Nefzger, C.M., Rossello, F.J., Chen, J., Knaupp, A.S., Firas, J., Ford, E., Pflueger, J., Paynter, J.M., Chy, H.S., et al. (2017). Comprehensive characterization of distinct states of human naive pluripotency generated by reprogramming. Nature Methods 14, 1055-1062. Loh, K.M., Ang, L.T., Zhang, J., Kumar, V., Ang, J., Auyeong, J.Q., Lee, K.L., Choo, S.H., Lim, C.Y., Nichane, M., et al. (2014). Efficient endoderm induction from human pluripotent stem cells by logically directing signals controlling lineage bifurcations. Cell Stem Cell 14, 237-252. 21     Love, M.I., Huber, W., and Anders, S. (2014). Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol 15, 550. Martello, G., and Smith, A. (2014). The nature of embryonic stem cells. Annu Rev Cell Dev Biol 30, 647-675. Martello, G., Sugimoto, T., Diamanti, E., Joshi, A., Hannah, R., Ohtsuka, S., Gottgens, B., Niwa, H., and Smith, A. (2012). Esrrb is a pivotal target of the Gsk3/Tcf3 axis regulating embryonic stem cell self-renewal. Cell Stem Cell 11, 491- 504. Miura, F., Enomoto, Y., Dairiki, R., and Ito, T. (2012). Amplification-free whole- genome bisulfite sequencing by post-bisulfite adaptor tagging. Nucleic Acids Res 40, e136. Nakamura, T., Okamoto, I., Sasaki, K., Yabuta, Y., Iwatani, C., Tsuchiya, H., Seita, Y., Nakamura, S., Yamamoto, T., and Saitou, M. (2016). A developmental coordinate of pluripotency among mice, monkeys and humans. Nature 537, 57-62. Nichols, J., and Smith, A. (2009). Naive and primed pluripotent states. Cell Stem Cell 4, 487-492. Nichols, J., and Smith, A. (2012). Pluripotency in the embryo and in culture. Cold Spring Harb Perspect Biol 4, a008128. O'Leary, T., Heindryckx, B., Lierman, S., van Bruggen, D., Goeman, J.J., Vandewoestyne, M., Deforce, D., de Sousa Lopes, S.M., and De Sutter, P. (2012). Tracking the progression of the human inner cell mass during embryonic stem cell derivation. Nat Biotechnol 30, 278-282. Okita, K., Ichisaka, T., and Yamanaka, S. (2007). Generation of germline-competent induced pluripotent stem cells. Nature 448, 313-317. Ormiston, M.L., Toshner, M.R., Kiskin, F.N., Huang, C.J., Groves, E., Morrell, N.W., and Rana, A.A. (2015). Generation and Culture of Blood Outgrowth Endothelial Cells from Human Peripheral Blood. J Vis Exp, e53384. Pastor, W.A., Chen, D., Liu, W., Kim, R., Sahakyan, A., Lukianchikov, A., Plath, K., Jacobsen, S.E., and Clark, A.T. (2016). Naive Human Pluripotent Cells Feature a Methylation Landscape Devoid of Blastocyst or Germline Memory. Cell Stem Cell 18, 323-329. Poleganov, M.A., Eminli, S., Beissert, T., Herz, S., Moon, J.I., Goldmann, J., Beyer, A., Heck, R., Burkhart, I., Barea Roldan, D., et al. (2015). Efficient Reprogramming of Human Fibroblasts and Blood-Derived Endothelial Progenitor Cells Using Nonmodified RNA for Reprogramming and Immune Evasion. Hum Gene Ther 26, 751-766. 22     Rossant, J., and Tam, P.P.L. (2017). New Insights into Early Human Development: Lessons for Stem Cell Derivation and Differentiation. Cell Stem Cell 20, 18-28. Rostovskaya, M., Stirparo, G.G., and Smith, A. (2019). Capacitation of human naïve pluripotent stem cells for multi-lineage differentiation. Development 146, dev172916. Schiebinger, G., Shu, J., Tabaka, M., Cleary, B., Subramanian, V., Solomon, A., Gould, J., Liu, S., Lin, S., Berube, P., et al. (2019). Optimal-Transport Analysis of Single-Cell Gene Expression Identifies Developmental Trajectories in Reprogramming. Cell 176, 928-943.e922. Silva, J., Barrandon, O., Nichols, J., Kawaguchi, J., Theunissen, T.W., and Smith, A. (2008). Promotion of reprogramming to ground state pluripotency by signal inhibition. PLoS Biol 6, e253. Smallwood, S.A., Lee, H.J., Angermueller, C., Krueger, F., Saadeh, H., Peat, J., Andrews, S.R., Stegle, O., Reik, W., and Kelsey, G. (2014). Single-cell genome-wide bisulfite sequencing for assessing epigenetic heterogeneity. Nat Methods 11, 817- 820. Smith, A. (2017). Formative pluripotency: the executive phase in a developmental continuum. Development 144, 365-373. Smith, A.G. (2001). Embryo-derived stem cells: of mice and men. Ann Rev Cell Dev Biol 17, 435-462. Smith, Z.D., Chan, M.M., Humm, K.C., Karnik, R., Mekhoubad, S., Regev, A., Eggan, K., and Meissner, A. (2014). DNA methylation dynamics of the human preimplantation embryo. Nature 511, 611-615. Stadhouders, R., Vidal, E., Serra, F., Di Stefano, B., Le Dily, F., Quilez, J., Gomez, A., Collombet, S., Berenguer, C., Cuartero, Y., et al. (2018). Transcription factors orchestrate dynamic interplay between genome topology and gene regulation during cell reprogramming. Nat Genet 50, 238-249. Stirparo, G.G., Boroviak, T., Guo, G., Nichols, J., Smith, A., and Bertone, P. (2018). Integrated analysis of single-cell embryo data yields a unified transcriptome signature for the human pre-implantation epiblast. Development 145. Takahashi, K., Tanabe, K., Ohnuki, M., Narita, M., Ichisaka, T., Tomoda, K., and Yamanaka, S. (2007). Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell 131, 861-872. Takahashi, K., and Yamanaka, S. (2006). Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 126, 663-676. Takashima, Y., Guo, G., Loos, R., Nichols, J., Ficz, G., Krueger, F., Oxley, D., Santos, F., Clarke, J., Mansfield, W., et al. (2014). Resetting Transcription Factor Control Circuitry toward Ground-State Pluripotency in Human. Cell 158, 1254-1269. 23     Theunissen, T.W., Friedli, M., He, Y., Planet, E., O'Neil, R.C., Markoulaki, S., Pontis, J., Wang, H., Iouranova, A., Imbeault, M., et al. (2016). Molecular Criteria for Defining the Naive Human Pluripotent State. Cell Stem Cell 19, 502-515. Theunissen, T.W., Powell, B.E., Wang, H., Mitalipova, M., Faddah, D.A., Reddy, J., Fan, Z.P., Maetzel, D., Ganz, K., Shi, L., et al. (2014). Systematic identification of culture conditions for induction and maintenance of naive human pluripotency. Cell Stem Cell 15, 471-487. Thomson, J.A., Itskovitz-Eldor, J., Shapiro, S.S., Waknitz, M.A., Swiergiel, J.J., Marshall, V.S., and Jones, J.M. (1998). Embryonic stem cell lines derived from human blastocysts. Science 282, 1145-1147. Vallier, L., Alexander, M., and Pedersen, R.A. (2005). Activin/Nodal and FGF pathways cooperate to maintain pluripotency of human embryonic stem cells. J Cell Sci 118, 4495-4509. van der Maaten, L., and Hinton, G. (2008). Visualizing data using t-SNE. Journal of Machine Learning Research 9, 2579-2605. von Meyenn, F., Berrens, R.V., Andrews, S., Santos, F., Collier, A.J., Krueger, F., Osorno, R., Dean, W., Rugg-Gunn, P.J., and Reik, W. (2016). Comparative Principles of DNA Methylation Reprogramming during Human and Mouse In Vitro Primordial Germ Cell Specification. Dev Cell 39, 104-115. Wray, J., Kalkan, T., Gomez-Lopez, S., Eckardt, D., Cook, A., Kemler, R., and Smith, A. (2011). Inhibition of glycogen synthase kinase-3 alleviates Tcf3 repression of the pluripotency network and increases embryonic stem cell resistance to differentiation. Nat Cell Biol 13, 838-845. Yan, L., Yang, M., Guo, H., Yang, L., Wu, J., Li, R., Liu, P., Lian, Y., Zheng, X., Yan, J., et al. (2013). Single-cell RNA-Seq profiling of human preimplantation embryos and embryonic stem cells. Nat Struct Mol Biol 20, 1131-1139. Yates, A., Akanni, W., Amode, M.R., Barrell, D., Billis, K., Carvalho-Silva, D., Cummins, C., Clapham, P., Fitzgerald, S., Gil, L., et al. (2016). Ensembl 2016. Nucleic Acids Res 44, D710-716. Ying, Q.L., Wray, J., Nichols, J., Batlle-Morera, L., Doble, B., Woodgett, J., Cohen, P., and Smith, A. (2008). The ground state of embryonic stem cell self-renewal. Nature 453, 519-523. Yu, J., Vodyanik, M.A., Smuga-Otto, K., Antosiewicz-Bourget, J., Frane, J.L., Tian, S., Nie, J., Jonsdottir, G.A., Ruotti, V., Stewart, R., et al. (2007). Induced pluripotent stem cell lines derived from human somatic cells. Science 318, 1917-1920. 24     FIGURE LEGENDS Figure 1. Wnt inhibition enhances naive reprogramming by RNA 1A. Schematic of reprogramming protocol 1B. Morphology during initial reprogramming in medium with FGF2 1C. Morphology in naïve capture medium, PGL or PXGL. See also Figure S1A 1D. Flow cytometry analysis of EpCAM and SUSD2 expression after 12 days in PGL with CH or XAV. Scatter plots on left, histograms on right. 1E. RT-qPCR analysis of pluripotency markers after 12 days in PGL based medium Scale bar, 100 µM; Error bars indicate s.d. of two technical replicates. See also Figure S1 Figure 2. Reproducibility of reprogramming in PXGL 2A. Well of HDF75 reprogramming culture after 13 days in PXGL, stained in situ with SUSD2-PE antibody. See also figure S1B. Scale bar, 0.2 CM 2B. Immunostaining for KLF17 and NANOG after 15 days in PXGL. Scale bar, 100 µM 2C. Flow cytometry analysis SUSD2 and CD24 expression at day 13 in PXGL for different fibroblast lines. 2D. Marker analysis by RT-qPCR of isolated SUSD2 positive and negative populations. Error bars indicate s.d. of two technical replicates. See also Figure S2 Figure 3. Expansion and characterization of naïve iPSCs 3A. Morphology of naïve iPSC culture on MEF at passage 1 after reprogramming. 3B. Flow cytometry analysis of SUSD2 and CD24 expression in HDF16, HDF75 and BJ derived naïve iPSC cultures at passage 2. 3C. SUSD staining of naïve iPSC cultures of indicated origin after sorting and subsequent passaging (P). 3D. Immunostaining for naïve markers in expanded naïve iPSC (BJ derived). 3E. RT-qPCR analysis of marker expression in expanded naïve iPSCs of indicated origins and embryo-derived naïve HNES1 cells. Data are normalized to expression in conventional H9 cells. Error bars indicate s.d. of two technical replicates. Scale bar, 100 µM See also Figure S3 25     Figure 4. Clonal expansion of naïve iPSCs 4A. RT-qPCR analysis of pluripotency markers in six expanded naïve iPSC clones at indicated passages. Two isogenic conventional iPSC clones (piPSC1, piPSC2) generated in parallel and embryo derived HNES5 cells are included for comparison. Error bars indicate s.d. of two technical replicates. 4B. DNA content analysis from flow cytometry profiles of cells stained with propidium iodide. Diploid genome population is labeled as 2N, 4N indicates cells in G2 and/or tetraploid, Hyperpolypoid is >4N. Figure 5. Differentiation of capacitated naïve iPSC 5A. Flow cytometry analysis of SOX17 and CXCR4 expression after 3 days definitive endoderm induction of primed S6EOS and capacitated niPSC4 cells. 5B. Immunostaining for FOXA2 and SOX17 after 3 days definitive endoderm induction of niPSC2. 5C. RT-qPCR analysis of definitive endoderm markers after 3 days induction of niPSC2. 5D. Immunostaining for SOX1 and PAX6 after 10 days neuroectoderm induction of niPSC2. 5E. RT-qPCR analysis of neuroectoderm marker expression. 5F. Immunostaining for TBX6 after 6 days of paraxial mesoderm induction of niPSC2. 5G. RT-qPCR analysis of paraxial mesoderm markers. Scale bar, 100 µM. Error bars indicate s.d. of three technical replicates. See also Figure S4 Figure 6. Global molecular analyses of naïve iPSCs 6A. Fraction of identity with human pre-implantation epiblast for primed iPSC, embryo-derived naïve stem cells (HNES1), and naïve iPSCs. Box plots show four independent cell cultures of each indicated type. 6B. Principal component analysis using all expressed protein-coding genes 6C. A heatmap showing the expression of 6,290 differentially expressed TE elements (log2FC > 2, p value < 0.05 in any pairwise comparison; and log2(norm counts) > 3.5 expression in any sample). TE elements are ranked by the average log2FC of four possible different comparisons between naïve iPSC (niPSC) and primed iPSC (piPSC) cell types. 26     6D. Scatter plots showing the expression of TE elements in piPSC, niPSC2 and HNES1 cells. TE elements from representative TE subfamilies that are differentially expressed between naïve and primed cells are highlighted. 6E. Box plots showing the global distribution of CpG methylation levels from pooled replicates of the indicated samples compared with published datasets (Guo et al., 2017; Guo et al., 2014; Takashima et al., 2014). iPSC samples are from two independent experiments. Methylation was quantitated over 20 kb genomic tiles. 6F. t-SNE plot showing the distribution and clustering of the analyzed datasets. Methylation was quantitated over 20 kb genomic tiles. See also Figure 5 100 101 102 103 104 100 101 102 103 104 1.3 48.7 39.810.2 100 101 102 103 104 100 101 102 103 104 1.3 18.5 34.445.8 100 101 102 103 104 100 101 102 103 104 0.8 71.7 23.93.5 PGLt2iLGo PXGL 100 101 102 103 104 100 101 102 103 104 0.5 13.0 76.99.6 100 101 102 103 104 100 101 102 103 104 0.7 6.7 34.857.8 100 101 102 103 104 100 101 102 103 104 1.0 61.3 31.56.1 HDF16 HDF75 R el at iv e to A C TB R el at iv e to A C TB HDF16 HDF75 S U S D 2- P E S U S D 2- P E EpCAM-PE-Cy7 SUSD2SUSD2 PGLPXGL EpCAM-PE/Cy7 Figure 1 A B C 0 0.04 0.08 0 0.04 0.08 0 0.03 0.06 0 0.2 0.4 0 0.3 0.6 0 0.003 0.006 OCT4 NANOG PRDM14 DPPA5 DNMT3L KLF17 t2iLGö PGL PXGL t2iLGö PGL PXGL t2iLGö PGL PXGL Daily mRNA transfection FGF2 Test medium Day 1 - Day 4 Day 5 - Day 6 Day7 In situ SUSD2 staining Flow cytometry analysis RT-qPCR analysis D Day 0 Day 4 Day 6 Day 7+13 E 0 20 40 60 80 SUSD2+ EpCAM+ t2iLGo PGL PXGL 0 20 40 60 80 % % SUSD2- EpCAM+ SUSD2- EpCAM- t2iLGo PGL PXGL SUSD2+ EpCAM+ SUSD2- EpCAM+ SUSD2- EpCAM- DAPI NANOG KLF17 NANOG/KLF17 100 101 102 103 104 100 101 102 103 104 41.0 14.4 34.310.3 HDF75, Day 7+13, PXGL S U S D 2- P E CD24-APC Figure 2 A B C D 100 101 102 103 104 100 101 102 103 104 34.2 14.9 32.318.5 100 101 102 103 104 100 101 102 103 104 56.1 26.7 10.86.4 HDF16 BJ S U S D 2- P E CD24-APC S U S D 2- P E CD24-APC HDF75 HDF75, Day 7+15, PXGL SUSD2+CD24- population SUSD2-CD24+ population Day 7+13, PXGL 0 0.04 0.08 OCT4 0 0.09 0.18 NANOG 0 1.5 3 DNMT3L 0 0.05 0.1 KLF17 0 2 4 DPPA5 0 0.009 0.018 TFCP2L1 HD F1 6 HD F7 5 BJ HD F7 5 BJ niP SC 2 HD F1 6 HD F7 5 BJ HD F7 5 BJ niP SC 2 HD F1 6 HD F7 5 BJ HD F7 5 BJ niP SC 2 HD F1 6 HD F7 5 BJ HD F7 5 BJ niP SC 2 HD F1 6 HD F7 5 BJ HD F7 5 BJ niP SC 2 HD F1 6 HD F7 5 BJ HD F7 5 BJ niP SC 2 R el at iv e to A C TB R el at iv e to A C TB SUSD2 HDF16, P1 HDF75, P2+8 EPC, P5+6 A B C D OCT4 NANOG KLF17DAPI KLF4 TFCP2L1DAPI E 100 101 102 103 104 100 101 102 103 104 95.6 0.1 0.24.1 100 101 102 103 104 100 101 102 103 104 91.0 0.1 1.07.9 100 101 102 103 104 100 101 102 103 104 33.4 0.3 26.839.5 CD24-APC S U S D 2- P E 100 101 102 103 104 100 101 102 103 104 93.1 0.1 0.26.6 cR-H9 HDF16 BJ HDF75 Figure 3 0.1 1 10 DN MT 3L DP PA 5 KL F1 7 DP PA 3 TB X3 TF CP 2L 1 KL F4 OC T4 NA NO G SO X2 DN MT 1 DN MT 3A DN MT 3B OT X2 TC F1 5 BJ HDF16 HDF75 EPC HNES1 N or m al iz ed e xp re ss io n to H 9 10 5 10 10 4 3 2 10 SUSD2 0 20K 40K 60K FL 3 Area: PE-Texas Red 0 20 40 60 # C el ls 30.2 42.5 14.8 0 20K 40K 60K FL 3 Area: PE-Texas Red 0 50 100 150 200 # C el ls 62.8 24.4 2.9 0 20K 40K 60K FL 3 Area: PE-Texas Red 0 30 60 90 120 # C el ls 62.3 23.7 4.0 0 20K 40K 60K FL 3 Area: PE-Texas Red 0 30 60 90 120 # C el ls 61.3 23.8 4.0 0 20K 40K 60K FL 3 Area: PE-Texas Red 0 20 40 60 80 # C el ls 46.1 36.8 7.6 0 20K 40K 60K FL 3 Area: PE-Texas Red 0 20 40 60 80 100 # C el ls 62.1 23.8 4.2 0 20K 40K 60K FL 3 Area: PE-Texas Red 0 20 40 60 80 100 # C el ls 52.1 29.9 7.3 2N 4N >4N niPSC1 niPSC2 niPSC3 niPSC4 niPSC5 niPSC6 cR-H9EOS 0 0.06 0.12 niP SC 1-P 6 niP SC 1-P 10 niP SC 2-P 5 niP SC 2-P 11 niP SC 3-P 6 niP SC 3-P 10 niP SC 4-P 5 niP SC 4-P 11 niP SC 5-P 7 niP SC 5-P 10 niP SC 6-P 5 niP SC 6-P 11 HN ES 5 piP SC 1 piP SC 2 OCT4 0 0.18 0.36 niP SC 1-P 6 niP SC 1-P 10 niP SC 2-P 5 niP SC 2-P 11 niP SC 3-P 6 niP SC 3-P 10 niP SC 4-P 5 niP SC 4-P 11 niP SC 5-P 7 niP SC 5-P 10 niP SC 6-P 5 niP SC 6-P 11 HN ES 5 piP SC 1 piP SC 2 NANOG 0 1.5 3 niP SC 1-P 6 niP SC 1-P 10 niP SC 2-P 5 niP SC 2-P 11 niP SC 3-P 6 niP SC 3-P 10 niP SC 4-P 5 niP SC 4-P 11 niP SC 5-P 7 niP SC 5-P 10 niP SC 6-P 5 niP SC 6-P 11 HN ES 5 piP SC 1 piP SC 2 DPPA5 0 0.07 0.14 niP SC 1-P 6 niP SC 1-P 10 niP SC 2-P 5 niP SC 2-P 11 niP SC 3-P 6 niP SC 3-P 10 niP SC 4-P 5 niP SC 4-P 11 niP SC 5-P 7 niP SC 5-P 10 niP SC 6-P 5 niP SC 6-P 11 HN ES 5 piP SC 1 piP SC 2 KLF17 0 1 2 niP SC 1-P 6 niP SC 1-P 10 niP SC 2-P 5 niP SC 2-P 11 niP SC 3-P 6 niP SC 3-P 10 niP SC 4-P 5 niP SC 4-P 11 niP SC 5-P 7 niP SC 5-P 10 niP SC 6-P 5 niP SC 6-P 11 HN ES 5 piP SC 1 piP SC 2 DNMT3L A B Figure 4 niPSC G-banding CGH array niPSC2 46, XX[20], P21 46,XX, P14 niPSC3 46, XX[20], P16 niPSC4 46, XX[18], 47, XX,+5[2], P17 46,XX, P14 C TBX6 FOXA2 SOX17 SOX1 PAX6DAPI DAPI DAPI E ct od er m 101 102 103 104 105 101 102 103 104 105 1.4 84.9 9.93.8 101 102 103 104 10 101 102 103 104 105 2.2 82.2 4.111.4 niPSC4S6EOS C X C R 4- P E SOX17-APC DAPI 0 0.125 0.25 CDH2 0 0.02 0.04 SNAIL1 0 0.003 0.006 ZEB1 0 0.0008 0.0016 HES7 0 0.005 0.01 TBX6 0 0.035 0.07 LHX1 0 0.7 1.4 CER1 0 0.3 0.6 FZD8 0 0.015 0.03 HHEX 0 0.08 0.16 SOX1 0 0.0025 0.005 PAX6 0 0.001 0.002 BRN2 M es od er m Endoderm Naive Diff Naive Diff Naive Diff Naive Diff Naive Diff Naive Diff Naive Diff Naive Diff Naive Diff Naive Diff R el at iv e to A C TB R el at iv e to A C TB R el at iv e to A C TB R el at iv e to A C TB A B C D E F G Figure 5 pr im ed iP S C H N E S 1 ni P S C 2 ni P S C 4 0.5 0.6 0.7 0.8 E P I f ra ct io n of id en tit y −30 −20 −10 0 10 20 30 −2 0 −1 0 0 10 20 30 PC1 (46.91 %) P C 2 (1 2. 08 % ) Naive Primed HNES1 t2iLGöY laminin (Guo et al., 2017) cR S6 t2iLGöY laminin (Guo et al., 2017) niPS-C4-LAM niPS-C2-LAM niPS-C4-GEL HNES1-GEL niPS-C2-GEL HNES1-LAM Elf1 (Sperber et al., 2015) H1 NHSM/4i (Sperber et al., 2015) Lis1 NHSM/4i (Sperber et al., 2015) WIS2 NHSM/4i (Irie et al., 2015) cR H9 t2iLGö (Guo et al., 2017) cR H9 t2iLGöY (Guo et al., 2017) cR S6 t2iLGöY (Guo et al., 2017) cR S6 t2iLGöY laminin (Guo et al., 2017) WIBR2 5i/L/A (Ji et al., 2016) Conventional H1 (Sperber et al., 2015) Conventional H9 (Takashima et al., 2014) Conventional H9 (WTSI) Conventional S6EOS (Guo et al., 2017) Conventional WIBR (Ji et al., 2016) Conventional WIS2 (Irie et al., 2015) ES1 EPS (Yang et al., 2017) H1 EPS (Yang et al., 2017) Conventional H1 (Yang et al., 2017) HNES1 t2iLGöY (Guo et al., 2017) HNES1 t2iLGöY laminin (Guo et al., 2017) HNES t2iLGöY (Guo et al., 2016) H9 t2iLGö (Takashima et al., 2014) niPSC4 niPSC2 HNES1 primed iPSC A B Figure 6 0 20 40 60 80 hICM Reset H9 HNES1 Naive iPSC Primed H9 Primed HNES1 Primed iPSC 100 C pG m et hy la tio n (% ) C -100 -50 0 50 100 150 -40 -30 -20 -10 0 10 20 30 40 Tsne Dim1 Ts ne D im 2 hICM (Guo et al., 2014 Reset H9 (Takashima et al., 2014) HNES1 (Guo et al., 2017) Naive iPSC Primed H9 (Takashima et., 2014) Primed HNES1 (Guo et al., 2017) Primed iPSC D piPSC ni PS C2 ni PS C2 HNES1 E F piP SC 1 piP SC 2 niP SC 2.L niP SC 2.G niP SC 4.L niP SC 4.G HN ES 1.L HN ES 1.G 0 4 8 log2(RPKM) Inventory of supplemental information Supplemental figures and legends Figure S1. Wnt inhibition enhances naïve reprogramming by RNA, relates to Figure 1 Figure S2. Reproducibility of reprogramming, relates to Figure 2 Figure S3. EPC reprogramming, relates to Figure 3 Figure S4. RT-qPCR analysis of lineage induction, relates to Figure 4 Figure S5. Analysis of transposon element expression and CpG methylation, relates to Figure 5 Supplemental Tables Table S1. Taqman assays Table S2. PCR primers and related UPL probes Supplemental protocol mRNA reprogramming of HDFs and EPCs. DSUSD2 Phase PGL PGL-XAV PGL-IWP2 0 0.2 0.4 PGL DPPA5 0 0.05 0.1 PGL NANOG 0 0.4 0.8 PGL DNMT3L 0 0.008 0.016 PGL KLF17 0 0.15 0.3 PGL TBX3 0 0.04 0.08 PGL PGL- XAV PGL- IWP2 AXIN2 100 101 102 103 104 100 101 102 103 104 0.0837 65.8 29.74.42 100 101 102 103 104 100 101 102 103 104 0.0694 85.5 13.31.19 100 101 102 103 104 100 101 102 103 104 0.443 84.5 12.52.62 100 101 102 103 104 100 101 102 103 104 0.137 55.9 39.54.5 100 101 102 103 104 100 101 102 103 104 0.132 67.2 29.23.44 100 101 102 103 104 100 101 102 103 104 0.813 82.3 133.89 EpCAM-PE-Cy7 S U S D 2- P E S U S D 2- P E PGL PGL-XAV PGL-IWP2 EpCAM-PE-Cy7 HDF16 HDF75 PGL- XAV PGL- IWP2 PGL- XAV PGL- IWP2 PGL- XAV PGL- IWP2 PGL- XAV PGL- IWP2 PGL- XAV PGL- IWP2 R el at iv e to A C TB R el at iv e to A C TB HDF16 HDF75 A B C Day 4 Day 6 Day 7+1 BJ HDF16 Day 7+10 SUSD2 SUSD2 Figure S1 BJ HDF16 NANOG KLF17DAPI DAPI NANOG KLF17 BJ HDF16 Figure S2 A B C SUSD2 live staining PXGL E7 0.59 58.0 5.0436.4 101 102 103 104 105 101 102 103 104 105 1.52 72.3 7.8218.4 101 102 103 104 105 101 102 103 104 105 2.11 96.2 1.430.23 101 102 103 104 105 101 102 103 104 105 C D 24 -F IT C EpCAM-APC HDF16 HDF75 H9 Primed 4.72 74.0 18.03.31 101 102 103 104 105 101 102 103 104 105 2.33 55.3 38.63.81 101 102 103 104 105 101 102 103 104 105 0.11 99.5 0.370 101 102 103 104 105 101 102 103 104 105 S U S D 2- P E EpCAM-APC HDF16 HDF75 HNES1 D E PXGL E7 Naive Primed Primed Naive HDF16 HDF75 in Nutristem Day1-Day7 Day8 + 4 in E7 Day 8+12 in PXGL Naive Primed mRNA transfection (Day1- Day 4) DAPI OCT4 NANOG KLF17 OCT4DAPI KLF4 TFCP2L1 Daily mRNA transfection in EPC culture medium Day 1 - Day 8 Day 9Day 0 Plate EPC PXGL+Y 100 101 102 103 104 100 101 102 103 104 0.1 5.6 79.414.8 100 101 102 103 104 100 101 102 103 104 6.5 0.3 35.557.7 EpCAM-PECy7 S U S D 2- P E S U S D 2- P E CD24-APC A B C Naive iPSC reprogrammed from EPCs, P11 Figure S3 0 0.05 0.1 HDF75 EC26 EPC1 EPC2 NANOG 0 0.4 0.8 HDF75 EC26 EPC1 EPC2 DPPA5 0 0.004 0.008 HDF75 EC26 EPC1 EPC2 KLF17 0 0.4 0.8 HDF75 EC26 EPC1 EPC2 DNMT3L Re la tiv e to A C TB Re la tiv e to A C TB D 0 0.4 0.8 1.2 1.6 2 CER1 0 0.01 0.02 0.03 0.04 HHEX 0 0.02 0.04 0.06 0.08 LHX1 0 0.2 0.4 0.6 0.8 1 FZD8 A B C Figure S4 R el at iv e to A C TB 0 0.1 0.2 0.3 0.4 0.5 CDH2 0 0.001 0.002 0.003 HES7 0 0.01 0.02 0.03 0.04 SNAIL1 0 0.004 0.008 0.012 0.016 0.02 TBX6 R el at iv e to A C TB 0 0.005 0.01 0.015 0.02 0.025 BRN2 0 0.005 0.01 0.015 0.02 0.025 PAX6 0 0.05 0.1 0.15 0.2 0.25 0.3 0.35 0.4 SOX1 R el at iv e to A C TB 0 0.002 0.004 HDF16 HDF75 BJ EC26 HDF16 HDF75 BJ EC26 BRN2 0 0.004 0.008 HDF16 HDF75 BJ EC26 HDF16 HDF75 BJ EC26 PAX6 0 0.015 0.03 HDF16 HDF75 BJ EC26 HDF16 HDF75 BJ EC26 SOX1 0 0.2 0.4 HDF16 HDF75 BJ EC26 HDF16 HDF75 BJ EC26 FZD8 0 0.01 0.02 HDF16 HDF75 BJ EC26 HDF16 HDF75 BJ EC26 HHEX 0 0.04 0.08 HDF16 HDF75 BJ EC26 HDF16 HDF75 BJ EC26 LHX1 0 0.5 1 HDF16 HDF75 BJ EC26 HDF16 HDF75 BJ EC26 Diff Undiff CER1 R el at iv e to A C TB 0 0.04 0.08 HDF16 HDF75 BJ EC26 HDF16 HDF75 BJ EC26 CDH2 0 0.003 0.006 HDF16 HDF75 BJ EC26 HDF16 HDF75 BJ EC26 HES7 0 0.009 0.018 HDF16 HDF75 BJ EC26 HDF16 HDF75 BJ EC26 SNAIL1 0 0.003 0.006 HDF16 HDF75 BJ EC26 HDF16 HDF75 BJ EC26 TBX6 R el at iv e to A C TB R el at iv e to A C TB D E F Di ff Di ff Di ff Di ff Di ff HNES1 niPSC2 niPSC4 piPSC1 piPSC2 un dif f un dif f un dif f un dif f un dif f Di ff Di ff Di ff Di ff Di ff HNES1 niPSC2 niPSC4 piPSC1 piPSC2 un dif f un dif f un dif f un dif f un dif f Dif f Di ff Di ff Di ff Di ff HNES1 niPSC2 niPSC4 piPSC1 piPSC2 un dif f un dif f un dif f un dif f un dif f Dif f Di ff Di ff Di ff Di ff HNES1 niPSC2 niPSC4 piPSC1 piPSC2 un dif f un dif f un dif f un dif f un dif f Dif f Di ff Di ff Di ff Di ff HNES1 niPSC2 niPSC4 piPSC1 piPSC2 un dif f un dif f un dif f un dif f un dif f Di ff Di ff Di ff Di ff Di ff HNES1 niPSC2 niPSC4 piPSC1 piPSC2 un dif f un dif f un dif f un dif f un dif f Dif f Di ff Di ff Di ff Di ff HNES1 niPSC2 niPSC4 piPSC1 piPSC2 un dif f un dif f un dif f un dif f un dif f Di ff Di ff Di ff Di ff Di ff HNES1 niPSC2 niPSC4 piPSC1 piPSC2 un dif f un dif f un dif f un dif f un dif f Di ff Di ff Di ff Di ff Di ff HNES1 niPSC2 niPSC4 piPSC1 piPSC2 un dif f un dif f un dif f un dif f un dif f Di ff Di ff Di ff Di ff Di ff HNES1 niPSC2 niPSC4 piPSC1 piPSC2 un dif f un dif f un dif f un dif f un dif f Di ff Di ff Di ff Di ff Di ff HNES1 niPSC2 niPSC4 piPSC1 piPSC2 un dif f un dif f un dif f un dif f un dif f Diff Undiff Diff Undiff Diff Undiff Diff Undiff Diff Undiff Diff Undiff Diff Undiff Diff Undiff Diff Undiff Diff Undiff 20 40 60 80 100 20 40 60 80 100 pr im ed H 9 C pG m et hy la tio n (% ) 20 40 60 80 100 20 40 60 80 100 pr im ed H N E S 1 C pG m et hy la tio n (% ) 20 40 60 80 100 20 40 60 80 100 pr im ed H 9 C pG m et hy la tio n (% ) 20 40 60 80 100 20 40 60 80 100 pr im ed iP S C C pG m et hy la tio n (% ) naive iPSC CpG methylation (%) reset H9 CpG methylation (%) naive HNES1 CpG methylation (%) naive iPSC CpG methylation (%) Hypermetyhlated DMRs A IC M res et H9 HN ES 1 na ive iP SC pri me d H 9 pri me d H NE S1 pri me d i PS C PEG3 MCTS2P/HM13 IG−DMR DIRAS3 IGF1R GNAS−XL BLCAP/NNAT PLAGL1 IGF2 DMR2 IGF2 DMR0 IGF2R RB1 NESP−AS MEST L3MBTL PEG10 SNURF FAM50B GRB10 NAP1L5 INPP5F ZNF331 H19 KvDMR1 TRAPPC9 0 20 40 60 80 100 C pG m et hy la tio n (% ) B Figure S5 C D piP SC 1 piP SC 2 niP SC 2.G HN ES 1.L niP SC 2.L niP SC 4.L niP SC 4.G HN ES 1.G SVA_A SVA_B SVA_D HERVH LTR7 LTR8 SVA_F LTR5_Hs HERVK 0 4 8 log2(RPKM) Supplemental Figure Legends Figure S1. Wnt inhibition enhances naïve reprogramming by RNA, relates to Figure 1 S1A. Morphology BJ and HDF16 during reprogramming S1B. Images of HDF75 reprogramming culture in naïve capture medium, PGL and PGL with Wnt inhibitor, XAV939 (XAV) or IWP2. S1C. Flow cytometry analysis of EpCAM and SUSD2 expression after 12 days in PGL with XAV or IWP2. S1D. RT-qPCR analysis of markers after 12 days in PGL based medium. Scale bar, 100 µM. Error bars indicate s.d. of two technical replicates. Figure S2. Reproducibility of reprogramming, relates to Figure 2 S2A. Wells of reprogramming cultures after 13 days in PXGL, stained in situ with SUSD2-PE antibody. Scale bar, 2 mm S2B. Immunostaining for KLF17 and NANOG after 15 days in PXGL. Scale bar, 100 µM S2C. Schematic of reprogramming to primed and naïve iPSCs by RNA. S2D. Morphology of HDF16 and HDF75 after reprogramming to naïve and primed iPSCs. Scale bar, 100 µM S2E. Flow cytometry analysis of reprogramming to primed and naïve iPSCs. H9 primed and HNES1 are included as control for primed and naïve ESCs. Figure S3. EPC reprogramming, relates to Figure 3 S3A. Schematic of EPC reprogramming protocol S3B. Flow cytometry analysis of SUSD2, CD24 and EpCAM expression after three weeks in PXGL. S3C. Immunostaining of pluripotency markers in expanded EPC-derived naive iPSCs. Scale bar, 100 µM S3D. RT-qPCR analysis of three EPC derived niPSC cultures (EC26, EPC1, EPC2), comparing to HDF75 derived niPSCs. Error bars indicate s.d. of two technical replicates. Figure S4. RT-qPCR analysis of lineage induction, relates to Figure 5 S4A. Definitive endoderm induction of naive iPSCs (niPSC2, niPSC4) and primed iPSCs (piPSC1, piPSC2) S4B. Neuroectoderm induction of naive iPSCs (niPSC2, niPSC4) and primed iPSCs S4C. Paraxial mesoderm induction of naive iPSCs (niPSC2, niPSC4) and primed iPSCs S4D. Definitive endoderm induction of naïve iPSCs derived from HDFs and EPC S4E. Neuroectoderm induction of of naïve iPSCs derived from HDFs and EPC S4F. Paraxial mesoderm induction of naive iPSCs derived from HDFs and EPC Error bars indicate s.d. of three technical replicates. Figure S5. Analysis of transposon element expression and CpG methylation, relates to Figure 6 S5A. A heatmap showing the expression of known naive and primed-specific TEs (average expression of all TE loci of the subfamily). S5B. Scatter plots showing the expression of TE elements in niPSC2, C4 and HNES1 cells. TE elements from representative TE subfamilies that are differentially expressed between naïve and primed cells (Theunissen et al., 2016, Guo et al., 2017) are highlighted. S5C. Scatter plots of CpG methylation percentages over tiles spanning 20 kb. Regions with >10% gain in CpG methylation in reset H9-NK2 cells9 compared to conventional primed H9 cells are highlighted in blue in all scatterplots. S5D. Averaged CpG methylation of known DMRs of imprinted maternal and paternal genes. Table S1. Taqman assays, relates to experimental procedures Gene TaqMan Assay ID ACTB Hs01060665_g1 NANOG Hs02387400_g1 OCT4 Hs01654807_s1 KLF4 Hs00358836_m1 KLF17 Hs00703004_s1 TFCP2L1 Hs00232708_m1 DPPA3 Hs01931905_g1 DPPA5 Hs00988349_g1 DNMT1 Hs00945875_m1 DNMT3A Hs01027166_m1 DNMT3B Hs00171876_m1 DNMT3L Hs01081364_m1 SOX2 Hs01053049_s1 PRDM14 Hs01119056_m1 Table S2. PCR primers and related UPL probes, relates to experimental procedures Gene Forward Primer Reverse Primer UPL probe SOX1 accaggccatggatgaag cttaattgctggggaattgg 37 PAX6 ggcacacacacattaacacactt ggtgtgtgagagcaattctcag 9 BRN2 aataaggcaaaaggaaagcaact caaaacacatcattacacctgct 57 HHEX cggacggtgaacgactaca agaaggggctccagagtagag 61 LHX1 atgcaacctgaccgagaagt caggtcgctaggggagatg 80 CER1 gccatgaagtacattgggaga cacagccttcgtgggttatag 41 FZD8 cgccacgcgttaatttct ccggttctggaaccacac 19 CDH2 tgcacagatgtggacaggat ccacaaacatcagcacaagg 15 SNAI1 gcgagctgcaggactctaat cggtggggttgaggatct 62 HES7 gcagcctggaagagctga acggcgaactccaatatctc 78 TBX6 gaacggcagaaactgtaagagg gtgtgtctccgctcccatag 5 TCF15 tgttccgggacactctgg caggctgaatggatcctcac 80 ZEB1 agcacttaagaattcacagtggag catttcttactgcttatgtgtgagc 36 OTX2 gggtatggacttgctgcac ccgagtgaacgtcgtcct 81 TBX3 ggtcattaccaagtcgggaag tcagcagctataatgtccatcaa 26 Supplemental protocol 1. Reprogramming human dermal fibroblasts to naïve pluripotent stem cells Materials HDFa (human dermal fibroblast, adult) Irradiated mouse embryonic fibroblast (MEF) StemRNA 3rd Gen Reprogramming Kit (Stemgent,00-0076) Lipofectamine® RNAiMAX™ (Thermo Fisher Scientific, 13778150) Geltrex (hESC-Qualified, Thermo Fisher Scientific, A1413302) SUSD2 (PE conjugate) (BioLegend, 327406) Culture media Fibroblast culture medium DMEM high glucose (Merck, D5546), FBS (10%, Merck, F0804), L-glutamine (2 mM, Thermo Fisher Scientific, 25030-024), 2-mercaptoethanol (100 µM, Merck, M3148) Modified E7 medium Home made E6 basal medium (Chen et al., 2011) supplemented with 10 ng/mL FGF2 (prepared in- house). NutriStemTM hPSC XF Medium (Biological Industries, 01-0005) Naïve hPSC medium, PXGL N2B27 medium supplemented with MEK inhibitor PD0325901 (1 µM), Tankyrase inhibitor XAV939 (2 µM), aPKC inhibitor Gö6983 (2 µM), human LIF (10 ng/mL, prepared in-house)), Rho-kinase inhibitor Y-27632 (10 µM) Protocol 1: Day 0: Dissociate HDFs with TrypLE. Collect dissociated cells, pellet at 300g for 3 minutes and resuspend in fibroblast culture medium. Count cells and plate at a density of 1x104/cm2 on tissue culture plates pre-coated with Geltrex (1 µL/cm2). 2: Day 1: Switch to modified E7 medium and perform mRNA transfection following recommendation of StemRNA™-NM Reprogramming Kit protocol. 3: Day 2-4: Repeat mRNA transfection daily. Note: If excessive cell death is observed after mRNA transfection, it is recommended to plate fibroblasts at higher density. Alternatively, reducing mRNA transfection to 3 days is usually sufficient to generate at least 20 naïve colonies/4-well dish. 4: Day 5-6: Refresh culture with modified E7 medium. NutriStemTM can be used as an alternative medium. Note, by day 6, patches of cells with epithelial morphology should become apparent, indicating reprogramming has been initiated. 5: Day 7: Switch to human naïve culture medium, PXGL, and maintain for about two weeks. SUSD2 positive colonies should appear after 7-10 days in PXGL medium and can be visualised by live cell staining (Bredenkamp et al., 2019). Rock inhibitor (Y-27632) may be added to PXGL medium during reprogramming. Note, transfer to PXGL medium can be varied between Day 6 to Day 9. Delaying medium switch beyond Day 10 will significantly reduce reprogramming efficiency. 2. Reprogramming human blood outgrowth derived endothelial progenitor cells (EPC) to naïve pluripotent stem cells Materials EPC reprogramming uses the same materials as HDFa reprogramming, if not specified otherwise. EPC medium (50 mL) Endothelial Cell basal medium (PromoCell, c-22210) or EBM-2 Endothelial Cell basal medium (Lonza, cc-3156) 40-45 mL 5-10 mL heat-inactivated FBS (heat-inactivation is not necessary) (20% FBS when thawing the EPCs, 10% FBS for regular culture) Hydrocortisone (Lonza, cc-4112A) 16 µL hFGF-B (Lonza, cc-4113A) 160 µL VEGF (Lonza, cc-4114A) 16 µL R3-IGF-1 (Lonza, cc-4115A) 16 µL hEGF (Lonza, cc-4317A) 16 µL Ascorbic acid (Lonza, cc-4116A) 16 µL GA-1000 (Lonza, cc-4381A) 16 µL Reprogramming EPCs 1. EPCs are cultured according to (Ormiston et al., 2015). Cells are grown in 50 µg/mL Collagen I coated T-75 flasks with endothelial growth medium supplemented with growth factors with 10-20% FBS and without heparin (EPC medium). 2. When EPCs reach 80-90% confluence, cells are dissociated with TrypLE then resuspended at 2x106/mL in EPC medium. 3. Add 1-2x105 EPCs (0.5 mL) per well of a 4-well dish (coated with 2.4 µg/mL Laminin 511 (iMatrix-511, Reprocell, T303) at least 1 h before plating). 4. Next day, refresh with EPC medium about one hour before transfection. We normally do mRNA transfection after 5pm. 5. Perform mRNA cocktail transfection as detailed in StemRNA 3rd Gen Reprogramming Kit. 6. Next morning usually before 9-9.30am, refresh culture with fresh EPC medium; then late in the afternoon repeat mRNA transfection. 7. Repeat daily until Day 9. 8. Day 9, exchange to human naïve medium with 10 µM Y-27632 for naïve iPSC induction. 9. Following 15-20 days culture in naïve medium, naïve colonies should be readily identifiable by refractile dome-shaped morphology. At this point, naïve colonies can be picked or bulk passaged. 3. Passaging naïve cells 1. Dissociate culture with Accutase or TrypLE Express (about 5-10 minutes at 370C). 2. Pellet cells at 300g for 3 min. Aspirate and re-suspend cells in PXGL with Y-27632 (PXGLY). 3. Aliquot cells to plates coated with MEF feeders in PXGL plus Y-27632. We recommend adding Geltrex (0.5 µL per cm2) to cells at the time of passaging. 4. The next day, top up wells with fresh PXGL medium (without Y-27632). Subsequently, change half- medium daily until passaging. This normally takes 4-5 days culture in PXGL medium at a split ratio of 1:4 to 1:8. Do not let colonies grow too large. Note: A stable naïve iPSC culture will present with more than 80% SUSD2+CD24- cells after three passages in PXGL medium. If not, picking colonies or sorting for SUSD2+CD24- may be necessary to establish a stable iPSC culture. References: Bredenkamp, N., Stirparo, G.G., Nichols, J., Smith, A., and Guo, G. (2019). The Cell-Surface Marker Sushi Containing Domain 2 Facilitates Establishment of Human Naive Pluripotent Stem Cells. Stem Cell Reports. Chen, G., Gulbranson, D.R., Hou, Z., Bolin, J.M., Ruotti, V., Probasco, M.D., Smuga-Otto, K., Howden, S.E., Diol, N.R., Propson, N.E., et al. (2011). Chemically defined conditions for human iPSC derivation and culture. Nat Methods 8, 424-429. Ormiston, M.L., Toshner, M.R., Kiskin, F.N., Huang, C.J., Groves, E., Morrell, N.W., and Rana, A.A. (2015). Generation and Culture of Blood Outgrowth Endothelial Cells from Human Peripheral Blood. J Vis Exp, e53384.