ReportPeroxisome Proliferator-Activated Receptor g2 Controls the Rate of Adipose Tissue Lipid Storage and Determines Metabolic FlexibilityGraphical AbstractHighlightsd Mice lacking PPARg2 have impaired adipose tissue lipid storage rate d Low adipose tissue storage rate leads to metabolic inflexibility d Acute hypercaloric challenges can detect impaired adipose tissue lipid storage rate d Chronic adipose tissue metabolic inflexibility leads to insulin resistance with ageVirtue et al., 2018, Cell Reports 24, 2005–2012 August 21, 2018 ª 2018 The Authors. https://doi.org/10.1016/j.celrep.2018.07.063Authors Sam Virtue, Kasparas Petkevicius, Jose´ Maria Moreno-Navarrete, ..., Albert Koulman, Jose´ Manuel Ferna´ndez-Real, Antonio Vidal-Puig Correspondence sv234@medschl.cam.ac.uk (S.V.), ajv22@medschl.cam.ac.uk (A.V.-P.) In Brief Virtue et al. describe how the transcription factor peroxisome proliferator-activated receptor gamma 2 (PPARg2) regulates lipid storage rate in adipose tissue. Mice lacking PPARg2 cope when fat storage demands are low, but acute overfeeding overwhelms adipose tissue, redirecting lipid to muscle and causing insulin resistance. Cell Reports ReportPeroxisome Proliferator-Activated Receptor g2 Controls the Rate of Adipose Tissue Lipid Storage and Determines Metabolic Flexibility Sam Virtue,1,4,* Kasparas Petkevicius,1 Jose´ Maria Moreno-Navarrete,2 Benjamin Jenkins,1 Daniel Hart,1 Martin Dale,1 Albert Koulman,1 Jose´ Manuel Ferna´ndez-Real,2 and Antonio Vidal-Puig1,3,* 1The University of Cambridge Metabolic Research Laboratories, Wellcome Trust–MRC Institute of Metabolic Science, Cambridge CB2 0QQ, UK 2Biomedical Research Institute of Girona (IDIBGI), CIBERobn Pathophysiology of Obesity and Nutrition, Hospital of Girona ‘‘Dr. Josep Trueta,’’ Avinguda de Franc¸a s/n, and Department of Medical Sciences, Faculty of Medicine, University of Girona, Girona, Spain 3Wellcome Trust Sanger Institute, Hinxton CB10 1SA, UK 4Lead Contact *Correspondence: sv234@medschl.cam.ac.uk (S.V.), ajv22@medschl.cam.ac.uk (A.V.-P.) https://doi.org/10.1016/j.celrep.2018.07.063SUMMARY One understudied function of white adipose tissue (AT) is its role in postprandial lipid buffering. In this study, we demonstrate that mice lacking the adipose tissue-specific transcription factor peroxisome pro- liferator-activated receptor g2 (PPARg2) exhibit a defect in their rate of adipose tissue lipid storage. Impaired adipose tissue storage rate reduces metabolic flexibility, without compromising fasted glucose tolerance or insulin sensitivity, even following prolonged high-fat feeding. However, acutely over- feeding PPARg2-KO mice caused a 10-fold increase in insulin levels compared with controls. Although impaired adipose tissue storage rate did not result in insulin resistance in young mice, 1-year-old PPARg2-KO mice developed skeletal muscle insulin resistance.Ourdata indicate that failedadipose tissue storagemayoccurprior todefects inglucosehandling and that overfeeding protocols may uncover genes controlling adipose tissue storage rate, as opposed to capacity, and act as a diagnostic test for early- stage human metabolic disease. INTRODUCTION The epidemic of obesity has led to epidemics of diabetes and cardiovascular disease. An important question is how obesity leads to metabolic complications. A proposed mechanism link- ing obesity to metabolic complications is the concept of adipose tissue (AT) expansion and lipotoxicity. The adipose tissue expan- sion hypothesis suggests that metabolic complications occur when an individual’s adipose tissue storage capacity is ex- ceeded (Virtue and Vidal-Puig, 2010), that preventing adipose tissue expansion will worsen metabolic complications (Danforth, 2000), whereas unlimited adipose tissue expansion would be metabolically protective, a concept demonstrated in mice (Kim et al., 2007).Cell R This is an open access article undWe previously reported (Medina-Gomez et al., 2005) the phenotype of mice lacking peroxisome proliferator-activated re- ceptor g2 (PPARg2). PPARg2 is the adipose tissue-specific iso- form of PPARg. Surprisingly, despite defective adipogenesis in vitro, mice lacking PPARg2 had normal adipocyte size on a chow diet (Medina-Gomez et al., 2005), as well as normal glucose and insulin tolerance on chow or chronic high-fat (3 months of feeding) diets. However, crossing the PPARg2- knockout (KO) mouse onto an ob/ob background (POKOmouse) led to severe metabolic syndrome. Importantly, defects in insulin sensitivity in POKO mice occurred before any divergence in adiposity between genotypes (Medina-Gomez et al., 2007). The early onset of metabolic impairments in POKO mice raised the question as to which aspect of leptin deficiency was driving the phenotypic divergence. Furthermore, why PPARg2-KOmice on a non-obese background were metabolically healthy was unresolved. Although PPARy2 KO mice had normal-sized adipocytes on a chow diet, they showed molecular markers of impaired adipo- cyte function (Medina-Gomez et al., 2005). Dysfunctional adi- pose tissue function has been suggested to lead to impaired metabolic flexibility in both humans (Frayn, 2002) and rodents (Asterholm et al., 2012; Asterholm and Scherer, 2010). Metabolic inflexibility is the inability to switch efficiently between predomi- nantly using lipid in the fasted state to carbohydrate in the fed state (Goodpaster and Sparks, 2017; Storlien et al., 2004). In hu- mans, obesity is characterized by low metabolic flexibility (Stor- lien et al., 2004). Although direct defects in muscle lipid and glucose use have been suggested to causemetabolic inflexibility (Ukropcova et al., 2007), defects in adipose tissue function can also cause metabolic inflexibility by altering the fluxes of lipids to muscle (Frayn, 2002). Dysfunctional adipose tissue fails to store postprandial lipid and redirects it to non-adipose organs. Conversely, in the fasting state, insufficient release of free fatty acids (FFAs) by adipose tissue occurs because of impaired lipol- ysis (McQuaid et al., 2011). Although multiple studies have investigated metabolic flexi- bility in mice (Asterholm et al., 2012; Asterholm and Scherer, 2010; Gao et al., 2015; Isken et al., 2010; Jackowski and Leo- nardi, 2014; Longo et al., 2008; Muoio et al., 2012; Riachieports 24, 2005–2012, August 21, 2018 ª 2018 The Authors. 2005 er the CC BY license (http://creativecommons.org/licenses/by/4.0/). 0 20 40 60 80 100 120D 0 0.5 1 1.5 2 2.5 3 3.5 RD GIR HGP 0 4 8 12 16 0 20 40 60 80 100 120 0 1 2 3 4 5 6 7 uM ol /m ou se /m in 0 2 4 6 8 10 0 20 40 60 80 100 120 A B C 0 20 70 50 40 30 10 S up re ss io n of H G P (% ) G lu co se (m M ol ) E xo G lu co se (m M ol ) E nd o G lu co se (m M ol ) S up re ss io n of F FA (% ) 0 15 35 30 25 20 10 5 WT PPARγ2 KO 0.7 0.8 0.9 1 1.1 R E R 0 0.1 0.2 0.3 0.4 0.7 0.8 0.9 1 1.1 08 :41 11 :41 14 :41 17 :41 20 :41 23 :41 02 :41 05 :41 08 :41 R E R 0 2 4 6 8 10 12 0 2 4 6 8 Time (Hours) TG (m M ol /l) * * * F K E I JH WT PPARγ2 KO Time of day *AOC 0 2 4 6 8 0 20 40 60 80 100 120 0 4 8 12 16 20 0 20 40 60 80 100 120 0 3 6 9 12 15 0 20 40 60 80 100 120 G lu co se (m M ol ) Time (mins) E xo G lu co se (m M ol ) Time (mins) Time (mins) E nd o G lu co se (m M ol ) Time (mins) Time (mins) 8 * * *AOC 60 Low High ∆R E R Time (mins) G Figure 1. PPARg2-KO Mice Exhibit Altered Carbohydrate and Lipid Metabolism in the Fed State (A–C) Fasted glucose tolerance tests fromWT and PPARg2-KOmice: (A) total, (B) exogenous, and (C) endogenous glucose. (D) Hyperinsulinemic-euglycemic clamps: rate of disposal (RD), glucose infusion rate (GIR), and hepatic glucose production (HGP) in the hyper- insulinemic state (left), suppression of HGP (middle), and suppression of NEFA from basal to hyperinsulinemic state (right) (n = 7 WT and n = 9 KO for GTT, n = 8 WT and n = 5 KO for clamps). (E–G) Metabolic flexibility shown by (E) represen- tative plot of 24 hr respiratory exchange ratio (RER) determined by indirect calorimetry, (F) lowest and highest 10% of RER values for WT and PPARg2-KO mice, and (G) dRER (n = 8 mice per group). (H–J) Fed glucose tolerance tests: (H) total, (I) exogenous, and (J) endogenous glucose (n = 6WT and n = 9 KO). (K) Lipid clearance in PPARg2-KO and WT mice (n = 9 WT, n = 8 KO). *p < 0.05, two-tailed Student’s t test. All mice were 4–5 months of age. All data are represented as mean ± SEM. See also Figure S1.et al., 2004; Vacanti et al., 2014; Vaitheesvaran et al., 2010; Vroe- grijk et al., 2013), translating murine data to humans is compli- cated because of their different feeding patterns. Mice eat multiple small meals per day (Ellacott et al., 2010), and as a result, the rate at which the adipose tissue of mice is required to store and release lipid maybe relatively low. In contrast, hu- mans tend to eat three large meals a day, causing fewer more acute demands for adipose tissue lipid storage (McQuaid et al., 2011). Overall, a loss of adipose tissue flexibility may man- ifest differently in rodents and humans. The most commonly used model for inducing obesity and insulin resistance in mice is high-fat diet (HFD) feeding. HFD causes many mouse strains to consume more calories and gain weight, but after an initial period of rapid body weight2006 Cell Reports 24, 2005–2012, August 21, 2018gain, usually lasting less than 1 week, body weight divergence between HFD and chow-fed mice tends to be relatively slow. The slow rate of weight gain caused by established HFD suggests that chronic HFD may not actually greatly in- crease demands on adipose tissue stor- age rate. In this study, we reinvestigated PPARg2-KO mice. Although PPARg is traditionally viewed as a regulator of adi- pogenesis, PPARg2 is regulated by fast- ing and refeeding (Vidal-Puig et al., 1997), suggesting an additional dynamic role for PPARg2. Supportive of this concept, PPARg2 is necessary for appro- priate expression of lipolytic genes in ad-ipocytes (Rodriguez-Cuenca et al., 2012). In this study, we demonstrate that PPARg2-KOmice have a reduced adipose tis- sue lipid storage rate and exhibit metabolic inflexibility. In states in which adipose tissue lipid storage rates are low, mice lacking PPARg2 have normal insulin and glucose levels. To challenge adipose tissue storage rate, we exploited the fact that mice dramatically over-eat when initially switched to an HFD. In response to 1 day of high-fat feeding (1dHFD), PPARg2-KO mice failed to store lipid in adipose tissue and redirect it to mus- cle, causing triglyceride (TG) accumulation and insulin resis- tance, with PPARg2-KO mice exhibiting 10 times the insulin levels of controls. Importantly, mice lacking PPARg2 developed insulin resistance with aging, suggesting that a primary loss of adipose tissue lipid buffering may be initially tolerated but 020 60 100 Chow 1dHFD 0 0.4 0.8 1.2 1.6 2 0 0.2 0.4 0.6 0.8 1 1.2 1.4 0 10 20 30 40 0 0.4 0.8 1.2 1.6 2 BAT scWAT eWAT Liver 0 2 4 6 8 10 12 FI (k J/ da y) dE E (J /m in /m ou se ) dB W (g ) B W (g ) Ti ss ue w ei gh t ( g) % L iv er F at A B C D E F ** * * WT Chow KO Chow WT 1d HFD KO 1d HFD 0 2 4 6 8 10 12 Chow 1day 1month 0 0.5 1 1.5 2 2.5 3 Chow 1day 1month 0 0.2 0.4 0.6 0.8 1 1.2 1.4 Chow 1day 1month 0 2 4 6 8 10 12 Chow 1day 1month FF A (m M ol ) TG (m M ol ) G lu co se (m M ol ) * * * G H I J WT 1m HFD KO 1m HFD In su lin (u g/ l) 40 80 Figure 2. PPARg2-KO Mice Exhibited Impaired Metabolic Responses to Acute Overfeeding (A–F) Responses to 1 day high-fat diet (1dHFD): (A) food intake, (B) change in energy expenditure (dEE), and (C) change in body weight (dBW) be- tween chow and after 1dHFD; (D) body weight, (E) tissue weights, and (F) liver fat percentage after 1dHFD period. (G–J) Serum biochemistry for (G) insulin, (H) TGs, (I) FFAs, and (J) glucose after 1dHFD. N = 8 per group except 1 month HFD KO and food intake for chow and 1dHFD WT (n = 6). *p < 0.05, two-tailed Student’s t test. All mice were 4 months of age. All data are represented as mean ± SEM. See also Figures S1 and S2.ultimately leads to metabolic disease. Finally, we demonstrate that, in line with a potential acute metabolic role for PPARg2 in adipocytes, PPARg2 but not PPARg1 correlates with whole- body and adipose tissue insulin sensitivity in humans. RESULTS AND DISCUSSION PPARg2-KO mice had normal fasting glucose tolerance (Figures 1A–1C) (Medina-Gomez et al., 2005), insulin levels (Figure S1A), glucose infusion rate (GIR), rate of whole-body glucose disap- pearance (RD), and hepatic glucose production (HGP) during a euglycemic-hyperinsulinemic clamp (Figure 1D). However, PPARg2-KO mice had reduced metabolic flexibility in the fed state (Figures 1E–1G). On the basis of their amplitude of respira- tory exchange ratio (RER), PPARg2-KO mice had increased glucose oxidation in the light phase and increased lipid oxidation in thedarkphase relative to controls (Figure1F). To investigate the increased glucose oxidation in the light phase, we performed a glucose tolerance test (GTT) in the fed state at 10 a.m., incorpo- rating stable isotopes. Consistent with their RER profile, mice lacking PPARg2 exhibited increased clearance of exogenous glucose (Figures 1H–1J). The PPARg2-KO mice also exhibited reduced RER during the night phase, suggesting that PPARg2 mice may have impaired adipose tissue lipid storage leading toCell Repexcess delivery of lipid to muscle (Randle et al., 1963), and in line with this concept, mice lackingPPARg2wereunable toclear an oral lipid load as effectively as controls, exhibiting higher TG (Figure 1K) and FFAs (Figure S1B) during a lipid tolerance test. In response to chronic HFD, mice lack- ing PPARg2 have normal carbohydrate metabolism and adipose tissue mass (Medina-Gomez et al., 2005). However, given their compressed RER profiles and inability to clear lipids, we hypothe- sized that PPARg2-KO mice may exhibit a defect in the rate of adipose tissue lipid storage, rather than total storage capac- ity. This hypothesis was also supported by the early onset (4 weeks of age) of hy-perinsulinemia in POKO mice, an age at which ob/ob mice are already hyperphagic but prior to a divergence in adiposity rela- tive to controls (Medina-Gomez et al., 2007). To stress adipose tissue storage rate, we developed an overfeeding challenge by giving mice a high-fat diet for 1 day (1dHFD). We first character- ized 1dHFD in wild-type mice. Mice on 1dHFD doubled food intake (Figure S1C) and increased insulin levels (Figure S1D) to maintain normoglycemia (Figure S1E). Body weight and subcu- taneous white adipose tissue (scWAT) mass were increased (Figures S1F–S1H). Finally, Pparg2 expression in scWAT was physiologically increased in response to 1dHFD, suggestive of a role for PPARg2 in responding to overfeeding (Figure S1I). PPARg2-KO mice placed on HFD for 1 day exhibited similar food intake (Figure 2A), diet-induced thermogenesis (Figure 2B), and body weight gain (Figure 2C) to controls, whereas absolute body weight, BAT weight, liver weight, and liver fat percentage were increased (Figures 2D–2F). When subjected to 1dHFD, PPARg2-KO mice exhibited dramatically increased insulin levels and increased glucose and FFA levels compared with 1dHFDwild-type controls. Impor- tantly, prolonged HFD feeding (for either 1 week or 1 month) normalized the serum biochemistry parameters of PPARg2-KO mice (Figures 2G–2J, S1L, and S1M), even though PPARg2-KO mice after 1 month of HFD had greater adiposity (Figures S1Jorts 24, 2005–2012, August 21, 2018 2007 00.5 1 1.5 Angptl4 Lpl Gpihbp1 0 0.5 1 1.5 Fatp1 Cd36 Got2 0 0.5 1 1.5 Atgl Hsl Perilipin WT Chow KO Chow WT 1d HFD KO 1d HFD WT 1m HFD KO 1m HFD pHSL S660 tHSL pP44 MAPK pP42 MAPK tP44 MAPK tP42 MAPK pAKT s473 tAKT B-actin pA KT /tA KT pP 44 /tP 44 pP 42 /tP 42 pH SL /tH SL tHS L/b act in tAK T/B act in W T 1 dH FD KO 1d HF D W T C ho w KO C ho w A B C D E R el at iv e ex pr es si on R el at iv e ex pr es si on R el at iv e ex pr es si on A rb itr ar y U ni ts * * * * * * * * * * * * * * * * 0 40 80 120 160 200 240 280 D pm /u l o f s er um F I 0 2 4 6 8 10 12 sc W AT N E /E F A 20 40 60 80 100 120 140 D pm /m g of s cW AT * * * J 0 Fas Elovl6 Scd1 Srebp1c M P 0.5 1 1.5 0 R el at iv e E xp re ss io n R el at iv e E xp re ss io n * * 0 0.5 1 1.5 N R el at iv e E xp re ss io n Irs1 Irs2 F4/80 0 0.2 0.4 0.6 0.8 1 1.2 1.4 pAKT s473 tAKT pP42 MAPK tP42 MAPK B-actin A rb itr ar y U ni ts pA KT /tA KT pP 42 /tP 42 W T 1 dH FD KO 1d HF D W T C ho w KO C ho w WT KO Chow 1d HFD 1m HFD * G H K L 0 0.5 1 1.5 2 2.5 3 3.5 0 500 1000 1500 2000 2500 3000 A di po cy te A re a (μ m ²) 3500 * * * * * * 0 0.5 1 1.5 2 2.5 * * * * 3 Angptl4 Lpl Fatp1 Dgat1 Dgat2 0 0.5 1 1.5 2 O R el at iv e E xp re ss io n 2.5 Aox Cpt1a Cpt1b Lcad Pgc1a Pgc1b * * Figure 3. Mice Lacking PPARg2 Cannot Appropriately Store Lipid in Adipose Tissue (A–C) Gene expression in WAT for (A) lipoprotein lipase and regulatory molecules and (B) FA uptake genes. (C) Markers of lipolysis (n = 8 mice per group except 1 month HFD KO [n = 7]). (D and E) Western blots of WAT: (D) representative western blots and (E) quantification (n = 8 mice per group). (legend continued on next page) 2008 Cell Reports 24, 2005–2012, August 21, 2018 and S1K) than PPARg2-KOmice after 1dHFD (Figure 2E). Finally, we conducted a fasting-refeeding experiment and demon- strated that mice lacking PPARg2 had greatly increased insulin in response to refeeding after an overnight fast (Figures S2A and S2B). Overall, our data suggested a lack of PPARg2 impaired adipose tissue lipid storage rate and a failure in adipose tissue storage rate caused insulin resistance in response to overnutrition. We next sought to confirm that PPARg2-KO adipose tissue was unable to buffer lipid appropriately. We first analyzed gene expression in scWAT. In terms of genes controlling hydrolysis of TG to FFAs, lipoprotein lipase (Lpl) tended to be upregulated, whereas the LPL inhibitory protein angiopoietin-like 4 (Angptl4) was downregulated in PPARg2-KO scWAT after 1dHFD (Fig- ure 3A). The FFA transporter-encoding genes FA transport pro- tein (Fatp1) and Cd36 were downregulated in PPARg2-KO mice by 1dHFD (Figure 3B). The trend to upregulation of Lpl and the downregulation of Angptl4, Cd36, and Fatp1 were consistent with the normal TG levels and increased FFAs in PPARg2-KO mice following 1dHFD. To exclude a role for lipol- ysis in regulating circulating FFA levels, we analyzed expression of adipose TG lipase (Atgl), which was downregulated under high-fat feeding conditions and hormone sensitive lipase (Hsl), which was downregulated under all nutritional conditions (Fig- ure 3C) in PPARg2-KO mice. HSL phosphorylation at the activa- tory S660 site was decreased in the scWAT of PPARg2-KOmice following 1dHFD (Figures 3D and 3E), while insulin signaling, a known suppressor of lipolysis, was either similar (ratio of phos- pho-AKT to total AKT) or upregulated (ratio of phospho-P44/42 ERK to total P44/42 ERK), in line with the increased circulating insulin levels. Overall, and in line with our previous work (Rodri- guez-Cuenca et al., 2012), the elevated FFAs in PPARg2-KO mice were unlikely to be a result of FFA release by adipose tissue but a result of a defect in FFA uptake. To confirm a defect in FFA transport into adipose tissue, we used the fact our HFDhas an increased nonessential (NE)/essen- tial (E) FA ratio compared with chow. Feeding mice an HFD leads to a progressive increase in NE/E FA ratio in white adipose tissue (WAT) (Yew Tan et al., 2015). Wild-type (WT) and PPARg2-KO mice had similar NE/E FA ratios under chow conditions, but 1 day HFD increased NE/E FA ratio only in WT mice (Figures 3F and S2C), a difference that was normalized between geno- types after 1month of HFD. Importantly, this analysis detects ex- isting fat as well as newly stored fat. The 15% increase in NE/E ratio in WT mice was in good agreement with the 20% increase in fat mass observed in response to 1dHFD (Figure S1G), sug- gesting that most of the fat accumulating in the scWAT of WT(F) The ratio of non-essential to essential FAs in adipose tissue fromWT and PPAR WT chow, 1 month HFD WT and KO). (G andH)Morphometric analysis of sections ofWAT fromWT and PPARg2-KOmi adipocyte cross-sectional area (n = 8 per group KO chow, 1 day HFD KO and 1 (I and J) Radioactive palmitate levels in (I) blood and (J) scWAT from WT and PPA group). (K and L) Western blots from muscle: (K) representative western blots and (L) qu (M–P) Gene expression in muscle for (M) FA oxidative markers, (N) insulin sensitiv (n = 8 mice per group except 1 month HFD KO [n = 7]). For multiple time points, two-way ANOVA was performed, and if significant, pairw All mice were 4–5 months old. All data are represented as mean ± SEM. See alsmice was dietary derived. Further support for a lack of lipid up- take to adipocytes was provided by histological analysis of WT and PPARg2-KO mouse adipocyte sizes. Although WT mice increased their adipocyte size following 1dHFD, PPARg2-KO mice did not (Figures 3G and 3H). Finally, we traced palmitate uptake to WAT under euglycemic-hyperinsulinemic clamp con- ditions. PPARg2-KO mice exhibited increased 14C-palmitate in blood (Figure 3I) and decreased incorporation into adipose tis- sue (Figures 3J and S2D–S2F). Overall, these results suggested that elevated circulating FFA levels in PPARg2-KO mice were caused by a failure to uptake and esterify FFAs into WAT, a concept further supported by the elevated FFAs during a lipid tolerance test (LTT) (Figure S1B). The failure of adipose tissue to clear FFAs (Figure 3J) suggested apotential increasedfluxofFFAs tootherorgans (Virtue andVidal- Puig, 2010), which we next sought to investigate. In liver, mice lacking PPARg2 exhibited a more lipogenic response to acute overfeeding than WTs (Figures S2G–S2K), potentially reflecting the increased insulin levels (Figure 2G), but no differences in FA oxidation markers or changes in the phosphorylation status of in- sulin signalingmolecules (Figures S2L and S2M). Similarly to liver, no defects in brown adipose tissue (BAT) insulin signaling (Figures S3A and S3B), or glucose disposal into BAT or WAT (Figure S3C) were detected. Conversely, AKT phosphorylationwas impaired in skeletal muscle after 1dHFD in PPARg2-KOmice (Figures 3K and 3L). Muscle gene expression showed that several oxidativemeta- bolism genes in PPARg2-KO mice (Figure 3M) reached levels of expression after 1dHFD that were similar to or greater than those observed for either WT or PPARg2-KOmice after 1 month of high feeding. Additionally, lipid uptake andTGstoragegenes tended to be increased in the muscle of PPARg2-KO mice compared with controls (Figure 3O). HFD did not modifymRNAmarkers of insulin sensitivity in PPARg2-KO muscles (Figure 3N) or markers of lipo- genesis (Figure 3P) between genotypes. To validate gene expression changes, we analyzed muscle lipid composition. On a chow diet, WT and PPARg2-KO mice had largely similar muscle lipidomes (Figure S3D) that could not be separated using multivariate analyses (Figures 4A and 4B), but following 1dHFD, a significant separation in the lipid pro- files was detectable (Figures 4A and 4B). PPARy2-KO mice accumulatedmore longer chain FA-containing TGs than controls (Figure 4C). Finally, we measured the acylcarnitine profile of the muscles. Under chow conditions, and consistent with their increased carbohydrate oxidation in the light phase, mice lack- ing PPARg2 had less short-chain acyl carnitines, but this pheno- type was reversed by 1dHFD (Figures 4D and S3E). In summary, our data supported the idea that PPARg2-KO mice exhibit ag2-KOmice (n = 8 per group KO chow, 1 day HFDWT and KO, n = 7 per group, ce: (G) representative images (scale bar shows 100 mM) and (H) quantification of month HFD WT, n = 7 per group, KO chow, 1dHFD WT 1 month HFD KO). Rg2-KO mice under hyperinsulinemic-euglycemic clamp conditions (n = 6 per antification (n = 8 per group). ity markers, (O) lipid uptake and storage genes, and (P) lipid biosynthetic genes ise comparisons were performed using two-tailed Student’s t test (*p < 0.05). o Figures S2 and S3. Cell Reports 24, 2005–2012, August 21, 2018 2009 00.6 1.2 1.8 F480 0 0.2 0.4 0.6 0.8 1 1.2 Angptl4 Fatp1 Lpl 0 0.2 0.4 0.6 0.8 1 1.2 1.4 Aox Cpt1a Lcad Pgc1a Pgc1b 0 0.2 0.4 0.6 0.8 1 1.2 Dgat1 Dgat2 Elovl6 Fas Scd1 Srebp1c 0 0.2 0.4 0.6 0.8 1 1.2 Irs1 Irs2 0 1.5 3 4.5 RD GIR HGP 0 20 60 70 50 40 30 10uM ol /m ou se /m in S up re ss io n of H G P % 0 20 50 40 30 10 * B od y W ei gh t ( g) R el at iv e E xp re ss io n R el at iv e E xp re ss io n R el at iv e E xp re ss io n R el at iv e E xp re ss io n * * E F H I J K L WT 1 year old KO 1 year old * * * *** * * G R el at iv e E xp re ss io n R² = 0.217 P=0.001 R² = 0.130 P=0.016 R² = 0.094 P=0.04 0 2 4 6 8 10 12 14 16 0 2 4 6 8 10 12 M -V al ue 0 0.5 1 1.5 2 2.5 3 IR S 1 0 0.2 0.4 0.6 0.8 1 1.2 1.4 G lu t4 PPARγ2 0 2 4 6 8 10 12 14 16 PPARγ2 0 2 4 6 8 10 12 14 16 PPARγ2 M N O -4 -2 0 2 4 -8 -6 -4 -2 0 2 4 6 8 t[2 ] t[1] KO1 KO2 KO3 KO4 O 5 KO6 KO7 KO8 Chow WT1 WT2 WT3 WT4 WT5 WT6 WT7 Chow WT8 -5 0 5 -12-10-8-6 -4-2 0 2 4 6 8 1012 t[2 ] t[1] KO2 KO3KO4 KO5KO6 KO7 KO8 WT1 WT2 WT3WT4T5WT6 WT7WT8 -4 -3 -2 -1 0 1 2 3 4 t[1] t[2] 0 50 100 150 200 250 0 5 10 15 20 25 30 WT Chow KO Chow WT 1d HFD KO 1d HFD Lo ad in g C oe ffi ci en ts Chow 1d HFD Tr ig ly ce rid es ng /m g pr ot ei n A cy l C ar na tin es ng /m g pr ot ei n >50 Carbons <50 Carbons Short Chain Mid/long Chain A B C D * * 0.07 0.06* Figure 4. Loss of Adipose Tissue Lipid Buffering Leads to Aging-Related Insulin Resistance (A) Principal-component analysis of lipid species frommuscleof chow (left) or 1dHFD (right) fedmice. (B) Quantification of the first two principal com- ponents from (A). (C) Muscle TG species. (D) Muscle acylcarnitines species (n = 6–8 per group). (E–I) Gene expression in muscle of 1-year-old mice: (E) F4/80, (F) FA oxidative markers, (G) lipid uptake and storage genes, (H) lipid biosynthetic genes, and (I) Insulin sensitivity markers (n = 10 WT, n = 7 KO, male mice chow fed). (J–L) Clamps from 1-year-old mice: (J) rate of glucose disposal (RD), glucose infusion rate (GIR), and hepatic glucose production (HGP) under hyperinsulinemic condition; (K) suppression of HGP between the basal and hyperinsulinemic state; and (L) body weights of mice used for clamps (n = 7 WT and 6 KO mice, chow fed). (M–O) Correlations between PPARg2 expression in human scWAT and (M) M-value during a clamp, (N) IRS1 expression, and (O) Glut 4 expression (n = 45 subjects). For multiple time points, two-way ANOVA was performed, and if significant, pairwise compari- sons were performed using two-tailed Student’s t test (*p < 0.05). Correlations are Pearson’s, and exact p values are reported. All mice were 4–5 months old. All data are represented as mean ± SEM. See also Figures S3 and S4.primary defect in adipose tissue storage rate, which in the context of acute overfeeding drives FFA flux to muscle. Increased FFA flux to muscle leads to lipid accumulation, lipo- toxicity-induced insulin resistance, and compensatory upregula- tion of the FA oxidation program (Randle et al., 1963). Although 1dHFDwas able to unmask the underlyingmetabolic defects of PPARg2 ablation, even under chow conditions, mice lacking PPARg2 had impaired metabolic flexibility (Figure 1E) and increased expression of the lipid oxidation genes Aox and2010 Cell Reports 24, 2005–2012, August 21, 2018Cpt1b (Figure 3M) in skeletal muscle. To determine if a loss of metabolic flexibility due to adipose tissue dysfunction led to longer term metabolic complications, we aged PPARg2-KO mice and controls on a chow diet for 1 year. Aged mice lacking PPARg2 exhibited decreased expression ofPgc1a (Figure 4F) and insulin sensitivity markers including the FA synthesis pro- gram and Irs1 (Figures 4H and 4I) and increased expression of the macrophage marker F4/80 (Figure 4E) in muscle. Notably, other than a tendency toward reducedScd1 expression, these changes were absent in themuscles of youngmice on a chow diet (Figures 3M–3P). These molecular changes manifested in skeletalmuscle insulin resistance, with aged PPARg2-KO mice exhibit- ing lower RD, reduced GIR, and normal HGP (Figures 4J–4L) as well as increased fed insulin levels (Figures S3F–S3J) compared with WTs. Adipose tissue showed relatively little further impairment with aging compared with young animals (Figures S4A–S4E), and liver exhibited almost no changes be- tween PPARg2-KO and WTs (Figures S4F–S4J). The human relevance of our observations was confirmed in adipose tissue from 45 obese subjects who had undergone a euglycemic-hyperinsulinemic clamp. PPARg2, but not PPARg1, expression in scWAT correlated with M-value as well as IRS1 and GLUT4 (Figures 4M–4O and S4K–S4M). Our study identifies PPARg2 as a crucial regulator of adipose tissue lipid storage rate, in addition to its role in adipose tissue development and total storage capacity. A reduction in adipose tissue storage rate limits the ability of adipose tissue to respond acutely to large nutrient influxes and causes metabolic inflexi- bility that chronically leads to insulin resistance. Our data there- fore suggest a possible evolutionary rationale for the presence of PPARg2 in mature adipocytes, as a nutritional integrator of lipid uptake and release that controls the availability of FFAs (Rodri- guez-Cuenca et al., 2012) and gluconeogenic substrates (Perry et al., 2015; Titchenell et al., 2016) in the fasted state and permits appropriate lipid storage in the fed state. Because the mouse model of PPARg2 ablation we have used is a total KO, we cannot exclude effects of PPARg2 in other organs, but PPARy2 is almost exclusively expressed in adipose tissue (Escher et al., 2001). Furthermore, although it is possible that effects on lipid uptake and release could be secondary to alterations in adipo- genesis, we observed these defects in chow-fed mice at an age when PPARg2-KO animals possess normal adipocyte numbers (Figures 3G and 3H). Under laboratory conditions of ad libitum access to food, mice do not eat like humans, consumingmany small meals throughout the day (Ellacott et al., 2010). Conversely, most humans consume a small number of large meals a day and occasionally tend to over-eat. As such, the nutrient load that humans face is more infrequent, with a larger and more variable amplitude than that faced by mice. Although not perfectly analogous to the human breakfast-lunch-dinner feeding pattern, the 1dHFD model in rodents increases the amplitude of their nutrient intake and importantly keeps them in circadian phase. The 1dHFD modelmay therefore provide amore translatablemetabolic chal- lenge than traditional chronic HFDs for the study of adipose lipid storage function, and it is likely that other mouse models with similar defects maybe uncovered using a 1dHFD protocol. Our results also raise questions regarding how metabolic dis- ease is diagnosed and studied in humans. Currently there is a bias toward studying human and mouse metabolism in the fasted state. Equally, diagnostic tests for human metabolic dis- ease are conducted almost exclusively in the fasted state to con- trol for human meal choices. By extension, our data suggest that there are humans with primary adipose tissue defects who exhibit normal GTT results but become metabolically dysfunc- tional after eating. It is possible that a hypercaloric mixed meal tolerance test would be the most suitable way to detect such in- dividuals. Finally, our data suggest that ‘‘murinizing’’ human feeding patterns may be a way to treat individuals with adipose dysfunction and storage defects.STAR+METHODS Detailed methods are provided in the online version of this paper and include the following: d KEY RESOURCES TABLE d CONTACT FOR REAGENT AND RESOURCE SHARINGd EXPERIMENTAL MODEL AND SUBJECT DETAILS B Animals B Rodent Diets B Feeding regimes d METHOD DETAILS B Glucose tolerance test B Inlet conditions B Temperature Program: B MSD conditions: B Mouse Euglycaemic-hyperinsulinaemic clamp B Mouse 2-Deoxyglucose uptake B Calorimetry and assessment of metabolic flexibility B Lipid tolerance test B Liver fat % B Serum Biochemistry B RNA extraction and real time PCR B Western Blotting B Histological analysis of white adipose tissue B GC-MS FAME analysis B Lipid uptake to adipose tissue B LC-MS analyasis d QUANTIFICATION AND STATISTICAL ANALYSIS d DATA AND SOFTWARE AVAILABILLITYSUPPLEMENTAL INFORMATION Supplemental Information includes four figures and one table and can be found with this article online at https://doi.org/10.1016/j.celrep.2018.07.063.ACKNOWLEDGMENTS We thank Helen Westby, Sarah Grocott, Charley Beresford, Jade Bacon, Laura McKinven, and Agnes Lukasik for their excellent technical assistance. All animal work was carried out in the Disease Model Core (MRC Metabolic Diseases Unit [MRC_MC_UU_12012/5]; Wellcome Trust Strategic Award [100574/Z/12/Z]). All serum biochemistry was conducted by the Biochemistry Assay Lab (MRCMetabolic Diseases Unit [MRC_MC_UU_12012/5]). We thank the BHF (RG/12/13/29853), FIS (PI15/01934), and MRC (MC_UU_12012/2) for funding this work.AUTHOR CONTRIBUTIONS S.V. designed and conducted experiments and wrote the manuscript. K.P., D.H., B.J., and M.D. conducted experiments. A.K. designed and conducted experiments. J.M.M.-N. and J.M.F.-R. provided and analyzed human adipose gene expression data. A.V.-P. designed experiments and wrote the manuscript.DECLARATION OF INTERESTS The authors declare no competing interests. Received: November 27, 2017 Revised: March 15, 2018 Accepted: July 18, 2018 Published: August 21, 2018 REFERENCES Asterholm, I.W., and Scherer, P.E. (2010). Enhancedmetabolic flexibility asso- ciated with elevated adiponectin levels. Am. J. Pathol. 176, 1364–1376.Cell Reports 24, 2005–2012, August 21, 2018 2011 Asterholm, I.W., Mundy, D.I., Weng, J., Anderson, R.G., and Scherer, P.E. (2012). Altered mitochondrial function and metabolic inflexibility associated with loss of caveolin-1. Cell Metab. 15, 171–185. Danforth, E., Jr. (2000). Failure of adipocyte differentiation causes type II dia- betes mellitus? Nat. Genet. 26, 13. Ellacott, K.L., Morton, G.J., Woods, S.C., Tso, P., and Schwartz, M.W. (2010). Assessment of feeding behavior in laboratory mice. Cell Metab. 12, 10–17. Escher, P., Braissant, O., Basu-Modak, S., Michalik, L., Wahli, W., and Des- vergne, B. (2001). Rat PPARs: quantitative analysis in adult rat tissues and regulation in fasting and refeeding. Endocrinology 142, 4195–4202. Folch, J., Lees, M., and Sloane Stanley, G.H. (1957). A simple method for the isolation and purification of total lipides from animal tissues. J. Biol. Chem. 226, 497–509. Frayn, K.N. (2002). Adipose tissue as a buffer for daily lipid flux. Diabetologia 45, 1201–1210. Gao, S., McMillan, R.P., Zhu, Q., Lopaschuk, G.D., Hulver, M.W., and Butler, A.A. (2015). Therapeutic effects of adropin on glucose tolerance and substrate utilization in diet-induced obese mice with insulin resistance. Mol. Metab. 4, 310–324. Goodpaster, B.H., and Sparks, L.M. (2017). Metabolic flexibility in health and disease. Cell Metab. 25, 1027–1036. Isken, F., Klaus, S., Petzke, K.J., Loddenkemper, C., Pfeiffer, A.F., and Weickert, M.O. (2010). Impairment of fat oxidation under high- vs. low-glyce- mic index diet occurs before the development of an obese phenotype. Am. J. Physiol. Endocrinol. Metab. 298, E287–E295. Jackowski, S., and Leonardi, R. (2014). Deregulated coenzyme A, loss of metabolic flexibility and diabetes. Biochem. Soc. Trans. 42, 1118–1122. Kim, J.Y., van de Wall, E., Laplante, M., Azzara, A., Trujillo, M.E., Hofmann, S.M., Schraw, T., Durand, J.L., Li, H., Li, G., et al. (2007). Obesity-associated improvements in metabolic profile through expansion of adipose tissue. J. Clin. Invest. 117, 2621–2637. Longo, K.A., Charoenthongtrakul, S., Giuliana, D.J., Govek, E.K., McDonagh, T., Qi, Y., DiStefano, P.S., andGeddes, B.J. (2008). Improved insulin sensitivity and metabolic flexibility in ghrelin receptor knockout mice. Regul. Pept. 150, 55–61. McQuaid, S.E., Hodson, L., Neville, M.J., Dennis, A.L., Cheeseman, J., Hum- phreys, S.M., Ruge, T., Gilbert, M., Fielding, B.A., Frayn, K.N., and Karpe, F. (2011). Downregulation of adipose tissue fatty acid trafficking in obesity: a driver for ectopic fat deposition? Diabetes 60, 47–55. Medina-Gomez, G., Virtue, S., Lelliott, C., Boiani, R., Campbell, M., Christo- doulides, C., Perrin, C., Jimenez-Linan, M., Blount, M., Dixon, J., et al. (2005). The link between nutritional status and insulin sensitivity is dependent on the adipocyte-specific peroxisome proliferator-activated receptor- gamma2 isoform. Diabetes 54, 1706–1716. Medina-Gomez, G., Gray, S.L., Yetukuri, L., Shimomura, K., Virtue, S., Camp- bell, M., Curtis, R.K., Jimenez-Linan, M., Blount, M., Yeo, G.S., et al. (2007). PPAR gamma 2 prevents lipotoxicity by controlling adipose tissue expand- ability and peripheral lipid metabolism. PLoS Genet. 3, e64. Muoio, D.M., Noland, R.C., Kovalik, J.P., Seiler, S.E., Davies, M.N., DeBalsi, K.L., Ilkayeva, O.R., Stevens, R.D., Kheterpal, I., Zhang, J., et al. (2012). Mus-2012 Cell Reports 24, 2005–2012, August 21, 2018cle-specific deletion of carnitine acetyltransferase compromises glucose tolerance and metabolic flexibility. Cell Metab. 15, 764–777. Perry, R.J., Camporez, J.G., Kursawe, R., Titchenell, P.M., Zhang, D., Perry, C.J., Jurczak, M.J., Abudukadier, A., Han, M.S., Zhang, X.M., et al. (2015). He- patic acetyl CoA links adipose tissue inflammation to hepatic insulin resistance and type 2 diabetes. Cell 160, 745–758. Randle, P.J., Garland, P.B., Hales, C.N., and Newsholme, E.A. (1963). The glucose fatty-acid cycle. Its role in insulin sensitivity and the metabolic distur- bances of diabetes mellitus. Lancet 1, 785–789. Riachi, M., Himms-Hagen, J., and Harper, M.E. (2004). Percent relative cumu- lative frequency analysis in indirect calorimetry: application to studies of trans- genic mice. Can. J. Physiol. Pharmacol. 82, 1075–1083. Rodriguez-Cuenca, S., Carobbio, S., Velagapudi, V.R., Barbarroja, N., Mor- eno-Navarrete, J.M., Tinahones, F.J., Fernandez-Real, J.M., Oresic, M., and Vidal-Puig, A. (2012). Peroxisome proliferator-activated receptor g-dependent regulation of lipolytic nodes and metabolic flexibility. Mol. Cell. Biol. 32, 1555– 1565. Storlien, L., Oakes, N.D., and Kelley, D.E. (2004). Metabolic flexibility. Proc. Nutr. Soc. 63, 363–368. Titchenell, P.M., Quinn, W.J., Lu, M., Chu, Q., Lu, W., Li, C., Chen, H., Monks, B.R., Chen, J., Rabinowitz, J.D., and Birnbaum, M.J. (2016). Direct hepatocyte insulin signaling is required for lipogenesis but is dispensable for the suppres- sion of glucose production. Cell Metab. 23, 1154–1166. Ukropcova, B., Sereda, O., de Jonge, L., Bogacka, I., Nguyen, T., Xie, H., Bray, G.A., and Smith, S.R. (2007). Family history of diabetes links impaired sub- strate switching and reduced mitochondrial content in skeletal muscle. Dia- betes 56, 720–727. Vacanti, N.M., Divakaruni, A.S., Green, C.R., Parker, S.J., Henry, R.R., Ciaraldi, T.P., Murphy, A.N., andMetallo, C.M. (2014). Regulation of substrate utilization by the mitochondrial pyruvate carrier. Mol. Cell 56, 425–435. Vaitheesvaran, B., LeRoith, D., and Kurland, I.J. (2010). MKR mice have increased dynamic glucose disposal despite metabolic inflexibility, and hepat- ic and peripheral insulin insensitivity. Diabetologia 53, 2224–2232. Vidal-Puig, A.J., Considine, R.V., Jimenez-Lin˜an,M.,Werman, A., Pories,W.J., Caro, J.F., and Flier, J.S. (1997). Peroxisome proliferator-activated receptor gene expression in human tissues. Effects of obesity, weight loss, and regula- tion by insulin and glucocorticoids. J. Clin. Invest. 99, 2416–2422. Virtue, S., and Vidal-Puig, A. (2010). Adipose tissue expandability, lipotoxicity and the Metabolic Syndrome–an allostatic perspective. Biochim. Biophys. Acta 1801, 338–349. Vroegrijk, I.O., van Diepen, J.A., van den Berg, S.A., Romijn, J.A., Havekes, L.M., van Dijk, K.W., Darland, G., Konda, V., Tripp, M.L., Bland, J.S., and Voshol, P.J. (2013). META060 protects against diet-induced obesity and insu- lin resistance in a high-fat-diet fed mouse. Nutrition 29, 276–283. Yew Tan, C., Virtue, S., Murfitt, S., Roberts, L.D., Phua, Y.H., Dale, M., Griffin, J.L., Tinahones, F., Scherer, P.E., and Vidal-Puig, A. (2015). Adipose tissue fatty acid chain length and mono-unsaturation increases with obesity and in- sulin resistance. Sci. Rep. 5, 18366. STAR+METHODSKEY RESOURCES TABLEREAGENT or RESOURCE SOURCE IDENTIFIER Antibodies pHSL S660 Cell Signaling Cat 4126; RRID: AB_490997 Total HSL Cell Signaling Cat 4107 ; RRID: AB_2296900 Phospho P44/42 MAPK Cell Signaling Cat 4376; RRID: AB_331772 Total P44/42 MAPK Cell Signaling Cat 4695; RRID: AB_390779 pAKT S473 Cell Signaling Cat 4060; RRID: AB_2315049 Total AKT Cell Signaling Cat 2920; RRID: AB_1147620 B-actin Cell Signaling Cat 8226; RRID: AB_306371 Biological Samples Human adipose tissue biopsies Endocrinology Service of the Hospital of Girona ‘Dr Josep Trueta’ N/A Chemicals, Peptides, and Recombinant Proteins D-Glucose (6,6-D2 99%) Goss Scientific DLM-349-1 D-Glucose (2-D, 98%) Goss Scientific DLM-1271-1 Pyridine Sigma 270970-100ml Hydroxyamine hydrochloride Sigma 431362-50 g Acetic anhydride Sigma 320102 Ethyl Acetate Sigma 34972 Fentanyl Martindale Pharma PL 00156/0038 Midazolam (Hypnovel) Roche PL00031/0126 Acepromazine Novartis GTIN5037694004606 3-3H glucose Perkin Elmer NET331A250UC Deoxy-D-glucose, 2-[1-14C] Perkin Elmer NEC495A250UC Insulin Novo Nordisk EU/1/02/230/003 Olive oil Heritage STAT 60 AMS Biotech CS-502 Reverse transcriptase kit N/A N/A Reverse Transcriptase M-MLV Promega M170b M-MLV RT 5x buffer Promega M351A MgCl2 25mM Promega A351B Random Primers Promega C118A dNTP Mix 10 mM Promega U151B RNeasy Lipid Tissue Mini Kit QIAGEN 74804 Chlorofom Sigma 34854 Methanol Sigma 34860 BF3 Methanol Sigma B1127 Hexane Sigma 34859 1-14C Palmitate Perkin Elmer NEC075H050UC BondElut NH2 columns Agilent 12102014 Isolute Strong anion exchange columns, 100 mg bed, 6 ml reservoir. Biotage 500-0010-C Formic acid Sigma F0507-500ML Ammonium acetate Sigma A1542-250G (Continued on next page) Cell Reports 24, 2005–2012.e1–e7, August 21, 2018 e1 Continued REAGENT or RESOURCE SOURCE IDENTIFIER Critical Commercial Assays Alpha Trak 2 glucose meter Zoetis N/A Insulin Elisa (Mouse Clamp studies) Crista Chem 90080 NEFA assay (Mouse clamp studies) WAKO R1 436-91995 R2 434-91795 S: 270-77000 Triglyceride assays Siemens Healthcare Diagnostics N/A Roche Free Fatty Acid Kit (half-micro test) Roche 1138175001 Insulin ECL Meso Scale Discovery K152BZC Deposited Data Raw data This paper https://data.mendeley.com/datasets/ whn4s7nyww/draft?a=22693287-b601- 457c-85a9-9903c6d88639; Reserved: https://doi.org/10.17632/whn4s7nyww.2 Experimental Models: Organisms/Strains Mouse: C57BL/6J The Jackson Laboratory JAX: 000664 Mouse: PPARy2 KO C57BL/6J.sv129 (Medina-Gomez et al., 2005) N/A Oligonucleotides PPARg2 F CCAACCAATCTTTTGCAAGACATAGAC (Medina-Gomez et al., 2005) N/A PPARg2 R ACATGCAATTTCACCCACACATGAGTG (Medina-Gomez et al., 2005) N/A PPARg2 Asc AATGGCCGCTTTTCTGGATTCATCGAC (Medina-Gomez et al., 2005) N/A Sybr Green Primer and TaqMan primer and probe sequences see Table S1 N/A N/A GLUT4 TaqMan primer and probe set (Human) ThermoFisher Hs00168966_m1 Human PPIA (Cyclophilin A) Endogenous Control (FAM/MGB probe, non-primer limited) ThermoFisher 4333763F IRS1 TaqMan primer and probe set (Human) ThermoFisher Hs00178563_m1 Software and Algorithms IBM SPSS Statistics 22 IBM corporation N/A MassHunter Workstation Software Quantitative Analysis (Version B.07.00) Agilent Technologies Inc N/ACONTACT FOR REAGENT AND RESOURCE SHARING Further information and requests for resources and reagents should be directed and will be fulfilled by Dr. Samuel Virtue (sv234@medschl.cam.ac.uk). EXPERIMENTAL MODEL AND SUBJECT DETAILS Animals PPARg2 KOmicewere generated as described previously (Medina-Gomez et al., 2005).Micewere phenotyped on amixedC57BL/6/ sv129 genetic background. Mice homozygous for a deletion in PPARg2 (PPARg2/) and their wild-type littermates were generated by mating heterozygous mice. All animals used were male mice. Ages are provided in figure legends. C57BL/6 wild-type mice were purchased fromCharles River UK. This research has been regulated under the Animals (Scientific Procedures) Act 1986 Amendment Regulations 2012 following ethical review by the University of Cambridge AnimalWelfare and Ethical ReviewBody (AWERB). Animals were housed in a specific pathogen free facility with 12 hour light and 12 hour dark cycles. Unless otherwise stated all animals were studied under fed conditions and at 24C. Rodent Diets Mice were fed either standard breeders chow (Safe Diets, DS-105) or a 45% fat diet (HFD) (Research Diets D12451) all diets were provided ab libitum.e2 Cell Reports 24, 2005–2012.e1–e7, August 21, 2018 Feeding regimes For the one day high-fat diet challengemice were single housed 1 week prior to the start of the diet to permit food intake assessment. The diet commenced in a staggered manner between 10 am and midday. Mice were alternated in genotype for both feeding of the diet and also for culling. Mice were killed in the same sequence that they were fed the diet in to keep the mice as close to receiving high-fat diet for 24 hours as possible. No significant correlation between the order the mice were killed in and the levels of FFAs, in- sulin or TG in blood was detected for the time course of the experiment. 1 month and 1 week HFD fed animals mice were culled be- tween 10 am and 12pm in order to maintain the animals in the same stage of the circadian cycle as the chow controls and the 1 day high-fat fed animals Patient recruitment Forty five subcutaneous adipose tissue (SAT) samples from morbidly obese (BMI > 35 kg/m2) participants with different degrees of insulin action (measured using hyperinsulinaemic–euglycaemic clamp) were analyzed. All these participants were of Caucasian origin, reported that their bodyweight had been stable for at least threemonths before the study andwere studied in the post-absorp- tive state. BMI was calculated as weight (in kg) divided by height (in m) squared. Patients had no systemic disease other than obesity and all were free of any infections in the previous month before the study. Liver diseases (specifically tumoral disease and hepatitis C virus infection) and thyroid dysfunction were specifically excluded by biochemical work-up. All these participants were recruited at the Endocrinology Service of the Hospital of Girona ‘Dr Josep Trueta’. All participants gave written informed consent, validated and approved by the Ethics Committee of the Hospital of Girona ‘Dr Josep Trueta’, after the purpose of the study was explained to them. METHOD DETAILS Glucose tolerance test For fasted glucose tolerance testsmicewere fasted overnight from 4pmuntil 9 am the next day and then allowed to acclimatise to the procedural room for 1 hour. For fed glucose tolerance tests mice were allowed to acclimatise to the procedural room for one hour between 9 and 10 am. Glucose was administered at 1 g/kg IP. A fixed dose of glucose was given to all mice in the study group based on the average weight of the group. Fed glucose tolerance tests were performed at 10 am in the morning. Blood samples were collected at 0, 10, 20, 30, 60, 90 and 120 minutes. For stable isotope GTTsmice were injected with a 50:50mix of D2-6,6 Glucose and D2-2 Glucose (Goss Scientific, UK). Bloodwas collected on blood spot cards. A 6 mm punch was removed from each blood spot card and extracted by wetting with 40 ul of water followed by addition of 400 ul of ethanol. Samples were shaken for 45minutes at room temperature before undergoing centrifugation at 16,000 g. EtOH extracts were dried under vacuum at ambient temperature using a Speed Vac. Extracts underwent aldonitrile pen- taacetate derivitisation as follows: Dried extracts were resuspended in 50 ul of pyridine containing 2% w/v hydroxylamine. Samples were heated for 45 minutes at 90C then allowed to cool. After cooling 100 ul of acetic anhydride was added and samples were heat- ed for 30 minutes at 60C for 30 minutes. Samples were allowed to cool and then dried under nitrogen at 60C. Dried samples were dissolved in 200 ul of ethyl acetate, centrifuged at 16,000 g for 1 minute and the top 150 ul of supernatant was transferred to an au- tosampler vial containing a 300 ul glass insert. Gas-Chromatography Mass spectrometry analysis was performed using an Aglient 7890B GC and an Agilent 5977A MSD using a 0.25 uM x 30 M DB-5 (Cat: 122-5031, Agilent) column. The GC-Conditions were as follows: Inlet conditions Inlet temperature: 250C Split 20:1 Inlet liner Liner, ultra inert, splitless, single taper, glasswool (cat#6322616) (Agilent Technologies) Column Flow 1 ml/min Temperature Program: 80C Hold for 1 minute 20C/min until 280C 280C Hold for 3 minutes MSD transfer line 290C MSD conditions: Scan 45-850, 4 Hz MS Source temperature 230C MS Quad temperature 150CCell Reports 24, 2005–2012.e1–e7, August 21, 2018 e3 Analysis was performed usingMSQuantitative analysis. Ions analyzed were 217 (M0) 218 (M1), 219 (M2) 220 (M3) and 221 (M4). To determine the relative ratio of endogenous to exogenous glucose blood samples were compared to the glucose composition of mouse blood from animals uninjected with labeled glucose and a sample of D2-6,6 glucose (10 ul, 10mM) that was dried onto a blood spot card and extracted as described above). The ion pattern of each blood sample was compared to the tracer and endogenous blood glucose. To determine the relative contribution of endogenous and tracer glucose we defined 5 equations for each ion as follows: Equation System 1 : M0calc= x M0Endo+ ð1­xÞ M0Exo M1calc= x M1Endo+ ð1­xÞ M1Exo M2calc= x M2Endo+ ð1­xÞ M2Exo M3calc= x M3Endo+ ð1­xÞ M3Exo M4calc= x M4Endo+ ð1­xÞ M4Exo Where x represents the Fractional concentration of the endogenous glucose in the blood and 1-x the Fractional concentration of exogenous glucose in the blood. We defined a further 5 equations: Equation System 2 : M0obs­M0calc M1obs­M1calc M2obs­M2calc M3obs­M3calc M4obs­M4calc We then used the Solver function of Excel to minimize the sum of the squares of the result of the 5 equations by changing the value of x in equation system 1 using the GRG Non-Linear Engine. The solution for x defined the fractional concentration of endogenous glucose and 1-x the fractional concentration of D2-6,6 glucose. As D2-6,6 glucose represented 50% of the glucose injected in the GTT we multiplied the fractional concentration of D2-6,6 glucose by 2 to get the fractional concentration of the exogenous glucose and multiplied it by the observed blood concen- tration of glucose to get the concentration of exogenous glucose in mMol. By subtraction the exogenous glucose from the mouse’s total blood glucose concentration we obtained the endogenous glucose concentration. Mouse Euglycaemic-hyperinsulinaemic clamp Animals were fasted from 4 pm until 8 am the next morning. Animals were anaesthetised with 11 ml per gram of body weight using a combination of the following drugs at stated concentrations fentanyl (0.03125 mg/ml), midazolam (0.625 mg/ml), and acepromazine (0.625 mg/ml). Once unconscious mice were placed on temperature controlled heating pads (Harvard Apparatus) and core body temperature was maintained at 37C. Mice underwent a basal infusion period. The basal infusate comprised of 3-3H glucose (0.23MBq/ml) and 3mg/ml sodium citrate in 0.9% saline. The basal infusion rate was 100 ul/hour and was conducted for 90minutes. For the clamp phase the basal infusate was stopped and the hyperinsulinaemic infusion was started. The hyperinsulinaemic infusate comprised of 0.11 mU per ml of insulin, 0.231 MBQ/ml of 3-3H glucose, 3 mg/ml sodium citrate, 2% FFA-free low-endotoxin BSA in 0.9% saline. The hyperinsulinaemic infusion was initiated with a bolus of 30 ul of infusate followed by 100 ul/hour. A variable rate infusion of glucose was then started using 12.5% glucose in 0.9% saline with 3 mg/ml sodium citrate. Blood glucose was measured every 5 minutes and glucose infusion rate was adjusted to clamp mice to their basal glucose levels. The hyperinsulinaemic infusion was continued for at least 90 minutes, or if mice had not reached steady state until steady state was achieved. Steady state was defined as mice exhibiting blood glucoses that were ± 0.5 mMol of their starting blood glucose and having a stable glucose infusion rate for three consecutive measurements. Blood samples were collected for the determination of FFA, Insulin and serum specific activity at the end of the basal and clamped states. Mouse 2-Deoxyglucose uptake Mice were fed a high-fat diet for 1 day, with mice placed on the diet between 8 and 9 am. The following day mice were anaesthetised in the sequence they were anaesthetised between 8 and 9 am. The anesthetic was 11 ml per gram of body weight using a combination of the following drugs at stated concentrations fentanyl (0.03125mg/ml), midazolam (0.625mg/ml), and acepromazine (0.625mg/ml). Micewere injected IVwith 0.046MBqof 14C 2-Deoxyglucose and blood glucose levels weremeasured and serum samples collected at 10,20 and 30 minutes post injection in order to determine the specific activity of glucose in the blood. Mice were killed 30 minutes after injection with 14C-2-Deoxyglucose and tissues were harvested. Phospho deoxyglucose was separated from deoxyglucose using solid-phase extraction with strong anion exchange columns. Tis- sues were weighed (100 mg of WAT and 50 mg of BAT) and homogenized in 1 mL of distilled water in glass tubes. The homog- enates were heated to 95C for 10 minutes before cooling to room temperature. Homogenates were then transferred to eppendorf tubes and centrifuged at 16,000 G and 66 ul of homogenate was taken for scintillation counting. SAX-SPE columns were conditionede4 Cell Reports 24, 2005–2012.e1–e7, August 21, 2018 with 5ml of distilled water and then collection vials placed below the columns before transferring 660 ul of homogenate to the column. Columns were washed 3 times with 2 mL of distilled water. The wash fractions were vortexed and 500 ul of the wash fraction was added to 20 mL of scintillant for counting. New collection columns were placed under the SPE columns and the phosphodeoxyglu- cosewas eluted three times using 2mL of 0.2M formic acid and 0.5Mammonium acetate pH 5.0. The elution fractions were vortexed to mix them and 500 ul was added to 20 mL of scintillant and counted immediately. Calorimetry and assessment of metabolic flexibility Mice underwent calorimetry in a custom built calorimetry system (Creative Scientific UK) for up to 48 hours. Carbon dioxide and oxygen concentrations were determined every 11 minutes for each chamber and the incurrent air supply. Flow rates were 400 ml/minute. Energy expenditure was calculated from the VO2 and CO2 according to the modified Weir equation (EE J/min = 15.818xVO2 (ml/min) + 5.176*VCO2 (ml/min)). Metabolic flexibility was assessed bymeasuring the amplitude of respiratory exchange ratio (RER) frommice in free living calorimetry chambers. Amplitude of RERwas defined as the difference between the average of the lowest 10% of RER values subtracted from the average of the highest 10% of RER values (dRER). Amplitude of RER has been es- tablished as a read out of metabolic flexibility by multiple groups (Asterholm et al., 2012; Asterholm and Scherer, 2010; Gao et al., 2015; Isken et al., 2010; Jackowski and Leonardi, 2014; Longo et al., 2008; Muoio et al., 2012; Riachi et al., 2004; Vaitheesvaran et al., 2010; Vroegrijk et al., 2013). Lipid tolerance test Mice were fasted overnight from 4 pm until 9 am the next day. Mice were gavaged with 200 ml olive oil (Heritage, NISA, UK). Blood samples were collected at 0,1,2,4 and 8 hours post gavage for determination of TG and FFA levels. See Serum biochemistry for de- tails of TG and FFA measurement. Liver fat % 100-200mg of liver was weighed and lipids extracted according to the Folch extraction procedure (Folch et al., 1957). Briefly, 100mg of liver was homogenized in 1mL volumes (w/v) of 2:1 chloroformmethanol using aMPBiomedical Fast Prep. Homogenized samples were centrifuged (16,000 G for 10minutes) and the supernatant transferred to a clean Eppendorf tube. 200 ul of water was added and samples vortexed for 2 minutes. Samples were centrifuged (16,000 G for 10 minutes) and the lower organic phase was collected into a pre-weighed Eppendorf tube. A second round of extraction was carried out by adding 700 ul of chloroform to the sample and vor- texing (2 minutes) and centrifuging (16,000 G for 10 minutes). The lower organic phase was collected again and combined with the previous extract. The extract was then dried under nitrogen. The weight of the tube and extracted lipid wasmeasured and the weight of the empty tube subtracted to give the quantity of lipid in the sample. The liver fat extract was expressed as a% of wet liver weight. Serum Biochemistry Triglycerides weremeasured on the Dimension RXL analyzer (Siemens Healthcare). Free Fatty Acidsweremeasured using the Roche Free Fatty Acid Kit (half-micro test) (kit code 11383175001). Insulin, was measured using electrochemical luminescence immuno- assay on the MesoScale Discovery immunoassay platform. RNA extraction and real time PCR RNA was extracted using STAT-60 (AMS biotech) according to manufacturer’s procedures. Reverse transcription (500 ng of total RNA) was performed using random hexamers using the Reverse Transcriptase System (Promega) according to manufacturer’s in- structions. Real-time PCR was carried out in 13ul reactions using TaqMan or Sybr Green reagents and performed in a 384 well plate on an ABI7900 real-time PCR machine using default thermal cycler conditions. For PCR primer sequences see Table S1. Western Blotting Protein was extracted from tissues using a modified RIPA buffer (50 mM Tris HCL pH 8, 150 mM NaCl, 1% NP-40, 0.5% Sodium Deoxycholate, 0.1% SDS) and quantified by the BioRad DC protein assay. Protein was heated with loading dye containing DTT and heated to 95oC for 5 minutes to denature proteins before loading. 10 ug per well of protein was and subjected to SDS-PAGE in a 4%–12% gradient gel using the Novex NuPage midi system (Life Technologies) and transferred using the iBlot transfer system and reagents (Life Technologies) for 7 minutes. Membranes were probed for: pHSL S660 (Cat: 4126 Cell Signaling, USA) total HSL (Cat: 4107Cell Signaling, USA), Phospho-p44/42MAPK (Cat: 4376Cell Signaling, USA), total p44/42MAPK (Cat: 4695 Cell Signaling, USA), Phospho AKT (Cat: 4060 Cell Signaling, USA), total-AKT (Cat: 2920 Cell Signaling, USA) and B-actin (Cat: 8226 Abcam, UK). Histological analysis of white adipose tissue Adipose tissue was fixed in formalin. Tissues were embedded in paraffin and sections were cut at a thickness of 100 mM. Slides were imaged using an automated slide scanning microscope (Axioscan Z1 using a Hamamatsu orca flash 4.0 V3 camera) using a 20x objective with a numerical aperture of 0.8. Adipocytes size was quantified using Halo (Indica Labs inc) utilizing the Vacuole module v.1.4. The cut off point for minimum vacuole diameter was set at 15 and the maximum at 150 mm. Adipocyte, blood vessels and slide background were determined using the tissue classifier method, only adipocytes were quantified.Cell Reports 24, 2005–2012.e1–e7, August 21, 2018 e5 GC-MS FAME analysis Lipid extraction and analysis were described in detail previously (Yew Tan et al., 2015). Briefly, lipids were extracted by the Folch extraction procedure. Lipids were esterified to form methyl esters using BF3 methanol. Methyl esters were analyzed by Gas-chro- matography Mass-Spectrometry. The identity of species was determine by retention time andmass spectra and compared to a food industry fame standard (Thames Restek, UK). Lipid species were quantified based on integrated peak area. Lipid uptake to adipose tissue Mice were clamped as described above. 30 minutes from the end of the clamp a bolus of 0.2 MBQ of 1-14C palmitate conjugated to 2% BSA in PBS was injected IV. After 30 minutes serum and adipose tissue was collected. Serum DPMs were measured directly. Adipose tissue was weighed and lipids extracted using the Folch method (see ‘‘Liver fat%’’ above). Lipids were separated into Neutral Lipid, Phospholipid and FFA fractions by solid phase extraction. Solid phase extraction was performed by resuspending the adipose tissue extract in 1mL of dry chloroform. Of this 1 mL 100 ul was reserved for scintillation counting and 900 ul was applied to the SPE column and the flow through collected. Two further washes of 1 mL of dry chloroform were performed and combined with the initial flow through; this represented the neutral lipid fraction. Phospholipids were then eluted from the columns into a fresh tube using 2 mL of Chloroform:Methanol 60:40). The NEFA fraction was eluted in 2.0ml chloroform/methanol/glacial acetic acid (100:2:2). All SPE stepswere performed using a vacuummanifold. Unlikemany SPE lipid extraction protocols, no activation of the columnswas required and between collection of fractions the bed was dried under vacuum for 2-3 s to minimize carry over between fractions. LC-MS analyasis Sample extraction The pre-weighedmuscle tissue samples (10-20mg) were transferred to a 2mL Eppendorf screw cap tubes. A single 5mm stainless steel ball bearing and 400 mL of the chloroform:methanol mix solution (2:1, respectively) were added to the tissue samples, followed by a 3 s cycle of vigorous vortexing. The tissues were then homogenized in the extraction solvent using a Bioprep-24-1004 homog- enizer (Allsheng, Hangzhou City, China) run at speed; 6 m/s, time; 30 s for 2 cycles. Following the homogenization, 150 mL of the sta- ble isotope labeled lipid internal standard mix was added along with 10 mL the stable isotope 5-hydroxytryptamine-d4 acylcarnitine internal marker. The mixtures was then thoroughly vortexed before the addition of 600 mL of the chloroform:methanol mix solution (2:1, respectively). The samples were homogenized again (speed; 6 m/s, time; 30 s for 2 cycles). To the homogenates, 400 mL of HPLC-water was added with an additional cycle of vortexing. The samples were then centrifuged (5 mins at 21,000 g) to produce aqueous and organic biphasic extracts. The two phases were then separated by pipetting each into separate 2 mL Eppendorf screw cap vials making sure not to break up the undissolved protein pellet. To perform a double extraction, 1mL of the chloroform:methanol mix solution (2:1, respectively) was added to each sample, then vortexed thoroughly. The samples were then homogenized on the tissuelyser (speed; 6m/s, time; 30 s for 2 cycles). Then 400 mL of HPLC-water was added to each sample, vortexed and homogenized on the tissuelyser (speed; 6 m/s, time; 30 s for 2 cycles). The samples were then centrifuged (5 mins at 21,000 g) to produce the biphasic extracts, followed by phase separation into the corresponding 2 mL Eppendorf screw cap vials containing the first extracts. Acylcarnitine sample preparation Half of the corresponding organic fractions and half the aqueous fraction were mixed with each other into separate 2 mL Eppendorf screw cap vials. Themixed extracts were dried completely under a gentle stream of oxygen free nitrogen heated to 45C. To the dried extracts, 200 mL of water:acetonitrile (4:1, respectively) was added to reconstitute the acylcarnitine species. The samples were then vortexed thoroughly. The samples were then transferred into 2 mL amber glass vials containing a 300 mL vial-insert which were then analyzed by liquid chromatography with mass spectrometry detection. Acylcarnitine LC-MS Chromatographic separation was achieved using an ACE Excel 2 C18-PFP (150mm * 2.1mm, 2 mm) LC-column with a Shimadzu UPLC system (Shimadzu UK Limited, Wolverton, Milton Keynes). The column was maintained at 55Cwith a flow rate of 0.5 mL/min. A binary mobile phase system was used with mobile phase A; water (with 0.1% formic acid), and mobile phase B; acetonitrile (with 0.1% formic acid). The gradient profile was as follows; at 0 minutes_0% mobile phase B, at 0.5 minutes_100% mobile phase B, at 5.5 minutes_100% mobile phase B, at 5.51 minutes_0% mobiles phase B, at 7 minutes_0% mobile phase B. Mass spectrometry detection was performed on a Thermo Exactive orbitrap mass spectrometer (Thermo Scientific, Hemel Hempstead, UK) operating in positive ion mode. A heated electrospray source was used; the sheath gas was set to 40 (arbitrary units), the aux gas set to 15 (arbitrary units) and the capillary temperature set to 250C. The instrument was operated in full scan mode from m/z 75–1000 Da. Acylcarnitine species were identified by detecting a signal peak for the corresponding accurate mass at the correct retention time. Signals were normalized to the dried tissue mass (dried protein pellet left after the extraction), their final semiquantitative con- centrations were determined by comparing the acylcarnitine species intensity to the internal marker intensity. Lipid sample preparation, 50 mL of the organic fractions were transferred into 2mL amber glass vials containing a 300 mL vial-insert. The samples were then dried completely under a gentle stream of oxygen free nitrogen at 45C. Then, 90 mL of isopropanol:acetoni- trile (4:1, respectively) was added to reconstitute the lipid species. The samples were then vortexed thoroughly before being analyzed by liquid chromatography with mass spectrometry detection. Lipid LC-MS, Chromatographic separation was achieved using aWaters Acquity UPLC CSHC18 (50mm * 2.1mm, 1.7 mm) LC-col- umn with a Shimadzu UPLC system (Shimadzu UK Limited, Wolverton, Milton Keynes). The column was maintained at 55C with ae6 Cell Reports 24, 2005–2012.e1–e7, August 21, 2018 flow rate of 0.5 mL/min. A binary mobile phase system was used with mobile phase A; acetonitrile:water mix (6:4, respectively, with 10 mM ammonium formate), and mobile phase B; isopropanol:acetonitrile mix (9:1, respectively, with 10 mM ammonium formate). The gradient profile was as follows; at 0 minutes_40% mobile phase B, at 0.4 minutes_43% mobile phase B, at 0.45 minutes_50% mobile phase B, at 2.4 minutes_54% mobile phase B, at 2.45 minutes_70% mobile phase B, at 7 minutes_99% mobile phase B, at 8 minutes_99% mobile phase B, at 8.3 minutes_40% mobile phase B, at 10 minutes_40% mobile phase B. Mass spectrometry detection was performed on a Thermo Exactive orbitrap mass spectrometer (Thermo Scientific, Hemel Hempstead, UK) operating in positive ion and negative ion continuous switchingmode. Heated electrospray sourcewas used; the sheath gaswas set to 40 (arbi- trary units), the aux gas set to 15 (arbitrary units) and the capillary temperature set to 300C. The instrument was operated in full scan mode from m/z 150–1200 Da. Lipid species were identified by detecting a signal peak for the corresponding accurate mass at the correct retention time. Signals were normalized to the dried tissue mass (dried protein pellet left after the extraction), their final semi- quantitative concentrations were determined by comparing the lipid species intensity to the appropriate stable isotope labeled lipid internal standard. Human Adipose tissue handling Adipose tissue samples were obtained from SAT depots during elective surgical procedures (cholecystectomy, abdominal hernia surgery and gastric bypass surgery). Samples of adipose tissue were immediately transported to the laboratory (5-10 min). The handling of tissue was carried out under strictly aseptic conditions. Adipose tissue samples were washed in PBS, cut with forceps and scalpel into small pieces (100 mg) and immediately flash-frozen in liquid nitrogen before being stored at 80C. Hyperinsulinemic-euglycemic clamp in humans After an overnight fast, two catheters were inserted into an antecubital vein, one for each arm, used to administer constant infusions of glucose and insulin, and to obtain arterialized venous blood samples. A 2-h hyperinsulinaemic-euglycaemic clampwas initiated by a two-step primed infusion of insulin (80mU/m2/min for 5 min, 60mU/m2/min for 5 min) immediately followed by a continuous infusion of insulin at a rate of 40mU/m2/min (regular insulin (Actrapid, NovoNordisk, NJ)). Glucose infusion began atminute 4 at an initial perfu- sion rate of 0.011 mmol/kg/min being then adjusted to maintain plasma glucose concentration at 4.9 – 5.5 mmol/l. Blood samples were collected every 5minutes for determination of plasma glucose and insulin. Insulin sensitivity was assessed as themean glucose infusion rate during the last 40 min. In the stationary equilibrium, the amount of glucose administered (M) equals the glucose taken by the body tissues and is a measure of overall insulin sensitivity. RNA expression for human SAT RNA purification was performed using an RNeasy Lipid Tissue Mini Kit (QIAgen, Izasa, Barcelona, Spain) and the integrity was checked using an Agilent Bioanalyzer (Agilent Technologies, Palo Alto, CA, USA). Gene expression was assessed by real-time PCR using a LightCycler 480 Real-Time PCR System (Roche Diagnostics, Barcelona, Spain), using TaqMan and SYBRgreen tech- nology suitable for relative genetic expression quantification. The RT-PCR reaction was performed in a final volume of 12 mL. The cycle program consisted of an initial denaturing of 10 min at 95C then 40 cycles of 15 s denaturizing phase at 95C and 1 min an- nealing and extension phase at 60C. A threshold cycle (Ct value) was obtained for each amplification curve and a DCt value was first calculated by subtracting theCt value for human cyclophilin A (PPIA) RNA from theCt value for each sample. Fold changes compared with the endogenous control were then determined by calculating 2-DCt, so gene expression results are expressed as expression ratio relative to PPIA gene expression according to manufacturers’ guidelines. The commercially available and pre-validated TaqMan primer/probe sets used were as follows: Peptidylprolyl isomerase A (cyclophilin A) (4333763, PPIA as endogenous control), insulin receptor substrate 1 (IRS1, Hs00178563_m1), solute carrier family 2 member 4 (SLC2A4 or GLUT4. Hs00168966_m1). Human PPARg1 [forward: 50-GGCCGCAGATTTGAAAGAAG-30 and reverse: 50-GGAGAGATCCACGGAGCTGAT-30] and PPARg2 [forward: 50-AAACCCCTATTCCATGCTGTTATG-30 and reverse: 50- TGTCAACCATGGTCATTTCTTGTG-30] weremeasured using SYBRGreen technology. QUANTIFICATION AND STATISTICAL ANALYSIS All statistics were performed using SPSS 25. Data points were excluded if they exhibit a value of more than two standard deviations from the mean. For all metabolic tests animals were randomly ordered into metabolic chambers (calorimetry) or to order in which experiments were conducted (GTT, Euglycaemic-hyperinsulinaemic clamps). Statistical significant was set at a p value of < 0.05. Specific tests are detailed in the figure legends. DATA AND SOFTWARE AVAILABILLITY https://data.mendeley.com/datasets/whn4s7nyww/draft?a=22693287-b601-457c-85a9-9903c6d88639Cell Reports 24, 2005–2012.e1–e7, August 21, 2018 e7