Identification of Host Cellular Factors that Regulate Human Norovirus Replication by Sabastine Eugene Arthur Downing College Thesis submitted for the degree of Doctor of Philosophy August 2020 Division of Virology, Department of Pathology, University of Cambridge, Addenbrooke’s Hospital, Hills Road, Cambridge. i Abstract The human norovirus (HuNoV) is one of the most predominant causes of gastroenteritis, yet no suitable therapeutics are available for its control. Currently, our knowledge of the precise cellular processes that control its replication is limited. In this study, we used the virus replicon system in human gastric tumour (HGT) cells to determine host factors involved in human norovirus replication, and to analyse the adaptive changes required to support its long-term replication in cell culture. First, using a genome-wide microarray screen, we found that the expression of the receptor for type III interferons is suppressed by epigenetic modification of its promoter, and cells lacking the receptor were more permissive for HuNoV replication. Secondly, the role of the heat shock protein 90 (Hsp90) on HuNoV replication was examined. While this molecular chaperone was previously reported to have a proviral effect on murine norovirus infection, in this current study, we observed that inhibition of the protein with small molecule inhibitors resulted in the degradation of key cellular proteins in the innate immune pathway, with a corresponding increase in virus replication in replicon- harbouring cells. Finally, we showed that human norovirus replication requires the activity of COX-1 so that the inhibition of the enzyme with a small molecule inhibitor (SC-560) reduced virus replication. Prostaglandin E2 supplementation abrogated the effect of SC560 on HuNoV replication. We also observed that a prolonged treatment of the replicon-harbouring cells with SC-560 resulted in the generation of a single amino acid mutation, T229A, in the NS1/2 of the replicon. Introduction of this mutation in the wildtype HuNoV replicon conferred resistance to the inhibitory effect from COX- 1 inhibition by SC-560. Altogether, this work provides new insights into the key dynamics of virus-host interactions that determine the outcome of HuNoV infections, and potentially opens novel avenues for their therapeutic control. ii Declaration I declare that this thesis and all data herein are the result of my own work, unless otherwise stated. Secondly, this thesis is not substantially the same as any that I have submitted, or, is being concurrently submitted for a degree or diploma or other qualification at the University of Cambridge or any other University or similar institution. I further state that no substantial part of my dissertation has already been submitted, or, is being concurrently submitted for any such degree, diploma or other qualification at the University of Cambridge or any other University or similar institution. Lastly, this thesis does not exceed the prescribed word limit for the relevant Degree Committee. iii Acknowledgements Foremost, I would like to express my sincere gratitude to my supervisor, Prof. Ian Goodfellow for his continuous support throughout my intense PhD journey, in and out of the lab. His patience, motivation, enthusiasm, and professionalism contributed a lot to the success of my study. Moreover, my sincere thanks also go to Dr. Frederic Sorgeloos for his friendship and laboratory support. He was almost a co-supervisor to me. I thank all my mates in the Goodfellow lab, especially, Dr. Myra Hosmillo and Dr. Aminu Jahun for their support, advise and friendship. They stimulated intelligible discussions during the usual long hours of work together on our separate projects to keep the company of one another. Furthermore, I thank all my friends in the Division of Virology at the Department of Pathology, Downing College and the Cambridge community for the encouragement throughout my academic walk. Also, to all the friends I made outside of my academic work, at church or playing football, I say a big thank you for the friendly environment that helped me release stress for new energy each day. A big thank you to the Cambridge Africa team, past and present, for their immense support in this journey. Finally, I would like to thank my parents to whom I dedicate my work, Mr. Augustine Arthur and Mrs. Agnes Arthur (deceased) for supporting me in all aspects of my life and also trusting in me. To my siblings, Mark, Elizabeth, Bernard (deceased), Emmanuel, Esther and Ruth, thank you so much for the love. iv Table of Contents Abstract ........................................................................................................................ i Declaration .................................................................................................................. II Acknowledgements .................................................................................................... III Table of contents ....................................................................................................... IV List of figures ............................................................................................................ VIII List of tables ............................................................................................................... XI Abbreviations ............................................................................................................ XII Chapter 1 Introduction ................................................................................................ 1 1.1. NOROVIRUS PHYSIOPATHOLOGY ........................................................................... 2 1.2. NOROVIRUS CLASSIFICATION AND GENOME ORGANISATION ..................................... 2 1.3. THE NOROVIRUS LIFE CYCLE ................................................................................ 7 1.4. NOROVIRUS-HOST INTERACTIONS ......................................................................... 9 1.5. IN VITRO SYSTEMS USED TO STUDY HUNOV ........................................................ 17 1.6. RESEARCH RATIONALE ...................................................................................... 23 1.7. THESIS OBJECTIVES ................................................................................... 23 Chapter 2 Materials and Methods ............................................................................ 25 2.1. CELLS AND MEDIA ............................................................................................. 26 2.2. MICROARRAY ANALYSIS ..................................................................................... 26 2.3. QUANTITATIVE RT-PCR ANALYSIS ..................................................................... 27 2.4. NUCLEIC ACID TRANSFECTION AND IFN TREATMENT ............................................ 29 2.5. COLONY FORMING ASSAYS ................................................................................. 30 2.6. HUMAN INTESTINAL ENTEROID INFECTIONS ......................................................... 31 v 2.7. IMMUNOFLUORESCENCE MICROSCOPY ................................................................ 31 2.8. WESTERN BLOTTING AND ENZYME-LINKED IMMUNOSORBENT ASSAY (ELISA) ....... 32 2.8. GENERATION OF IFNAR1 OR IFNLR1 KNOCKOUT HGT CELLS ............................. 33 2.10. GENERATION OF RECOMBINANT HUNOV REPLICON RNA .................................. 34 2.11. CELL CYTOTOXICITY ASSAY .............................................................................. 34 2.12. INHIBITION ASSAY ............................................................................................ 35 2.13. MCRBC CLEAVAGE ASSAY ............................................................................... 35 2.14. STATISTICAL ANALYSIS AND DATA SHARING ....................................................... 36 Chapter 3 Epigenetic Suppression of Interferon Lambda Receptor Expression Leads to Enhanced Human Norovirus Replication In Vitro .................................................. 37 BACKGROUND .......................................................................................................... 38 RESULTS ................................................................................................................. 39 3.1. Generation and characterization of human cell lines bearing stable human norovirus replicons. ............................................................................................ 39 3.2. Viral adaptive changes enhance replication in a cell line-specific manner . 41 3.3. Cured population of HGT-NV cells demonstrate enhanced HuNoV replication. ........................................................................................................................... 44 3.4. An alteration in cellular environment is responsible for enhanced viral replication in HGT-Cured cells. .......................................................................... 45 3.5. Sensing of cytosolic RNA and DNA PAMPs by the innate immune system is functional in the HGT-based cells. ..................................................................... 55 3.6. The ability to respond to type III but not type I IFN in HGT-NV and HGT-Cured cells is debilitated. .............................................................................................. 56 3.7. IFNLR1 overexpression rescues STAT1 phosphorylation in response to IFN lambda and decreases viral replication. ............................................................ 58 vi 3.8. Inactivation of interferon type I and III receptors increases HuNoV replication in epithelial cells. ................................................................................................ 60 3.9. IFNLR1 is methylated in HGT-NV and HGT-Cured cells. ........................... 61 3.10. IFNLR1 promoter is methylated across the transcription start site ........... 62 3.11. Cellular factors beyond interferon response possibly enhance HuNoV replication. ......................................................................................................... 64 DISCUSSION ............................................................................................................ 66 Chapter 4 Interferon-Mediated Restriction of Human Norovirus Replication Requires Hsp90 Activity .......................................................................................................... 75 BACKGROUND .......................................................................................................... 76 RESULTS ................................................................................................................. 78 4.1. Hsp90 restricts HuNoV replication. ............................................................. 78 4.2. Hsp90 is required for robust induction of ISGs in HuNoV replication. ........ 81 4.3. Hsp90 inhibition impairs the induction of IFN in human norovirus replicon harbouring cells. ................................................................................................ 83 4.4. Hsp90 inhibition abrogates JAK/STAT signaling in human norovirus replicon- harbouring cells. ................................................................................................ 85 4.5. Hsp90 is required for the stabilization of key proteins in the IFN response pathway. ............................................................................................................ 86 DISCUSSION ............................................................................................................ 88 Chapter 5 Single Amino Acid Substitution in Human Norovirus NS1/2 Confers Resistance to COX-1 Inhibition-Mediated Inhibition of Replication In Vitro .............. 93 BACKGROUND .......................................................................................................... 94 RESULTS ................................................................................................................. 95 vii 5.1. COX-1 is required for the replication of HuNoV replicon ............................ 95 5.2. PGE2 supplementation abrogates the effect of COX-1 inhibitor on HuNoV replication .......................................................................................................... 98 5.3. Selection of HGT-NV cells with reduced susceptibility to SC-560-mediated inhibition of replication. ...................................................................................... 99 5.4. Characterization of HGT-NV-based cells. ................................................. 102 5.5. Resistance of HGT-NV cells to SC-560 is conferred by the viral genome. ......................................................................................................................... 103 5.6. Resistance to SC-560-medaited inhibition of replication is due to mutation the virus nonstructural protein NS1/2. ................................................................... 105 DISCUSSION .......................................................................................................... 107 Chapter 6 Conclusions and Future Studies ........................................................... 112 References ............................................................................................................. 116 viii List of Figures Figure 1.1 Genome organization of HuNoV Figure 1.2 The Norwalk virus-like particle (NV VLP) structure Figure 1.3 Schematic overview of the norovirus life cycle Figure 1.4 The Hsp90 domain structure and function Figure 1.5 Schematic of the IFN response pathway in host cells Figure 1.6 Schematic representation of the genome organization of the Norwalk virus and the replicon RNA Figure 3.1 Generation and characterization of stable HuNoV replicons in HGT cell lines Figure 3.2.1 Schematic representation of the Norwalk virus genome showing positions of mutations accumulated in the RNA replicons Figure 3.2.2 Adaptive changes in both viral RNA and host cell determines the success of viral replication Figure 3.3 HGT-Cured cells demonstrate enhanced HuNoV replication Figure 3.4.1 Microarray analysis of differentially regulated genes between HGT-NV, HGT-Cured and parental HGT cells Figure 3.4.2 Validation of differentially regulated genes between HGT-NV, HGT- Cured and parental HGT cells from microarray analysis Figure 3.5 Innate immune responses to RNA and DNA PAMPs are functional in HGT-based cells Figure 3.6 The ability to respond to type III but not type I IFN is debilitated in HGT- NV and HGT-Cured cells ix Figure 3.7 Overexpression of IFNLR1 in HGT-NV and HGT-Cured cells rescues the ability to respond to type III IFN and negatively impacts HuNoV replication Figure 3.8 Genetic ablation of IFNAR1 and IFNLR1 promotes HuNoV replication. Figure 3.9 IFNLR1 promoter is methylated during long-term HuNoV replication Figure 3.10 Assessment of IFNLR1 promoter methylation status in HGT-based cells Figure 3.11 Additional factors to type I and type III interferon response are important in restricting HuNoV replication Figure 3.12 Schematic of cellular adaptation that leads to permissibility to stable HuNoV replication Figure 4.1 Hsp90 restricts HuNoV replication. Figure 4.2 Hsp90 is required for robust induction of ISGs in HuNoV replication Figure 4.3 Hsp90 inhibition impairs the induction of IFN in human norovirus replicon harbouring cells Figure 4.4 Hsp90 inhibition abrogates JAK/STAT signaling in human norovirus replicon harbouring cells Figure 4.5 Hsp90 stabilizes proteins in the IFN response pathway Figure 5.1 Small molecule inhibition of COX/PGE2 reduces HuNoV replication Figure 5.2 COX-1-mediated inhibition of HuNoV is reversed by the addition of exogenous PGE2 Figure 5.3 HGT-NV cells develop resistance to SC-560 following repeated treatment with the drug. Figure 5.4 Characterization of HGT-NV based cells x Figure 5.5 HuNoV replicon is responsible for resistance to SC-560 in HGT-NV cells Figure 5.6 Single amino acid change in the HuNoV replicon confers resistance to SC-560-mediated inhibition of replication xi List of tables Table 2.1 List of inhibitors Table 2.2 List of primers and probes Table 2.3 List of antibodies used for western blot Table 3.1 Comparison of HuNoV replicon RNA sequences between HGT-NV and BHK-NV Table 3.2 Comparison of gene expression profiles between HGT cells and HGT-NV cells at FC ≥ 2 and FDR = 0.01 Table 3.3 Comparison of gene expression profiles between HGT cells and HGT-Cured cells at FC ≥ 2 and FDR = 0.01 Table 3.4 Comparison between HGT-NV and Huh-7-NV transcriptomes filtered at FDR < 0.01 Table 5.1 Inhibitory effect of COX inhibitors in HuNoV replicon-containing cells xii Abbreviations 2-CMC 2′-C-methylcytidine AAV-2 Adeno-associated virus-2 ACAT Acetyl-CoA acetyltransferase BHK Baby hamster kidney CHIP Chromatin immunoprecipitation COX Cyclooxygenase DKO Double knockout EBV Epstein-Barr virus EIF Eukaryotic initiation factor ELISA Enzyme-linked immunosorbent assay ER Endoplasmic reticulum FC Fold change FCV Feline calicivirus FDR False discovery rate FFAT Phenylalanine phenylalanine acidic tract FMDV Foot and mouth disease virus GCDCA Glycochenodeoxycholic acid GEO Gene expression omnibus GRP Glucose regulated protein HBGA Histo-blood group antigen HCV Hepatitis C virus HDAC Histone deacetylase HGT Human gastric tumour HOXC11 Homeobox C11 xiii HPE Human prostaglandin E HPV18 Human papillomavirus 18 Hsp90 Heat shock protein 90 HSPE Heparanase HSV Herpes simplex virus HuNoV Human norovirus IAV Influenza virus IFN Interferons IFNAR Interferon alpha receptor IFNLR1 Interferon lambda receptor 1 IL10RB interleukin 10 receptor beta IRF3 Interferon regulatory factor 3 ISG Interferon stimulating gene ISGF3 Interferon Stimulated gene factor 3 ISRE Interferon-stimulating response element JAK Janus Kinase LDLR Low density lipoprotein receptor LGP2 laboratory of genetics and physiology 2 MAVS Mitochondrial antiviral signaling protein MDA-5 myeloma differentiation-associated protein 5 MNV Murine norovirus MSP Major sperm protein MX1 Myxoma resistance protein 1 NS Non-structural proteins NTPase Nucleoside triphosphatase xiv ORF Open reading frame PABP Poly A binding protein PCR Polymerase chain reaction PG Prostaglandin PITX1 Paired like homeodomain 1 PLSCR1 Phospholipid scramblase 1 Pro Protease PRR Pattern recognition receptors PSaV Porcine Sapovirus PTGS Prostaglandin-endoperoxide synthase 1 RAG1 Recombination activating gene 1 RdRp RNA dependent RNA polymerase RIG-I retinoic acid-inducible gene 1 RIPA Radioimmuno-precipitation assay RLR retinoic acid-inducible gene 1-like receptor RT-qPCR Quantitative Real Time PCR RTP Receptor transfer protein RUX Ruxolitinib SF3 Super family 3 SgRNA Subgenomic RNA siRNA Small interfering RNA STAT Signal transducer and activator of transcription SV40 Simian virus 40 TBK TRAF family member associated NF-kB activator binding kinase TLR Toll-like receptor xv TNF Tumour necrosis factor TRAF TNF receptor associated factor TRIM7 Tripartite motif containing 7 TSS Transcription Start Site Tyk tyrosine kinase UTR Untranslated region VAPA Vesicle-associated membrane protein associated protein A VPg Viral protein genome-linked 1 Chapter 1 Introduction 2 1.1. Norovirus physiopathology Acute gastroenteritis usually affects children at least once in their lifetime, typically before the age of five (Guarino et al. 2014). Rotavirus and human noroviruses have been the leading causes of acute gastroenteritis (Fletcher et al. 2013) until the discovery of the rotavirus vaccine, leaving human noroviruses (HuNoVs) as the leading cause of the disease (Glass et al. 2009; Hall et al. 2013; Lopman et al. 2013). The human norovirus disease is usually acute and self-limiting, but may be persistent and can lead to hospitalization in the aged, children and the immunocompromised, with cases of subsequent mortalities recorded (Belliot et al. 2014; Lopman et al. 2016; Ludwig et al. 2008; Patel et al. 2008; Payne et al. 2013; Phillips et al. 2010). Symptoms include, but are not limited to, projectile vomiting, high-grade and low-grade fever, headaches, and diarrhoea. The main modes of HuNoV transmission are faecal-oral through ingestion of contaminated food and water and person-to-person through contaminated fomites surfaces (Becker et al. 2000; Koopmans and Duizer 2004). Despite the profound threat to public health and the global economic impact, estimated to be £50 billion annually (Bartsch et al. 2016), there are currently no licensed vaccines or therapeutics against HuNoV. 1.2. Norovirus classification and genome organisation Norovirus is one of the genera under the family Caliciviridae. The family Caliciviridae is made up of single-stranded positive-sense RNA viruses which are non-enveloped. It includes the genera Vesivirus, Lagovirus, Norovirus, Sapovirus, Nebovirus and the relatively newly discovered Recovirus. Additional tentative genera including Bavovirus, Minovirus, Nacovirus, Salovirus, and Valovirus have been recently classified under the Caliciviridae family (K. Y. Green et al. 2000; Vinjé et al. 2019; Desselberger 2019). The Norovirus genus is further classified into seven genogroups 3 (GI-GVII). Human norovirus belongs to genogroups GI, GII and GIV (Zheng et al. 2006). Noroviruses under GIII infect cows and sheep, GV infect mice, GVI infect cats and dogs and GVII infect dogs. Additionally, viruses that affect pigs, are also classified under GII. Noroviruses in GIV also infect cats and dogs in addition to humans (Caddy et al. 2014; Chang et al. 2005; Ford-Siltz et al. 2019; Karst et al. 2003; Martella et al. 2008; Parrino et al. 1977; Wolf et al. 2009; Woode and Bridger 1978). The human norovirus genome is made of a 7.5 kb single-stranded positive-sense RNA molecule. It has a viral protein genome-linked (VPg) covalently attached to the N- terminus of both the genomic and subgenomic RNA (sgRNA) (Burroughs and Brown 1978), with a polyadenylated 3’UTR (Fig. 1.1). The entire viral genome encodes three open reading frames (ORFs). The first ORF codes for six non-structural (NS) proteins. These are p48 (NS1-2), NTPase (NS3), p22 (NS4), VPg (NS5), virus encoded protease (NS6) and the RNA-dependent RNA polymerase (RdRp) (NS7). Despite being located on the total viral genomic RNA, the second and third ORFs are localized on the sgRNA and they code for the major (VP1) and minor (VP2) capsid proteins, respectively. Figure 1.1 Genome organization of HuNoV. The genome of the virus has a viral protein genome-linked (VPg) attached covalently to the N-terminus and a polyadenylated 3’UTR. It is made up of three ORFs. ORF1 is the genomic RNA and codes for six non-structural proteins, p48, NTPase, p22, VPg, virus encoded protease (Pro) and the RNA-dependent RNA polymerase (RdRp or Pol). The second and third ORFs are the subgenomic RNAs and they code for the major (VP1) and minor (VP2) capsid proteins, respectively. Several functions have been described for the various NS proteins and their precursor forms in the life cycle of noroviruses. In contrast to all other norovirus NS proteins which are cleaved by the viral protease, the NS1/2 is usually cleaved by host proteins 4 (Seah et al. 2003; Sosnovtsev et al. 2006). While the human norovirus NS1-2 precursor has not been properly characterised (Thorne and Goodfellow 2014), studies on the murine norovirus (MNV) and feline calicivirus (FCV) have suggested some functions of this protein precursor. During infection, caspase-3-mediated cleavage of full length NS1-2 in MNV contributes to virus spread and persistence in intestinal epithelial cells (Robinson et al. 2019). Also, NS1 of MNV persistent strain, CR6, antagonised the establishment of an interferon-mediated antiviral response (Lee et al. 2017). Further, interaction of a VAMP-associated protein A (VAPA) with the NS1 domain of MNV NS1/2 enhanced replication of the virus and it was shown that a mutation in the NS1 domain disrupted the interaction and negatively regulated virus replication (McCune et al. 2017). Finally, norovirus NS1/2 localises to endoplasmic reticulum (ER) promoting its reorganization providing a platform for the formation of replication complexes (Doerflinger et al. 2017; Jennifer L. Hyde and Mackenzie 2010). Like NS1-2, the NS3 protein has important functions in norovirus replication. This protein has signature motif similarities to the superfamily 3 (SF3) viral helicases. Examples of such helicases include the human enterovirus 2CATPase (EV71 2CATPase) (Xia et al. 2015), human papillomavirus 18 (HPV18) E1 protein (Lin et al. 2002), adeno- associated virus 2 (AAV2) Rep40 (Collaco et al. 2003; Zarate-Perez et al. 2012) and simian virus 40 (SV40) large T antigen (LTag) (Li et al. 2003). Norovirus NS3 possesses a nucleoside triphosphatase (NTPase) activity and its association with the replication complex during virus replication has been reported to be responsible for unwinding viral double-stranded RNA replicative intermediates (Pfister and Wimmer 2001). Additionally, the norovirus NS3 induces the formation of vesicular structures which colocalise with cholesterol-rich cellular membranes (Cotton et al. 2017). Further 5 work suggested that the NS3 of HuNoV strain GI.1 possesses an RNA chaperoning and an NTP-independent helicase activity (Li et al. 2017). Not much is known about the involvement of the norovirus NS4 protein in replication. The protein has been previously reported to associate with the Golgi apparatus and endosomes, as well as recruit host factors to the replication complex (Jennifer L. Hyde and Mackenzie 2010). The NS5 (VPg) protein is a multifunctional protein involved in replication and translation. The VPg serves as a cap analogue in the viral genome which provides protection and escape from host immune recognition (Goodfellow 2011). The protein also interacts with and recruits components of the host translation machinery, eukaryotic initiation factor 3 (eIF3) and eIF4E to drive virus translation (Chaudhry et al. 2006; Goodfellow et al. 2005; Daughenbaugh 2003). Further, following its nucleotidylylation by the virus-encoded RdRp, the norovirus VPg serves as a primer to initiate the synthesis of viral polyadenylated RNA (Rohayem et al. 2006). The norovirus 3C protease, NS6, is involved in polyprotein processing which leads to production of matured and functional viral protein precursors (Belliot et al. 2003; Liu et al. 1996; Seah et al. 1999; Someya et al. 2000). In noroviruses and FCV, the protein is reported to be involved in the cleavage of poly(A)-binding protein (PABP) and inhibit host protein translation (Kuyumcu-Martinez et al. 2004; Emmott et al. 2017). The norovirus RdRp (NS7) which contains the conserved catalytic domain and is responsible for the initiation of de novo synthesis of RNA on non-polyadenylated templates and primer (VPg)-dependent initiation of RNA synthesis on polyadenylated templates (Thorne and Goodfellow 2014; Gohara et al. 2000). The norovirus VP1 codes for the major capsid protein which interacts with the Histo- Blood Group Antigen (HBGA) as the initial attachment step during infection and has been shown to be responsible for the escape from neutralizing antibodies (Choi et al. 6 2008; A. M. Hutson et al. 2003). The norovirus VP2 codes for the minor capsid protein, which is thought to be involved in genome encapsidation, virion assembly, VP1 stability and in FCV it has pore-forming activities (Conley et al. 2019; Glass et al. 2000; Vongpunsawad et al. 2013). Figure 1.2. The Norwalk virus-like particle (NV VLP) structure (Hutson et al. 2004). Surface representation and cross-section of the NV VLP as observed when reconstructed by cryo-electron microscopy to 22 Å and by x-ray crystallography to 3.4 Å. The virus capsid protein is assembled into a T=3 icosahedral symmetry made up of 90 dimers of the protein (left). Each monomer is divided into the N-terminal arm, S- domain and P-domain which is further divided into the P1- and P2-domain. Refer to text for functions of the domains. The sub genomic RNA of each virion translates into 180 copies of VP1 which is 59 kDa in size and one or two copies of 30 kDa VP2. Typically, the capsid protein of the norovirus is a 90-dimer structure that organises into a T=3 icosahedron symmetry (Fig. 1.2). The monomeric capsid proteins are divided into three main parts, the N-terminal arm which faces the interior of the capsid. The S-domain is the shell domain that runs P2-domain P1-domain S-domain N terminal arm Dimer Monomer Capsid interior Surface representation Cross-section 7 continuously across the surface of the capsid and mainly forms the icosahedral shell (Prasad 1999). The P-domain which is the protruding domain is further subdivided into the P1 and P2 (most distal) subdomains are the protrusions on the surface of the capsid. The P-domain is thought to determine strain specificity and cell-binding properties of the virus (Prasad et al. 1999; Vongpunsawad et al. 2013). 1.3. The norovirus life cycle The life cycle of HuNoV is not well explored, again, owing to the lack of cell culture model, until recently. However, advances have been made with the MNV model which on the contrary has been extensively studied. The lifecycle of noroviruses (Fig. 1.3) begin with the attachment of the viral particle to the host cell surface which is at least partly thought to be mediated by binding to Histo-blood group antigens (Marionneau et al. 2002). After entering the host cell, there is uncoating and release of the viral genome into the cytosol. Following these events, VPg-dependent translation of the viral positive-sense RNA genome occurs using the host cell translation machinery. The first open reading frame which codes for the NS proteins is initially translated, followed by the structural proteins. Co- and post-translational cleavage of the ORF1 polyprotein by the NS6 protease then occurs to release the NS proteins and their precursors, some of which are involved in the formation of the replication complex (Thorne and Goodfellow 2014). Since the genome of noroviruses is positive-sense, replication of the genomic and subgenomic RNA proceeds through a negative-strand intermediate. Two mechanisms (de novo and VPg-dependent initiations) have been described for the synthesis of the genome, both driven by the RdRp (reviewed by Thorne and Goodfellow 2014). The de novo initiation of negative-sense RNA synthesis occurs following the binding of the RdRp to the 3’ end of the positive-sense RNA. This is followed by a direct interaction 8 Figure 1.3. Schematic overview of the norovirus life cycle. (1) The virus recognizes and attaches to host surface carbohydrate-based receptors. This is thought to be followed by binding to an unidentified protein receptor to mediate entry (2). Subsequently, the virus enters the host cell (3) and uncoats (4) in a process that is not yet defined. (5) Translation of the viral genome follows uncoating the VPg (red triangle) linked to the 5’ end of the genome interacting with cellular translation machinery. (6) The viral protease (Pro) co- and post-translationally cleaves the ORF1 polyprotein. (7) The replication complex is formed, and genome replication occurs through a negative-strand intermediate, and genomic and subgenomic RNA are synthesised by the viral RdRp (Pol) through both de novo and VPg-dependent mechanisms of RNA synthesis (8). (9) The replicated genomes are translated (within the replication complex) or packaged into the capsid, VP1, for virion assembly and exit (10). This figure was adapted from Thorne and Goodfellow (2014). 9 between the RdRp and specific loop sequences in the VP1 shell domain (unpublished), leading to the synthesis of the negative strand RNA. Following this, VPg-dependent RNA synthesis occurs where the RdRp utilizes VPg as a primer to synthesize viral positive strand RNA from the negative strand template (Thorne and Goodfellow 2014). The initial synthesis of the subgenomic RNA has been described in two models (Thorne and Goodfellow 2014). First is the pre-mature termination model where a termination signal encountered by the RdRp leads to the synthesis of the subgenomic negative-sense RNA. This RNA intermediate serves as a template for the synthesis of positive-sense RNA through the recognition of a subgenomic promoter in the negative- sense RNA intermediate using the covalently linked VPg as a primer. Evidence of this mechanism have been reported in HuNoV replicon-harbouring Huh-7 cells (HG23) where a negative-sense subgenomic RNA was identified (Chang et al. 2006). It was also reported in a study where an enzymatically active replication complex purified from cells infected with MNV or FCV (Green et al. 2002; Yunus et al. 2015). The second model is the internal initiation where the RdRp binds to a conserved stem loop up upstream of the negative-sense subgenomic RNA start site in the VP1 to initiate the synthesis in a VPg-dependent manner (Yunus et al. 2015). Replication of the viral genome is followed by secondary translation rounds and assembly of the genome into the viral capsid, followed by exit from the host cell. The process of assembly and release of the virus to the extracellular matrix is not well understood (Thorne and Goodfellow 2014). 1.4. Norovirus-host interactions Although most approaches to developing antivirals have typically relied on targeting viral factors (Deas et al. 2007; Smith et al. 2002; Vagnozzi et al. 2007), some have 10 focused on targeting host cellular factors involved in the viral life cycle (Gonzalez- Hernandez et al. 2014; Rocha-Pereira et al. 2014). This is in part due to the high error rates of the viral RdRp and the limitations posed by the ability of RNA viruses to readily generate drug resistance mutations (Silver and Bostian 1993; Thorne et al. 2016). Vashist and colleagues identified a network of host proteins that interact with the MNV genome extremities using riboproteomics analysis (Vashist et al. 2012). In their study, they discovered and validated that polypyrimidine tract-binding protein, La protein, and DEAD-Box helicase 3 are all proviral. Also, heterogenous nuclear ribonucleoprotein A1 and poly(rC)-binding protein 2 were shown to interact with the 5’ and 3’ extremities of the genomic RNA of MNV to induce and stabilize circularization of the genome. The knockdown of these proteins with siRNAs reduced virus titre in vitro, suggesting their importance in the viral life cycle (Lopez-Manriquez et al. 2013). The interactions of most of these proteins with the 5’ and 3’ ends of the MNV genome has also been shown for HuNoV (Gutierrez-Escolano et al. 2000; Gutiérrez-Escolano et al. 2003). Several other studies have shown an interaction between norovirus VPg and eukaryotic translation initiation factors (eIFs) to drive the translation of the viral genome (Daughenbaugh 2003; Chaudhry et al. 2006). In our lab, a recent study using CRISPR screening identified G3BP1, a component of stress granules, as one of the significantly enriched proteins in MNV infection. The protein was shown to interact with HuNoV and MNV VPg and increases both HuNoV and MNV replication in vitro (Hosmillo et al. 2019). Other studies have demonstrated that G3BP1 aided MNV in escaping stress granules and increasing replication (Brocard et al. 2020; Fritzlar et al. 2019). The host cell surface protein CD300If and CD300Id were shown by whole-genome CRISPR/Cas9 loss-of-function screen to be required for MNV binding in mammalian 11 cells (Orchard et al. 2016; Haga et al. 2016). Recently, Orchard and co-authors (2018) employed a CRISPR activation screen assay on Hela cells stably expressing CD300If and infected with different strains of MNV. The authors identified TRIM7, PITX1, MX1, PLSCR1, HOXC11 and DDX60 among others as proteins with antiviral activity against MNV. Also, it was confirmed that TRIM7 blocked MNV during infection at a step after entry into the host cell (Orchard et al. 2018). Chang (2009) identified the cholesterol and carbohydrate metabolic pathways as being differentially regulated during virus replication in HG23 cells, a replicon- harbouring human hepatoma (Huh-7) cell line (Chang 2009). This work confirmed cholesterol as important for norovirus replication and has been backed up by clinical data and in vivo experimental data in pigs, showing that cholesterol-reducing drugs promoted HuNoV replication (Jung et al. 2012; Bui et al. 2013). Previously, an association between the Golgi apparatus and human norovirus NS1/2 was shown to disrupt vesicular trafficking (Ettayebi and Hardy 2003; Fernandez-Vega et al. 2004). Also, NS1/2 is known to interact with VAMP-associated protein A (VAPA) in a mammalian cell (Ettayebi and Hardy 2003) but the outcome of this interaction was only reported recently. McCune and colleagues showed that in cells lacking VAPA and VAPB, there was a significant reduction in MNV replication and when mutations were introduced in NS1/2 to disrupt the NS1/2-VAPA interaction, a similar phenotype was produced. The authors further showed that phenylalanine–phenylalanine-acidic-tract (FFAT) motif used by host proteins to directly interact with VAPA major sperm protein (MSP) was mimicked in the NS1 domain of the virus, enabling the viral protein and the host protein to bind and increase virus replication (McCune et al. 2017). The interaction of heat shock protein 90 (Hsp90) with norovirus capsid protein confers stability to the capsid proteins and the inhibition of its activity led to a significant 12 reduction in MNV replication (Vashist et al. 2015). Hsp90 is a 90kDa protein in the heat shock protein (HSP) family which are highly conserved proteins that function as chaperones to aid in proper folding and unfolding, formation of protein complexes and sorting proteins into compartments in cells (Li and Srivastava 2003). Structurally, Figure 1.4. The Hsp90 domain structure and function. The Hsp90 monomers dimerize through the C-terminal upon binding with ATP through the N-terminal domain. The middle domain which is linked with the N-terminal domain through the charged linker recognises and interacts with the client protein. Figure was adapted from Karademir and Sari-Kaplan (2018). Hsp90 is a homodimer with three conserved domains— N-terminal domain (NTD), middle domain (MD) and C-terminal domain (CTD)— and an amino acid-rich charged- linker region (CR) which is only present in eukaryotes (Fig. 1.4) (Pearl and Prodromou 2006). The NTD contains the ATP binding site and is responsible for interacting with co-chaperones (Meyer et al. 2004). The MD interacts with client proteins, as well as activates ATP hydrolysis in the NTD (Pearl and Prodromou 2006). CTD is responsible for the dimerization of Hsp90 and also thought to be involved in its interaction with Hsp70 (Ratzke et al. 2010; Scheufler et al. 2000). The CR enables flexibility of Hsp90 to facilitate the interaction between the NTD and MD during activation and processing N-terminal Domain (ATP/inhibitor binding) Charged linker Middle Domain (Client protein binding) C-terminal Domain (Dimerization) ATP Dimerization Open form Closed form ATP Client protein Client protein 13 of client proteins (Hainzl et al. 2009). The specific functions of Hsp90 are discussed further in Chapter 4. Cyclooxygenase (COX) encoded by the PTGS gene forms part of an enzyme system that oxidizes arachidonic acids to produce eicosanoids, which are signaling compounds that mediate a wide range of cellular functions ranging from physiological to pathological. Two isoforms of the PTGS gene exist in humans, PTGS1 which codes for the COX-1 enzyme and PTGS2 which codes for the COX-2 enzyme. COX-1 is expressed constitutively and functions in producing prostaglandins (PGs) to maintain tissue homeostasis, while COX-2 is inducible in several cells, with its expression regulated by mitogens, cytokines and endotoxins. The expression of this isoform is significantly increased in tissues undergoing inflammation and it is thought to produce PGs in the process (Carey et al. 2003; Smith et al. 2000; Williams et al. 1999). COX- 2 is also constitutively expressed in the brain and spinal cord and is involved in transmission in neurons during fever and pains (Vane et al. 1998). Additionally, PGs produced by COX-2 play a vital role in the processes of ovulation and childbirth (Chakraborty et al. 1996). Both RNA and DNA viruses have been reported to modulate the COX/PGE2 pathway to circumvent antiviral mechanisms of cells (Sander et al. 2017). Infections with gamma herpes viruses such as Epstein-Barr virus (EBV) and herpes simplex virus (HSV) induce COX-2 expression (Al-Salam et al. 2013; Shelby et al. 2005). Late membrane protein 1 of EBV expression increased with increase in COX-2 expression (Bai and Tang 2009). Prostaglandin E2 has been reported to be very important in the lifecycle of cytomegalovirus, ranging from cell-to-cell spreading, to restoring progeny formation that is decreased by COX inhibition, and increasing viral DNA copy numbers and plaque formation (Zhu et al. 2002; Hooks et al. 2006; Schroer and Shenk 2008). There is evidence suggesting that rotavirus infection 14 induces PGE2 expression and COX inhibition decreased the duration of diarrhoea in infants (Yamashiro et al. 1989). The Wa strain of rotavirus utilizes the PGE2 and COX pathway to establish infection in vitro (Rossen et al. 2004). Several other viruses have been reported to utilize the COX/PGE2 pathway in different aspects of their life cycle (reviewed by Sander et al. 2017). Despite its importance in creating a proviral condition for many viruses, there still exist viruses that are inhibited by the PGE2. For instance, in vitro and in vivo studies previously reported that treatment with PGE2 significantly reduced adenovirus, hepatitis B virus, measles virus and parainfluenza virus (Dore- Duffy 1982; Luczak et al. 1975; Flowers et al. 1994; Hyman et al. 1999). Although there is currently no information on the role of the pathway in HuNoV replication, a more detailed discussion on its role in the replication of MNV and other viruses is presented in Chapter 5. The interferon (IFN) response pathway has garnered more attention in the study of norovirus lifecycle. Fig. 1.5. represents a schematic overview of the interferon response in virus replication. Canonically, viral infection activates different innate immune sensors. This leads to the production of IFNs and the subsequent expression of IFN-stimulated genes (ISGs) to establish an antiviral state (Stark and Darnell 2012; Sen 2001). Specifically, upon invasion of a cell by a virus, the pattern recognition receptors (PRRs), which include toll-like receptors (TLRs) and retinoic acid-inducible gene 1 (RIG)-I like receptors (RLRs), sense replication intermediates of the virus. The RLRs are of the DExD/H box RNA helicase family. These are RIG-I and MDA5 (myeloma differentiation-associated protein 5), as well as LGP2 (laboratory of genetics and physiology 2). Upon sensing the viral RNA, RLRs oligomerize and interact with Mitochondrial antiviral signaling protein (MAVS) which in turn recruits downstream kinases. This subsequently leads to the coordinated activation of distinct signalling 15 pathways responsible for the activation of IRF-3/7 and NF-κB transcription factors which translocate into the nucleus and induce the transcription of IFN genes. The IFN type I (IFN-α/β), discovered more than half a century ago (Isaacs and Lindenmann, 1957), represents the major part of interferon response and the first to be produced during the establishment of an antiviral state. Type III IFN (IFN-λ) were discovered only a little over a decade ago (Kotenko et al. 2003; Sheppard et al. 2003). Although both cytokine families possess similar functions, a few but crucial differences exist in their biology. Notably, both cytokines signal through distinct heterodimeric receptors with type I IFN signalling through the interferon alpha/beta receptor (IFNAR) composed of the IFNAR1 and IFNAR2 subunits and type III IFN through the interferon lambda receptor (IFNLR) which consists of the interferon lambda receptor 1 (IFNLR1) and interleukin 10 receptor beta (IL10RB) subunits. Figure 1.5. Schematic of the IFN response pathway in host cells. The canonical pathway comprises the sensing of PAMP and induction of IFNs. This is followed by receptor binding and JAK/STAT signaling and the induction of interferon stimulated gene. Detail description in text. Figure was adapted from Bowie and Unterholzner (2008). 16 Expression of type I and III interferons is regulated at the transcriptional level and relies on the recognition of conserved pathogen-associated molecular patterns (PAMPs). Secreted IFNs then bind to their respective receptors and are thought to activate the Janus kinase (JAK) 1 and tyrosine kinase 2 for IFN-α/β and JAK1 and JAK2 in the case of IFN-λ. Subsequently, recruited signal transducer and activator of transcription 1 (STAT1) and STAT2 are activated through phosphorylation. Phosphorylated STAT1 and STAT2 dimerises and recruits IRF9 to form a complex called ISGF3 which is translocated into the nucleus, interacts with the ISRE and drive the expression of IFN stimulated genes (ISGs), some of which have direct antiviral activities (Dickensheets et al. 2013; Schoggins et al. 2011). Interferon lambdas are important players in both innate and adaptive immunity and have profound antiviral effects on a variety of viruses including cytomegaloviruses, dengue viruses, hepatitis B and C viruses, HIV, herpes simplex virus 1 and 2,influenza virus and rotavirus (Ank et al. 2008; Hemann et al. 2017; Lee and Baldridge 2017; Mordstein et al. 2010; Syedbasha et al. 2017). Expression of IFNLR1 on epithelial cells of the small intestine and colon was shown to be important in IFN-λ-mediated antiviral activity against persistent MNV and reovirus infection in vivo (Baldridge et al. 2017b). Treatment of persistently infected mice lacking adaptive immune response (Rag1−/−) with IFN-λ abolished viral replication, suggesting that IFN-λ can cure persistent MNV infection in absence of adaptive immunity and this ability requires the expression of IFNLR1 (Nice et al. 2015). In line with this, the effect of antibiotics that inhibit persistent MNV infection in the gut has also been shown to be dependent on IFNLR1 expression as well as IRF3 and STAT1 transcription factors (Baldridge et al. 2015b). It was observed that AG129 sentinel mice lacking the ability to respond to both IFN-α/β and IFN-λ housed together with MNV-infected mice developed a diarrhoea- 17 associated MNV infection. Overexpression of IFN-λ in sentinel mice upregulated ISG expression, inhibited MNV replication in the small intestine and prevented them from being infected when co-housed with MNV-infected mice (Rocha-Pereira et al. 2018a). While numerous studies of IFN-λ on the related murine norovirus have been published, there is a paucity of data on its human counterpart. It has been recently suggested that while the human norovirus replication is hampered by type I and III interferons treatment (Dang et al. 2018; Qu et al. 2016), HuNoV RNA replication does not seems not to induce innate immune responses implying that endogenous IFN response may have a limited role in controlling HuNoV infection (Qu et al. 2016). 1.5. In vitro systems used to study HuNoV Most of the attempts to understand HuNoV biology and pathogenesis have relied on surrogate viruses in the Caliciviridae family, including PSaV, MNV and FCV (Chang et al. 2005; Hosmillo et al. 2015; Vashist et al. 2009). The availability of a reverse genetic and cell culture systems for these viruses render them very useful in advancing our understanding of HuNoV lifecycle (Chang et al. 2005; Chaudhry et al. 2007; Hosmillo et al. 2015; Oka et al. 2014; Yunus et al. 2010). The MNV was first identified in immunocompromised mice in which the virus caused a lethal infection due to the lack of STAT1 expression and a systemic infection due to the lack of RAG1 expression (Karst et al. 2003). As this was the only cultivable norovirus, further studies were carried out with this virus, considering it to be the best surrogate for the study of HuNoV pathogenesis (Ward et al. 2007). Subsequently, it was reported that the in vivo and in vitro infection of MNV occurs in dendritic cells, microphages and B cells (Wobus et al. 2004; Jones et al. 2014). There is a wide distribution of MNV since the virus was isolated from both field and laboratory mice (Farkas et al. 2012; Kitajima et al. 2009; Perdue et al. 2007). The MNV and HuNoV 18 have conserved structural and functional nucleotide sequences, as well as share greater than 50% nucleotide sequence identities (Vashist et al. 2009; Bull et al. 2011; Subba-Reddy et al. 2012; Lin et al. 2015). Additionally, there are DNA- and RNA- based reverse genetics system developed for MNV (Chaudhry et al. 2007; Ward et al. 2007; Arias et al. 2012). These qualify MNV as model surrogate for studying the HuNoV lifecycle. However, although HuNoV and MNV are both enteric, the latter is limited in its ability to be used as a surrogate for the study of HuNoV because 1) MNV infection does not lead to any symptoms which was shown to be due to the induction of a STAT1-dependent IFN response (Mumphrey et al. 2007), and 2) CD300lf was reported to be the functional receptor for MNV but not HuNoV (Graziano et al. 2019; 2020). The tropism of noroviruses is an important component in advancing the development of an improved cell culture system for HuNoV. It has been shown that the MNV infects macrophages, dendritic cells and B-cells in vitro (Karst et al. 2014; Wobus et al. 2004; Jones et al. 2014). Additionally, in vivo studies have added myeloid cells, lymphocytes and tuft cells as cells that are infected by MNV (Grau et al. 2017; Lee et al. 2017; Wilen et al. 2018). On the other hand, in addition to B-cells that were shown to be infected by HuNoV, enterocytes of human intestinal enteroids could be infected with HuNoV in vitro (Ettayebi et al. 2016; Jones et al. 2015). The in vivo tropism of HuNoV is not well understood but viral antigens were detected in intestinal epithelial cells of gnotobiotic pigs, lamina propria of human biopsy samples and dendritic cells of chimpanzees infected with HuNoV (Bok et al. 2011; Karandikar et al. 2016; Cheetham et al. 2006; Souza et al. 2008). Although both MNV and HuNoV were successfully propagated in B cells in the presence of commensal bacteria (Jones et al. 2014; 2015), reproducibility of results 19 from this approach remained elusive and hence, the attempt to develop other reproducible approaches. Before the study by Jones and colleagues (Jones et al. 2014; 2015), several primary cell lines were tested in their ability to support HuNoV propagation, but none was successful or produced a reproducible cell culture system for the virus (Duizer et al. 2004). The authors suggested that the difficulty in developing the cell culture system might be due to the absence of a secretor or a binding factor from either the host or the virus, or possibly from both (Duizer et al. 2004). Other attempts to propagate HuNoV in a three-dimensional (3D) cell culture using intestinal epithelial cells (Int-407) or human epithelial colorectal adenocarcinoma cells (Caco-2) failed (Straub et al. 2011; Takanashi et al. 2014). In these studies, although there were successful infections, replication of the viral RNA did not occur. Another study to reproduce the propagation of HuNoV in the 3D cell culture system failed to show increase in replication despite observed interactions between the virus and the cells (Papafragkou et al. 2013). Taken together, the data suggest a cellular mechanism such as an established antiviral state which blocks virus replication (Papafragkou et al. 2013; Straub et al. 2011; Takanashi et al. 2014). Recently, a discovery was made in the field when a group successfully cultivated multiple HuNoV in human intestinal epithelial enteroids (Ettayebi et al. 2016). In this system, bile was required by certain strains of the virus for effective replication. The system has recently been used by our lab and others to study host cell requirements for HuNoV propagation (Alvarado et al. 2018; Costantini et al. 2018; Koromyslova et al. 2018; Hosmillo et al. 2020). However, we find that this system is limited by associated low virus yields, as well as high cost of maintenance and labour intensity – optimization is currently ongoing to reduce cost, labour intensity and enhance robustness of the system. 20 The virus replicon system is an in vitro model which relies on self-replicating RNA which was developed to study the lifecycle of viruses that are difficult to grow in a cell culture (Kaplan and Racaniello 1988; Khromykh and Westaway 1997; Lohmann 1999; Pushko et al. 1997). In the generation of the replicon system, two main steps are required. For instance, to generate the human norovirus (HuNoV) replicon system in baby hamster kidney cells (BHK-21), first, a capped virus RNA replicon was transfected into the cells and selected with the inhibitor, G418 (Geneticin). The RNA replicon was designed to contain a G418 resistant marker in its VP1 coding region (Fig. 1.5). The G418 selection marker is a gene that confers resistance to G418 (geneticin), an aminoglycoside that negatively regulates polypeptide formation by Figure 1.6. Schematic representation of the genome organization of the Norwalk virus and the replicon RNA. The Norwalk virus RNA replicon is generated from the full-length Norwalk virus RNA (Chang et al. 2006). A portion of the VP1 is deleted and a G418 selection marker which is 804 nucleotides in length is inserted, followed immediately by a stop codon (thin red line). Black arrow in the replicon RNA shows the position of the translation start codon for the ORF2. The replicon RNA is shorter in length compared to the wildtype RNA due to the deletion in VP1. inhibiting the elongation step in protein synthesis. Therefore, only cells that are successfully transfected and can sustain the RNA replicon are able to resist the drug, enabling their selection in the presence of the drug. Secondly, high-expression clones 21 of virus replicon-harbouring cells were selected by limiting dilution, followed by expansion to produce large stocks (Fig. 1.6) (Blight et al. 2000; Chang et al. 2006; Foy et al. 2003; Gale and Foy 2005). To maintain replication of the replicon RNA in the cells, replicon-harbouring cells are maintained and passaged continuously in the presence of the G418. Although the replicon system is a useful model for studying the replication and translation in the viral lifecycle, it has limitations, including its inability to be used to study virus attachment, entry, assembly and exit. This is because the replicon is artificially introduced into the cytosol of the cell by transfection and therefore does not go through the regular attachment and entry processes. Also, a non-functional structural protein, e.g. VP1 in the case of the norovirus replicon, is synthesized from the replicon, owing to the modification in the structural protein by insertion of a selection marker and the introduction of a stop codon immediately downstream of the marker. Hence, there is no packaging of virions and no transmission of virus to infect other cells. Notwithstanding its limitations, the replicon system has been used to demonstrate the influence of host factors on post-entry events in the lifecycle of several viruses. Using RNA replicons of the foot-and-mouth disease virus (FMDV), re-localization of Sam68 from the nucleus to the cytoplasm was observed to co-localize with two non-structural proteins of the virus to enhance replication (Rai et al. 2015). Several studies using the HCV replicon to study host factors involved in the life cycle exist (Denard et al. 2011; Foy et al. 2003; Sumpter et al. 2005; Wang et al. 2005; Ye et al. 2003). For instance, using a cell line expressing the HCV replicon RNA, Yoshida and co reported that an HCV protein interacts with and directly activates the signal transducer and activator of transcription-3 (STAT3). This event drives the rapid increase in Bcl-XL and cyclin-D1 22 expression which subsequently contributes to cellular transformation (Yoshida et al. 2002). Additional data from another group demonstrated that the STAT3 activation induced by oxidative stress was caused by the presence of the HCV replicons (Waris et al. 2005). Further, the authors inhibited STAT3 with small molecule inhibitors of tyrosine and serine kinases which activate STAT3 in replicon-harbouring cells, FCA4, and a reduction in HCV replicon levels in were observed (Waris et al. 2005). This implicated STAT3 as a proviral host protein for HCV replication. Again, using the HCV replicon system, it was found that methylation of several host antiviral genes including viperin, MX1 and CREB3L1 rendered the host cells permissive for replication of the virus (Naka et al. 2006; Q. Chen et al. 2013). Replicons have been generated for several other viruses and are used not only to study virus-host interactions but also to screen for potential antivirals (Hannemann 2020). Complementary to the MNV system, the HuNoV GI replicon system has been used to study the virus replication and its interacting host factors, albeit few studies. Using the replicon system in Huh7 cells (HG23), proteins in the cholesterol biosynthesis pathway were identified as host factors that regulate the HuNoV replication (Chang 2009). The author found that inhibiting cholesterol biosynthesis increased virus replication, whereas specifically inhibiting acyl-CoA:cholesterol acyltransferase (ACAT) decreased virus replication. Further, overexpression of low-density lipoprotein receptor (LDLR)-related proteins increased virus replication (Chang 2009). Another study using the HuNoV replicon system added further components to the existing data on the lists of ISGs that affect HuNoV replication (Dang et al. 2018). Dang and co identified the receptor transporter protein 4 (RTP4) and heparanse (HSPE) as moderate antivirals and RIG-I and MDA5 as potent antivirals against HuNoV (Dang et al. 2018). 23 1.6. Research rationale The beginning of my research coincided with the development of the human intestinal enteroid system which is currently being used to study the interaction between HuNoV and host cellular factors (Ettayebi et al. 2016; Lin et al. 2019). Despite this success, researchers have focused on optimizing the system to increase the level of virus replication which suggests that although the virus replicates in this system to considerable levels, intrinsic factors in the host cell may possibly be limiting the level of replication (Estes et al. 2019; Hosmillo et al. 2020). This may also be a possible reason for the difficulty in establishing the 3D cell culture systems for HuNoV where infections were successful but almost no replication was observed (Straub et al. 2011; Takanashi et al. 2014). Since viruses are generally known to utilize host factors in the replication of their genome, it is important to further investigate the factors that may regulate virus replication within the cells. This will help fill the gaps in advancing the study of HuNoV biology and hopefully will drive the development of vaccines or therapeutics. 1.7. Thesis objectives Prior to the start of my study, a HuNoV replicon system, based on the human gastric tumour (HGT) cell line, was established in our laboratory by Dr Hosmillo. Treatment of this replicon-containing cell line (HGT-NV) with IFN-α led to the generation of a “cured” population of cells (HGT Cured). These cells were observed to be better at supporting the replication of HuNoV RNA replicon following transfection. Based on this, I hypothesize that HGT Cured cells have altered their gene expression profile to produce a cellular environment that is better suited for HuNoV replication. 24 The overarching objective of my research is to utilize the HuNoV replicon system to identify cellular factors involved in HuNoV replication. Specific aims: 1. Identify genes and pathways that are differentially regulated during HuNoV replication. 2. Elucidate the role of HSP90 in regulating the innate immune response during HuNoV replication. 3. Examine the effect of small molecule-mediated inhibition of COX/PGE2 pathway on HuNoV replication. 25 Chapter 2 Materials and Methods 26 2.1. Cells and Media Human gastric tumour (HGT) cells, human norovirus GI.1 replicon-harbouring HGT (HGT-NV) cells, BHK-NV and IFN-α-cured HGT-NV (HGT-Cured) cells were maintained in Dulbecco’s minimal essential medium supplemented with 10% fetal calf serum, 2 mM glutamine, 100 U/ml penicillin, 100 µg/ml streptomycin, 1X non-essential amino acid. Cells were maintained by passaging 80% confluent cells at 1:5 ratio into new tissue culture flasks with fresh complete growth cell culture media with the appropriate supplementation and incubated at 37ºC under 5% CO2. In the case of all replicon-harbouring cells, media was also supplemented with 0.5 mg/ml G418. Professor Ian Goodfellow generated the BHK-NV (GI.1) cells and Dr Myra Hosmillo generated the HGT-NV HGT-Cured cells. An annotated diagram showing the generation of HGT-NV and HGT-Cured cells is shown in the next chapter. All other inhibitors used in this study are listed in Table 2.1. Table 2.1: List of inhibitors Inhibitor Name Target Supplier Catalogue number SC-560 COX-1 Sigma-Aldrich S2064-5MG 5-Aza-2′-deoxycytidine DNA methyl transferase Sigma-Aldrich A3656 17-AAG Hsp90 Selleckchem S1141 17-DMAG Hsp90 Selleckchem S1142 2′-C-methylcytidine Viral Polymerase Sigma-Aldrich M4949 Celecoxib COX-2 Sigma-Aldrich PZ0008-5MG Ganetespib Hsp90 AdooQ STA-9090 Indomethacin COX-1/2 Sigma-Aldrich I7378-5G NS398 COX-2 Sigma-Aldrich N194-5MG Rupintrivir Viral Protease Sigma-Aldrich PZ0315-5MG Ruxolitinib JAK1/JAK2 InvivoGen INCB018424 2.2. Microarray analysis Four lineages of HGT, HGT-NV and HGT-Cured cells were grown in tissue culture flasks in the appropriate culture media. After four successive passages, total RNA was 27 extracted using TRIzol® (Invitrogen). After verifying the RNA integrity and quality using the Nanodrop 1000 (ThermoFisher Scientific), samples were sent for microarray analysis in triplicate. Microarray analysis was done using the HumanHT-12 v4 Expression BeadChip (Illumina, Chesterford, UK) according to the manufacturer’s instruction. Briefly, complementary DNA (cDNA) was synthesised from the extracted total RNA and the cDNA was biotin-labelled by in vitro transcription step as described previously (Boerries et al. 2015). Biotin-labelled cRNA samples were hybridized on Illumina HumanHT-12 v4 Expression BeadChip and microarray scanning performed. All microarray experiments, data normalizations and preliminary analysis were carried out by Cambridge Genomic Services, UK. To compare changes in gene expression profile between our dataset with a previous HuNoV replicon established in Huh-7 hepatoma cells (Chang 2009), microarray dataset GSE15520 from the Gene Expression Omnibus (GEO) database was processed by Dr Frederic Sorgeloos using the GEO2R script and resulting expression profiles were compared using gene names as common identifier. 2.3. Quantitative RT-PCR analysis Total cell RNA was extracted using a GenElute Mammalian Total RNA Miniprep kit (Sigma) according to the manufacturer’s protocol and contaminating genomic DNA was removed through RNase-free DNase I treatment (Roche). RNA quantity and purity were determined using the Nanodrop 1000 (ThermoFisher Scientific) based on the manufacturer’s instructions. To determine the quality and integrity of the extracted RNA, RNA electrophoresis was performed on a gel of 1.5% agarose in TAE buffer containing ethidium bromide and resolved at 80V for 60 min. Total RNA was then reverse transcribed using random hexamers and the M-MLV RT enzyme (Promega) according to the manufacturer’s protocol to generate cDNA samples. Briefly, 5μl of 28 RNA which contains about 0.5-2μg was added to 5μl of 50μM random hexamers (Roche), mixed and incubated for 5minutes at 70oC. Following this, 1μl of 10μM dNTPs, 5μl of 5x M-MLV buffer (250mM Tris-HCl (pH 8.3 at 25°C), 375mM KCl, 15mM MgCl2, 50mM DTT), 0.5μl of RNAseOUT (20U, Invitrogen), 0.5μl of M-MLV enzyme (100U) and 8μl of PCR-grade water on ice. The mixture was incubated at 37oC for 1 hr and then 95oC for 5 minutes. Finally, the sample was diluted to 90μl with PCR-grade water. SYBR green-based quantitative PCR was performed using gene-specific primers (Eurofins genomics) listed in Table 2.2. Briefly, SYBR Green mastermix containing 2.5mM MgCl2, 400μM dNTPs, 1/10,000 SybrGreen (Molecular Probes), 1M Betaine (Sigma), 0.05U/μl of Gold Star polymerase (Eurogentec), 1/5 10X Reaction buffer (750 mM Tris-HCl pH 8.8, 200 mM [NH4]2SO4, 0.1 % [v/v] Tween 20, Without MgCl2), and 28/10,000 ROX Passive Reference buffer (Eurogentec). 5μl of the cDNA sample was added to 0.25μl each of the forward and reverse primers (2.5pmol/μl final concentration), 12.5μl of the master mix and 7μl of PCR-grade water. Samples were mixed and ran on a ViiA 7 Real-Time PCR System (Applied Biosystems), with a 15- second 95oC denaturation step and a 1-minute 60oC annealing/extension step for 40 cycles. Unless specified, each experimental condition was measured in biological triplicate and results are shown as a ratio to levels detected in control cells according to the ΔΔCt method (Schmittgen and Livak 2008). Additional non-template and non-reverse transcriptase samples were analysed as negative controls. Genomic viral RNA was quantified by one step RT-qPCR using GI NV- specific primers. Viral genome copy numbers were calculated by interpolation from a standard curve generated using serial dilutions of viral RNA transcribed from the pNV101 plasmid coding for the full-length Norwalk genome (Fernandez-Vega et al. 2004). 29 Table 2.2: List of primers and probes Target Primer ID Sequence (5’ to 3’) ISG15 Fwd IGUC3336 CGCAGATCACCCAGAAGATCG ISG15 Rev IGUC3337 TTCGTCGCATTTGTCCACCA IFIT2 Fwd IGUC3338 AAGCACCTCAAAGGGCAAAAC IFIT2 Rev IGUC3339 TCGGCCCATGTGATAGTAGAC IFIT1 Fwd IGUC3340 GCGCTGGGTATGCGATCTC IFIT1 Rev IGUC3341 CAGCCTGCCTTAGGGGAAG IFITM3 Fwd IGUC3342 TGAGAACCATCCCAGTAACCC IFITM3 Rev IGUC3343 GAGAGAAGAAGGTTTGGACAGT IFITM2 Fwd IGUC3344 GCCCAGCGATAGATCAGGAG IFITM2 Rev IGUC3345 TACGTGGGATACAGGTCACGG IFIH1 Fwd IGUC3346 TCACAAGTTGATGGTCCTCAAGT IFIH1 Rev IGUC3347 CTGATGAGTTATTCTCCATGCCC SOCS2 Fwd IGUC3348 CAGATGTGCAAGGATAAGCGG SOCS2 Rev IGUC3349 GCGGTTTGGTCAGATAAAGGTG ANXA1 Fwd IGUC3350 GCGGTGAGCCCCTATCCTA ANXA1 Rev IGUC3351 TGATGGTTGCTTCATCCACAC IL28RA Fwd IGUC3352 ACCTATTTTGTGGCCTATCAGAGCT IL28RA Rev IGUC3353 CGGCTCCACTTCAAAAAGGTAAT IFI27L2 Fwd IGUC3354 CCACATCATCCAACATCCTCC IFI27L2 Rev IGUC3355 TCATCTTCTTTAGCCTCGGGTT EIF2AK2 Fwd IGUC3356 TGGAAAGCGAACAAGGAGTAAG EIF2AK2 Rev IGUC3357 CCAAAGCGTAGAGGTCCACTT TRAF3IP2 Fwd IGUC3358 ATGAACCGAAGCATTCCTGTG TRAF3IP2 Rev IGUC3359 TGTTGGGTGCCATGTTCCTTA VIPERIN Fwd IGUC2768 TGCTTAAGGAAGCTGGTATGG VIPERIN Rev IGUC2769 GCCGCAACTCTACTTTGCAG IFNB Fwd IGUC0772 CAGAAGGAGGACGCCGCATTGAC IFNB Rev IGUC0773 CCAGGCACAGTGACTGTACTCC IFNL2/3 Fwd IGUC2602 GAACCGGTACAGCCAATGGT IFNL2/3 Rev IGUC2603 AGTTCCGGGCCTGTATCCAG IL6 Fwd IGUC1231 ACTCACCTCTTCAGAACGAATTG IL6 Rev IGUC1232 CCATCTTTGGAAGGTTCAGGTTG GAPDH Fwd IGUC3360 AGGTGAAGACGGGCGGAGAGA GAPDH Rev IGUC3361 GCGAACACATCCGGCCT BETA ACTIN Fwd IGUC0784 TTCTACAATGAGCTGCGTGTG BETA ACTIN Rev IGUC0785 GGGGTGTTGAAGGTCTCAAA GI HuNoV Fwd COG1F ACCCARCCATTATACATYTG GI HuNoV Rev COG1R CTTAGACGCCATCATCATTYAC GI HuNoV Probe RING1(b)TP FAM-AGATCGCGGTCTCCTGTCCA-TAMRA 2.4. Nucleic acid transfection and IFN treatment Transfections of plasmid DNA or purified viral RNA (NV replicon) were carried out using Lipofectamine 2000 (Invitrogen) according to manufacturer’s instructions. Briefly, cells were seeded in antibiotic-free growth medium at a density of 2×105 or 30 1×106 cells per well in 24- or 6-well plates, respectively, and incubated overnight at 37°C. Lipofectamine 2000 reagent was diluted in Opti-MEM® (Gibco) and incubated for 5 minutes at 25°C. After the incubation, plasmid DNA or viral RNA, diluted in Opti- MEM® (Gibco), was mixed with the Lipofectamine: Opti-MEM mixture, vortexed briefly and incubated at 25°C for 20 minutes. The DNA or RNA complex was subsequently inoculated onto 80-90 % confluent cell monolayers, followed by incubation at 37°C. For viral RNA transfection, media was replaced after 24 h with fresh complete growth medium containing G418 at a concentration of 0.5 mg/ml. For IFN treatments, cells were seeded as described above and incubated at 37°C for indicated time-points with or without recombinant type I IFN (IFN-α; Sigma-Aldrich, Cat N°:I4401-100KU and IFN-β; Peprotech, Cat N°:300-02BC), or type III IFN (IFN-λ2; Peprotech, Cat N°:300- 02K) at a final concentration of 0.1 ug/ml. 2.5. Colony forming assays Non-replicon-harboring HGT cells were seeded in 6-well plates at a density of 1×106 cells/well in antibiotic free growth media. After an overnight incubation at 37°C, cells were transfected with viral RNA as described above and incubated for 24 h. Growth media was replaced on cells with fresh media containing the respective pharmacological inhibitors without G418 and incubation was continued for various time points. Plates were stained with 0.1% toluidine blue and photographed after 5 days of selection in G418. In the case of the replicon-harboring cells, cells were seeded same as above and after the overnight incubation, growth media was replaced with fresh media containing the pharmacological inhibitors without G418 and incubation was continued for various time points. Plates were stained with 0.1% toluidine blue and photographed after 5 days of selection in G418. 31 2.6. Human Intestinal Enteroid Infections As previously described (Hosmillo et al. 2020), differentiated human intestinal enteroid monolayers were grown in 48-well plates and infected in biological triplicates with GII.3 HuNoV stool filtrates containing approximately 1x106 viral genome equivalents. Cells were incubated for 2 h at 37°C, followed by washing with serum-free media and 250 µL of differentiation media containing 200 µM glycochenodeoxycholic acid (GCDCA) was added to the wells. Media was supplemented with pharmacological inhibitors or DMSO control. Cells were harvested after 48 h and processed for further analysis. All human intestinal enteroid experiments were performed by Dr. Myra Hosmillo. 2.7. Immunofluorescence microscopy Cells were plated on 12 mm glass coverslips and allowed to adhere overnight before fixation with 4% paraformaldehyde in PBS. Cells were then permeabilized for 5 min with PBS-Triton X-100 0.2% and unspecific antigens were blocked for 1h using 2% normal goat serum (Sigma-S2007) in PBS-Tween-20 0.1% (PBST). Cells were then incubated for 1h with primary mouse monoclonal J2 anti-dsRNA antibodies in PBST at a dilution of 1:1000 (J2, SCICONS English & Scientific Consulting, Hungary). After extensive washes with PBST, species-matched AlexaFluor-conjugated secondary antibodies (ThermoFisher Scientific, A-11029) were added at a dilution of 1:500 in PBST for one additional hour. Coverslips were extensively washed and mounted on slides with Mowiol supplemented with DAPI and DABCO. Confocal micrographs were acquired on a Leica TCS SP5 confocal fitted with a 63x 1.3NA oil immersion objective using 405nm and 488nm laser excitation lines under sequential channel scanning to prevent fluorophore bleed-through artefacts due to spectral overlap. 32 2.8. Western blotting and Enzyme-Linked Immunosorbent Assay (ELISA) Cell lysates were prepared in radio-immuno precipitation assay buffer (RIPA: 150 mM NaCl, 0.5% sodium deoxycholate, 0.1% SDS, 1mM EDTA, 1% Triton X-100, and 50 mM Tris-HCl pH8) supplemented with protease and phosphatase inhibitors (Calbiochem; Cat N°: 539134 and 524625). Protein concentrations were determined by BCA assay (Thermo Fisher Scientific). Equal amounts of total proteins were resolved by SDS-PAGE and transferred to nitrocellulose membranes. Blocking of unspecific antigens was carried out in 5% non-fat dried milk or 5% BSA in PBST for 1 h at 4°C. Primary antibodies (Table 2.3) were diluted in blocking buffer and incubated overnight at 4°C with gentle rocking. Membranes were washed three times in PBST for 5 min at RT. Species-matched IRDye-800CW secondary antibodies were diluted in blocking buffer as before and incubated at RT for 1 h. Membranes were washed again three times in PBST for 5 min at RT. Fluorescent signal was detected through an Odyssey CLx infrared imaging system (Li-COR). Human Prostaglandin E2 (PGE2) ELISA Kit (Invitrogen, KHL1701) was used to determine PGE2 levels in cell culture supernatant following treatment with cyclooxygenase (COX) inhibitors. Briefly, cell sub-confluent monolayers incubated in COX inhibitors were harvested after 48 h and supernatant collected. ELISA was performed on the supernatant according to the protocol supplied with the ELISA kit by the manufacturer. Table 2.3: List of antibodies used for western blot Target (Human) Supplier Catalogue number AKT Santa Cruz sc-8312 ANXA1 Cell Signaling Technology #3299 dsRNA Scicons J2-0702 GAPDH Ambion AM4300 IFITM3 Proteintech 12769-1-AP IRF3 Abcam ab25950 MAVS Santa Cruz sc-166583 33 MDA5 Abcam ab126630 NFκB (p65) Santa Cruz sc-8008 NS3 Raised in the laboratory NA NS6 Raised in the laboratory NA NS7 Raised in the laboratory NA p21 Santa Cruz sc-469 pSTAT1 Cell Signaling Technology 9167S RIG-I Santa Cruz sc-376845 STAT1 Abcam ab92506 STAT2 Proteintech 16674-1-AP TBK1 Cell Signaling Technology 3013S TYK2 (C-8) Santa Cruz sc-5271 VIPERIN Santa Cruz sc-390342 α-Tubulin Raised in the laboratory NA 2.8. Generation of IFNAR1 or IFNLR1 knockout HGT cells HGT cells knockout for IFNAR1 or IFNLR1 genes were generated using the CRISPR/Cas9 system as descrided by Giuliano et al. (2019). Lentivirus vectors encoding single-guide RNAs against IFNAR1 or IFNLR1 genes were generously provided by Dr Steeve Boulant and are described in Pervolaraki and colleagues (Pervolaraki et al. 2017). Vesicular stomatitis virus G-protein-pseudotyped lentiviral particles were generated by transient transfection of 80% confluent 293T cell monolayers grown in 6-well plates using 1.25 µg lentiviral vector, 0.63 µg pMDLg/pRRE (Addgene #12251), 0.31 µg pRSV-Rev (Addgene #12253) and 0.38 µg pMD2.G (Addgene #12259) per well. Plates were incubated for 24 h at 37ºC under 5% CO2 and following the incubation period, cell culture media was collected and replaced with fresh media. Collected cell culture supernatant was spun and passed through 0.45µM filter to obtain the lentiviral supernatant. Lentiviral supernatant was stored at -80 ºC until use. Parental HGT cells were transduced with lentiviral supernatants and incubated for 48 h. Transduced cells were then selected based on 34 their resistance to puromycin at a concentration of 2.5 µg/mL. Clonal isolation was performed by limiting dilution into 96-well plate at a density of 0.3 cell per well and single cell clones were selected based on visual examination. Single cell clones were expanded and tested for IFNAR1 or IFNLR1 gene disruption by RT-qPCR measurement of viperin induction following incubation with IFN-β or IFN-λ2, respectively. Absence of STAT1 phosphorylation following incubation with receptor- matched interferons confirmed the gene ablation. 2.10. Generation of Recombinant HuNoV Replicon RNA The plasmids with T229A mutation in NS1/2 (pNV101NS1/2T229A) were generated from the full-length Norwalk genome (pNV101) constructs by two-step overlap PCR with mutant-specific primers. Mutant and wildtype plasmids were in vitro transcribed following the protocol described previously (Yunus et al. 2010). Briefly, plasmid DNAs were linearized and incubated 37 °C for 2 h in a reaction containing 200 mM HEPES pH 7.5, 32 mM magnesium acetate, 40 mM DTT, 2 mM spermidine, 7.5 mM of each NTP and T7 RNA polymerase. Following this, DNase treatment was done on the transcribed RNA, precipitated with lithium chloride, resuspended in RNA storage solution (Ambion) and kept at -20°C until use. 2.11. Cell cytotoxicity assay Resazurin assay was performed by Mitsutaka Kitano and was used to determine the cytotoxicity and inhibitory effects of the various inhibitors against HGT-NV cells as described previously (Kitano et al. 2018). Briefly, HGT-NV cells were seeded at 5×104 cells per well in 96-well plates and incubated with various concentrations of inhibitors for 72 h at 37°C and 5% CO2. After incubation, cells were washed with PBS, and then complete cell culture medium supplemented with resazurin (Sigma Aldrich, R7017- 5G) at 0.1 mg/ml was added to the cells. The cell incubated for 4 h after which the 35 optical density at 560 nm with a 620-nm optical density reference was determined using a SpectraMax i3 instrument (Molecular Devices). The 50% cytotoxic concentration (CC50) and inhibition concentration (IC50) values of each inhibitor were calculated using XLfit (version 5.3) software. 2.12. Inhibition assay The 50% inhibitory concentration (IC50) was determined with the CellTitre-Blue assay according to the manufacturer’s instructions and as described previously (Surender Vashist et al. 2015). Briefly, HGT-NV cells were seeded at 5×104 cells per well in 96- well plates and incubated with various concentrations of the inhibitors for 72 h at 37°C and 5% CO2. After the incubation period, CellTitre-Blue reagent was added to each well at 20µl and further incubated for up to 4 h. Fluorescence reading was taken at 560nm and 590nm using a SpectraMax i3 instrument and 50% inhibitory concentration (IC50) values were calculated using GraphPad Prism (version 6). 2.13. McrBC cleavage assay 2ug of genomic DNA extracted from either HGT, HGT-NV or HGT-Cured cells was digested for 16 hours with 10 units McrBC (New England Biolabs) in the presence or absence of GTP. Digested genomic DNA was then purified by ethanol precipitation. Digested DNA was used for PCR amplification analysis using the IFNLR1 promoter- specific primers (IGUC4177 5’-AGAGGTACGGGCGAGTTTC-3’ (Fwd) and IGUC4178 5’-GACCCGGTTCTGTTCAGTCC-3’ (Rev) using KOD Hot Start DNA polymerase (Novagen) according to the manufacturer’s protocol. PCR products were visualized by electrophoresis on 1% agarose gels run in Tris-Borate-EDTA buffer and stained with ethidium bromide. 36 2.14. Statistical analysis and data sharing Statistical significance was determined from experiments where n ≥ 3 using two-tailed Student t tests in Prism 6.0 (GraphPad). Asterisks denote the statistical significance of the indicated comparisons as follows: *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001 and ****p ≤ 0.0001. All microarray expression data reported in this study have been deposited into Gene Expression Omnibus (GEO, http://www.ncbi.nlm.nih.gov/geo) with the accession number GSE111041. 37 Chapter 3 Epigenetic suppression of interferon lambda receptor expression leads to enhanced human norovirus replication in vitro. 38 Background Despite their limitations of not recapitulating a real infection model, the replicon system has advanced our understanding of virus replication and supported the screening of antivirals (Chang 2009; Harmalkar et al. 2019; Horscroft et al. 2005; Li et al. 2017; Naka et al. 2006; Oliveira et al. 2018; Rocha-Pereira et al. 2013; Rocha-Pereira et al. 2018a). Generation of cell lines that stably replicate viral RNA is important in identifying the viral and cellular changes that occur during virus replication. For example, from a study on HCV, it was demonstrated that adaptive changes in the viral NS proteins was responsible for its successful replication in Huh-7.5 cells (Blight et al. 2000; 2002). The replicon system has been used to further understand some of the cellular changes that occur during virus replication. For example, it was reported that during virus replication in a HuNoV replicon-harbouring Huh-7 cell (HG23), changes including the alteration of genes that are involved in cholesterol biosynthesis was observed (Chang 2009). These suggest that for viruses to establish replication, changes in both cellular and viral genome are essential. In this study, we sought to pinpoint cellular pathways altered during HuNoV replication. Using microarrays on replicon-harbouring human gastric epithelial cells, we identified transcriptome signatures consistent with an activation of autonomous immune responses. Consistent with this, we found a strong down-regulation of the IFN lambda receptor (IFNLR1) expression rendering cells insensitive to exogenous IFN-λ. Mechanistically, epigenetic studies revealed an increased methylation of the IFNLR1 promoter strongly suggesting an involvement of type III interferons in controlling HuNoV replication. Most of the data in this chapter has been published (Arthur et al. 2019). 39 Results 3.1. Generation and characterization of human cell lines bearing stable human norovirus replicons. To understand the influence of viral and host factors involved in HuNoV replication, we sought to generate several human cell lines stably replicating HuNoV RNA. To this end, BHK-21 cells were transfected with capped Norwalk replicon RNA harbouring a neomycin selection marker (Chang et al. 2006) and subjected to G418 selection 48 hours after transfection (Fig. 3.1A). Although the vast majority of the cells died within one-week, individual cell colonies were observed and subjected to limiting dilution. A single high-expressing clone was selected and expanded to generate stable replicon- containing BHK-21 cells (BHK-NV). VPg-linked RNA extracted from these cells was transfected into HGT cells, a cell line of epithelial origin which was subsequently selected on the basis of their G418 resistance in order to generate human norovirus replicon cells (HGT-NV). These HGT-NV cells were either collected as a population or subjected to limiting dilution to produce HGT-NV cell clones. The HGT-NV population was further passaged 16 times in the presence of IFN‒α at a concentration of 1000 U/mL in the absence of G418 selection over an 8 weeks period leading to the generation of HGT-Cured cells. These cells were subsequently cultured in presence of G418 to observe their loss of resistance to G418 confirming the complete elimination of the replicon. The generation of the HGT-NV and HGT-Cured cells were done by Dr. Myra Hosmillo before I joined the lab. Detection of HuNoV RNA by RT- qPCR analysis confirmed the presence of noroviral genomes in HGT-NV cells that were absent from HGT-Cured or parental HGT cells used as control (Fig. 3.1B). To confirm the presence of authentic steady-state replication of Norwalk RNA, cells were 40 subjected to immunofluorescence analysis using monoclonal antibodies directed against dsRNA, a by-product assumed to be universally generated during viral Figure 3.1. Generation and characterization of stable HuNoV replicons in HGT cell lines. A) Diagram showing the steps used to generate the various cell lines carrying human norovirus replicons and their IFN-cured counterparts. All cell lines were generated by Dr Myra Hosmillo. B) Total cellular RNA was extracted from each cell line and viral RNA quantified by RT-qPCR. Viral RNA copy numbers were normalized to the total input RNA and expressed as genome equivalents/µg of input RNA. The error bars represent the standard deviation determined from four biological replicates. Viral RNA copy numbers were below the limit of detection in both HGT and HGT-Cured cells. The dotted line represents the low limit of detection. C) Detection of viral replication complexes by confocal imaging. Representative merged confocal micrographs showing the detection of dsRNA (green) in indicated cell lines. Nuclei were stained with DAPI (blue). Scale bars correspond to 20μm. replication (Weber et al. 2006; Son et al. 2015). As shown in Fig. 1C, punctate structures reminiscent of replication complexes were identified in HGT-NV cells while no signal above background levels was detected in HGT-Cured or in parental cell lines. Taken together these results suggest that HuNoV VPg-linked RNA successfully A CB 41 replicates in HGT cells and displays all the characteristics of a replication-competent RNA. 3.2. Viral adaptive changes enhance replication in a cell line-specific manner Stable viral RNA replication under drug-mediated selection leads to an environment where on the one hand, host cells face the selective pressure of the drug and, on the other hand, replicating RNA faces innate cellular responses aimed at inhibiting replication. This results in the establishment of a metastable equilibrium prone to adaptation from both cells and the replicating viral RNA. In the state of metastable equilibrium, these adaptive changes will not affect the entire replicon system although it may alter the expression of some of the genes. To test for the appearance of such adaptive mutation(s) in the replicon, VPg-linked RNA was extracted from BHK-NV cells (NVBHK) and HGT-NV cells (NVHGT) and subjected to consensus genome sequencing. Sequence analysis revealed that viral RNA originating from both BHK- NV and HGT-NV cells underwent many synonymous and non-synonymous genomic changes (Table 3.1, Fig. 3.2.1). Eight genomic changes were acquired in NVHGT more than NVBHK, additional changes which may be due to the fact that NVBHK of hamster origin was transfected in HGT cells, which is of human origin, to establish the HGT- NV cell line from which NVHGT was extracted. This suggests a potential adaptation of HuNoV RNA to specific cellular environments, herein, hamster versus human. Most of the mutations lie in the NS1/2 region of the genome and this protein, although not much is known for HuNoV, has been shown to play multifunctional role in the context of MNV, ranging from virus replication to cellular manipulation (Hyde et al. 2009; Lateef et al. 2017). It is therefore possible that the mutations accumulated I this protein will have an effect in the replication profile of the virus replicons in the various cell lines. None of the mutations observed occurred in any of the functional domains in the non- 42 structural proteins, namely SF3 helicase domain within NS3, peptidase C37 domain within NS6 and RdRp catalytic domain within NS7 (Fig. 3.2.1). Table 3.1. Comparison of HuNoV replicon RNA sequences between HGT-NV and BHK-NV. Genomic position (nt) Gene Parental replicon NVBHK Substitution NVHGT Substitution 1-13 5'UTR & NS1/2 Not sequenced NA NA Not sequenced NA 129 NS1/2 C T P42L T P42L 145 NS1/2 A A - G I47M 170 NS1/2 C A L56M C - 311 NS1/2 T C W103R C W103R 381 NS1/2 G G - A G126D 439 NS1/2 A A - C E145D 500 NS1/2 A A - G T166A 535 NS1/2 A A - G - 580 NS1/2 A A - G - 859 NS1/2 A G - G - 946 NS1/2 A T Q314H T Q314H 983 NS1/2 C C - T - 1115 NS1/2 C C - A L371I 1142 NS1/2 A G N380D G N380D 1209 NS3 A G D4G G D4G 1282 NS3 A G - S - 1339 NS3 A A - G - 1732 NS3 C C - A - 1822 NS3 G G - C - 2041 NS3 T T - C - 2294 NS4 A G T3A G T3A 2744 NS4 C C - G H153D 2844 NS4 A A - G E186G 3236 NS5 A A - G T116A 3367 NS6 A G - G - 3855 NS7 A G D3G G D3G 3961 NS7 A A - G - 4190 NS7 A G T115A A - 4414 NS7 A G - A - 5411 VP1 T T - G - 5502 Neo T C S14P C S14P 5878 Neo A G Q139R G Q139R 5932 Neo A G D157G G D157G 6248 Neo T T - C - 6335 VP1* T T - C - 6393 VP1* T T - C - 6398 VP1* A A - A/G - 6478-6756 VP2 - - - In frame deletion I6-V98 6806 VP2 T T - C - 7091 VP2 A A - G N210D 7620-7654 3'UTR Not sequenced NA NA Not sequenced NA NA: Not applicable. *Indicates an N-terminally truncated protein (lacking an initiating Methionine codon). Specific adaptive mutations are indicated in red for BHK-NV and green for HGT-NV. ‘-‘ Indicates no substitution. 43 Figure 3.2.1. Schematic representation of the Norwalk virus genome showing positions of mutations accumulated in the RNA replicons. Virus RNA replicons from BHK-NV and HGT-NV were sequenced and compared to the parental viral RNA replicon sequence. Adaptive mutations specific to replicons extracted from HGT-NV are indicated in green arrow heads, BHK-NV in red arrow heads and general adaptive mutations in black arrow heads. Functional domains in the Norwalk virus genome are striped in NS3, NS6 and NS7. G418 selection marker is indicated by grey shading in VP1. As stated earlier, our data may suggest that some of the specific adaptive changes in the viral RNA may be important in establishing replication in the cell lines to which they were previously exposed, To examine this, equal amounts of NVBHK or NVHGT was transfected in BHK, HGT and HGT-Cured cells and replication was measured after 5 days post-selection in G418. We observed that BHK cells better supported the replication of NVBHK than NVHGT whereas HGT-Cured cells better supported the replication of NVHGT than NVBHK (Fig. 3.2.2.A-B). Compared to either BHK or HGT- Cured cells, HGT cells poorly supported the replication of both RNAs (Fig. 3.2.2A-B). Based on this data, it will be interesting to determine the role of each specific amino acid substitutions on virus replication. NS1/2 NS6NS5NS3 NS4 NS7 VP2 VP1 AAAA(n)VPg 5’ 3’ 5’ 3’ 5’ 3’ 5’ 3’ 5’ 3’ 5’ 3’ 5’ 3’ 3’ 5’ P42L I47M L56M W103R G126D E145D T166A Q314H L371I N380D D4G T3A H153D E186G D3G SF3 Helicase domain Peptidase C37 domain RdRp catalytic domain T116A T115A T116AI6-V98 G418 selection marker S14P Q139R D157G NS1/2 NS3 NS4 NS5 NS6 NS7 VP1 VP2 44 Figure 3.2.2. Adaptive changes in both viral RNA and host cell determines the success of viral replication. Cells transfected with VPg-linked RNA extracted from BHK-NV (A) or HGT-NV (B) were selected in 0.5mg/ml G418 for 5 days, harvested for total RNA extraction and viral RNA was quantified by RT-qPCR. Viral RNA levels were determined by comparison to a standard curve and normalized to the RNA input. The data are presented as mean and standard deviation from three replicates. Indicated values are expressed as fold change in genome equivalent normalized to viral RNA levels at 6 hours post-transfection to control for transfection efficiency. Unpaired two- tailed Student’s t-test was used to evaluate the statistical significance. 3.3. Cured population of HGT-NV cells demonstrate enhanced HuNoV replication. To test specifically for host cell adaptation, we first examined the ability for HGT and HGT-Cured cells to support replication of the HuNoV replicon. To this end, wild-type VPg-linked RNA extracted from BHK-NV cells was re-transfected in both HGT and HGT-Cured cell lines that were subsequently selected for 5 days with G418. As observed from Fig. 3.3A, HGT-Cured cells gave rise to a greater number of stable replicon-harbouring colonies than parental HGT cells. To quantitatively confirm this observation, each cell line was transfected with wild-type VPg-linked RNA replicon and cells were harvested at various time points for RNA extraction and viral RNA quantification (Fig. 3.3B). From 5 days post transfection, the levels of Norwalk replicon RNA were significantly higher in HGT-cured than in HGT cells. Noroviral RNA levels further increased at day 6 to yield a 15-fold difference between HGT-Cured and HGT cells. We thus concluded that HGT-Cured cells possess a greater degree of A B BHK HGT HGT-Cured 0 20 40 60 Cell lines Fo ld c ha ng e in v ira l g en eo m e eq ui va le nt re at iv e to d ay 0 NVBHK RNA *** *** ** BHK HGT HGT-Cured 0 20 40 60 80 Cell lines Fo ld c ha ng e in v ira l g en eo m e eq ui va le nt re at iv e to d ay 0 NVHGT RNA * *** ** 45 permissiveness to viral replication than parental HGT cells. This may also be likely due to cellular adaptation in HGT-Cured cells which supports the viral replication. Figure 3.3. HGT-Cured cells demonstrate enhanced HuNoV replication. A) HGT and HGT-Cured cells were transfected with VPg-linked replicon RNA. After five days of selection with G418 at a concentration of 0.5 mg/mL, cellular morphology was analysed by light microscopy. White arrows represent live cells that are beginning to clump together to form colonies. B) Cells transfected with VPg-linked RNA were harvested at various time points post-transfection for total RNA extraction and viral RNA was quantified by RT-qPCR. Viral RNA levels were determined by comparison to a standard curve and normalized to the RNA input. The data are presented as mean and standard deviation from three replicates. Indicated values are expressed as fold change in genome equivalent normalized to viral RNA levels at 6 hours post- transfection to control for transfection efficiency. Unpaired two-tailed Student’s t-test was used to evaluate the statistical significance. 3.4. An alteration in cellular environment is responsible for enhanced viral replication in HGT-Cured cells. Increased replication of HuNoV VPg-linked RNA in HGT-Cured cells suggests that these cells provide a better cellular environment compared to that of parental HGT cells. To get insights into the mechanism of this cell-derived HuNoV replicon permissiveness, genome-wide expression profiles from HGT, HGT-NV and HGT- Cured cell lines were quantified using Illumina BeadChip microarrays. We first compared the gene expression profiles of HGT-NV cells relative to their HGT controls. As seen in Figure 3.4.1A, more than 2000 genes (HGT-NV-vs-HGT: 2074, HGT- Cured-vs-HGT: 858) were identified for which mRNA expression was significantly BA 46 modified at an FDR lower than 0.01. Of these, a minority of 151 genes had expression changes in either direction greater than 2-fold suggesting that HuNoV replication has a marginal effect on the whole transcriptional landscape of replicon harbouring cells. Surprisingly, the number of the genes that were differentially increased or decreased in both HGT-NV and HGT-Cured is high and likely reflects cellular long-term adaption to replicating RNA (GO term enrichment analysis did not reveal specific pathway enrichment in this gene set). We also observed that whiles some interferon-stimulated genes (ISGs) were upregulated in HGT-NV, others were downregulated when compared with the transcriptional landscape of parental HGT cells (Fig. 3.4.1B and Table 3.2). Using FDR lower than 0.01 and at least a 2-fold change in either direction, comparison of gene expression profiles between HGT cells and HGT-Cured cells led to the identification of 101 genes for which expression was differentially regulated between the two cell lines (Tables 3.2-3.3). In a microarray analysis, multiple probes are used in in the same reaction, permitting recognition of polymorphisms in a gene. Also, due to the multiple probes used, there is high background noise which can confound the data generated. In contrast, a single probe or primer pair in RT- qPCR is designed to target specific sites of a gene and therefore, will not bind other polymorphic sites that are present. There is therefore high specificity when using RT- qPCR and limited background noise, promoting its use in validating/invalidating microarray data (Camarillo et al. 2011). In this study, we confirmed our observations from the microarray analysis and probed for the accuracy of gene expression measured by first 47 Figure 3.4.1. Microarray analysis of differentially regulated genes between HGT- NV, HGT-Cured and parental HGT cells. A) Volcano plots of differentially expressed genes from microarray analysis comparing gene expression in HGT-NV or HGT-Cured compared to parental HGT cells. Significantly up- or down-regulated genes (FDR<0.01 and |log2 fold change| ≥ 1) are represented in red or green, respectively. B) Venn diagrams representing the overlap of significantly up- and down-regulated genes between HGT-NV or HGT-Cured cells compared to parental HGT cells. The top ten genes within each category are shown. comparing expression changes obtained by microarrays with that measured by RT- qPCR analysis. To this end, direct comparison of raw microarray signal intensities with differences in cycle threshold obtained by real-time PCR displayed the same trends suggesting that similar fold changes were primarily the consequence of gene expression differences and were not an artefact resulting from different gene normalization techniques. Differential gene expression at the protein level of selected B A 48 genes was further confirmed by western blot analysis (Fig. 3.4.2A). Additionally, ten genes differentially regulated across conditions and spanning a wide range of fold Figure 3.4.2 Validation of differentially regulated genes between HGT-NV, HGT- Cured and parental HGT cells from microarray analysis. A) Direct comparison between microarray signal intensities and difference in cycle thresholds for ANXA1 and IFITM3 genes. Validation by western-blot analysis of ANXA1 and IFITM3 protein levels in HGT, HGT-NV and HGT-Cured cell lines. The indicated ratios represent the ANXA1 or IFITM3 protein levels normalized to the corresponding GAPDH loading controls relative to parental HGT cells. B-C. IFNLR1 (B) but not IL10RB (C) gene expression is down-regulated in HGT-NV and HGT-Cured cells. Changes in gene expression of IFNLR1 and IL10RB mRNA levels were normalized to b-actin levels and calculated using the DDCT method. Relative expression was determined from one experiment performed in biological triplicate and compared to the expression levels measured in HGT control. Statistical significance was determined using the unpaired t-test. Error bars represent the standard deviation between biological replicates. D) Fold change correlation between microarray analysis and quantitative real-time PCR (RT-qPCR). Scatter plots comparing log2 fold changes of selected genes measured by microarray analysis and RT-qPCR in HGT-NV or HGT-Cured compared to parental HGT cells. Error bars represent the standard deviation of biological quadruplicate experiments analysed in triplicate reactions. The Pearson correlation coefficient (r) and the number of pairs analysed (n) are indicated on each graph. Dotted lines illustrate the 95% confidence interval of the linear regression. A B C D 49 changes were chosen for RT-qPCR validation (Fig. 3.4.2B). Globally, we observed a high correlation between the two techniques with Pearson's correlation coefficients ranging from 0.90 to 0.95. Taken together these data extensively confirms the reliability of gene expression measurements by microarray analysis. While genes coding for IFITM2, IFITM3, IFIH1 and IFI27L2 were down-regulated, IFIT1 and IFIT2 genes were significantly up-regulated in HGT-NV cells. Expression of IFIT1 and IFIT2 proteins is known to be IRF3-dependent (Andersen et al. 2008; Grandvaux et al. 2002), while expression of IFITMs and IFIH1 genes is known to be mediated by ISRE binding (Friedman et al. 1984; Reid et al. 1989), this suggests that while HuNoV replication induces IRF3-dependent immune responses, activation of ISRE-dependent genes located downstream in the interferon signalling pathway is inhibited. In line with this observation, microarray analysis identified a statistically significant downregulation of the type III interferon receptor (IFNLR1) expression in HGT-NV and HGT-Cured cells when both were compared to HGT cells. To confirm and extend this observation, we compared IFNLR1 and IL10RB gene expression by quantitative RT- PCR. Strikingly, we found more than 20-fold decrease in IFNLR1 expression when parental HGT cells were compared to HGT-NV or HGT-Cured cells. In contrast, no significant difference was observed when IL10RB gene expression was measured (Fig. 3.4.2C-D). Our further analysis indicated that although several genes were significantly up- or down-regulated in both HGT-NV and HGT-Cured relative to HGT, no specific pathway was significantly enriched. In fact, the most enriched pathway was represented by a maximum of four genes in the dataset analysed. 50 Table 3.2. Comparison of gene expression profiles between HGT cells and HGT-NV cells at FC ≥ 2 and FDR = 0.01 SYMBOL Log2FC adj. P.Value DEFINITION ENC1 4.370817748 1.78743E-12 ectodermal-neural cortex (with BTB-like domain) (ENC1), mRNA. CALB2 3.993323767 1.78743E-12 calbindin 2 (CALB2), transcript variant CALB2c, mRNA. LMO3 3.505054553 1.91494E-12 LIM domain only 3 (rhombotin-like 2) (LMO3), transcript variant 1, mRNA. ADM 3.331471167 1.23629E-10 adrenomedullin (ADM), mRNA. LOC100134265 3.117828506 1.84686E-12 PREDICTED: similar to calbindin 2 full length protein (LOC100134265), mRNA. PPAP2B 2.802554377 3.19042E-11 phosphatidic acid phosphatase type 2B (PPAP2B), transcript variant 1, mRNA. PREDICTED: similar to FLJ00290 protein (LOC441310), mRNA 2.6903483 2.82963E-11 PREDICTED: similar to FLJ00290 protein (LOC441310), mRNA GABRA2 2.46602555 7.64144E-10 gamma-aminobutyric acid (GABA) A receptor, alpha 2 (GABRA2), mRNA. DACT1 2.457782201 1.53755E-11 dapper, antagonist of beta-catenin, homolog 1 (Xenopus laevis) (DACT1), mRNA. C11orf88 2.436672482 8.17626E-11 chromosome 11 open reading frame 88 (C11orf88), transcript variant 2, mRNA. ITSN1 2.2718616 1.60804E-11 intersectin 1 (SH3 domain protein) (ITSN1), transcript variant 2, mRNA. FNDC3B 2.251193568 1.55139E-11 fibronectin type III domain containing 3B (FNDC3B), transcript variant 1, mRNA. GABRB1 2.123604785 1.70585E-09 gamma-aminobutyric acid (GABA) A receptor, beta 1 (GABRB1), mRNA. CDH11 2.098006306 3.39319E-10 cadherin 11, type 2, OB-cadherin (osteoblast) (CDH11), mRNA. LMO2 2.050404517 6.69388E-09 LIM domain only 2 (rhombotin-like 1) (LMO2), mRNA. IGFBP7 1.960217284 2.39259E-08 insulin-like growth factor binding protein 7 (IGFBP7), mRNA. EPDR1 1.915205925 1.07585E-09 ependymin related protein 1 (zebrafish) (EPDR1), mRNA. GLCE 1.912800512 1.66157E-09 glucuronic acid epimerase (GLCE), mRNA. MUDENG 1.876473339 3.86741E-07 MU-2/AP1M2 domain containing, death-inducing (MUDENG), mRNA. DACH1 1.84553528 1.89386E-10 dachshund homolog 1 (Drosophila) (DACH1), transcript variant 2, mRNA. ANXA1 1.814088617 1.72659E-10 annexin A1 (ANXA1), mRNA. OTX2 1.773308242 4.05991E-09 orthodenticle homeobox 2 (OTX2), transcript variant 2, mRNA. IFIT1 1.69480005 7.57372E-09 interferon-induced protein with tetratricopeptide repeats 1 (IFIT1), transcript variant 2, mRNA. ABLIM1 1.677085172 1.60201E-08 actin binding LIM protein 1 (ABLIM1), transcript variant 2, mRNA. BCHE 1.592642494 7.10155E-09 butyrylcholinesterase (BCHE), mRNA. LOC100133893 1.530844344 5.64412E-10 PREDICTED: similar to hCG1642672 (LOC100133893), mRNA. NR2F2 1.478610865 6.45434E-09 nuclear receptor subfamily 2, group F, member 2 (NR2F2), mRNA. HAND2 1.466578658 5.84857E-10 heart and neural crest derivatives expressed 2 (HAND2), mRNA. BMP4 1.447515514 5.88738E-09 bone morphogenetic protein 4 (BMP4), transcript variant 3, mRNA. GREM1 1.442686938 2.01841E-07 gremlin 1, cysteine knot superfamily, homolog (Xenopus laevis) (GREM1), mRNA. ANGPTL4 1.431039012 1.94125E-05 angiopoietin-like 4 (ANGPTL4), transcript variant 1, mRNA. DLX5 1.428466848 1.04686E-09 distal-less homeobox 5 (DLX5), mRNA. DST 1.419392474 6.1025E-07 dystonin (DST), transcript variant 1, mRNA. PHLDA1 1.35922259 1.89305E-07 pleckstrin homology-like domain, family A, member 1 (PHLDA1), mRNA. KIAA1712 1.356730168 3.3424E-08 KIAA1712 (KIAA1712), mRNA. TIMP1 1.34663639 1.52408E-07 TIMP metallopeptidase inhibitor 1 (TIMP1), mRNA. DTNA 1.253767743 4.71764E-09 dystrobrevin, alpha (DTNA), transcript variant 7, mRNA. SLC7A11 1.252545248 7.8871E-08 solute carrier family 7, (cationic amino acid transporter, y+ system) member 11 (SLC7A11), mRNA. MYLK4 1.249673328 3.92662E-09 myosin light chain kinase family, member 4 (MYLK4), mRNA. TRAK1 1.241820878 2.15469E-08 trafficking protein, kinesin binding 1 (TRAK1), transcript variant 1, mRNA. C5 1.236460357 1.15352E-08 complement component 5 (C5), mRNA. ALDH1A1 1.235356056 2.67981E-06 aldehyde dehydrogenase 1 family, member A1 (ALDH1A1), mRNA. SPAG16 1.216243704 1.32675E-07 sperm associated antigen 16 (SPAG16), transcript variant 2, mRNA. MAMLD1 1.204389053 1.06792E-08 mastermind-like domain containing 1 (MAMLD1), mRNA. NR5A2 1.202659277 6.85729E-08 nuclear receptor subfamily 5, group A, member 2 (NR5A2), transcript variant 2, mRNA. CNN3 1.1980429 4.75859E-09 calponin 3, acidic (CNN3), mRNA. USP3 1.176484283 3.03148E-08 ubiquitin specific peptidase 3 (USP3), mRNA. GAD1 1.162063104 4.16559E-07 glutamate decarboxylase 1 (brain, 67kDa) (GAD1), transcript variant GAD25, mRNA. CHST7 1.145443574 2.47415E-08 carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 7 (CHST7), mRNA. 51 FBXO8 1.13644213 1.40967E-07 F-box protein 8 (FBXO8), mRNA. GLT25D2 1.109762129 1.83284E-08 glycosyltransferase 25 domain containing 2 (GLT25D2), mRNA. PNMA2 1.107555911 2.66811E-06 paraneoplastic antigen MA2 (PNMA2), mRNA. IFIT2 1.106497923 2.50426E-07 interferon-induced protein with tetratricopeptide repeats 2 (IFIT2), mRNA. SUNC1 1.089208082 2.27201E-07 Sad1 and UNC84 domain containing 1 (SUNC1), transcript variant 1, mRNA. SLC35F5 1.085940589 9.613E-06 solute carrier family 35, member F5 (SLC35F5), mRNA. RBM20 1.079643309 5.96085E-09 PREDICTED: RNA binding motif protein 20 (RBM20), mRNA. CHST13 1.078001687 2.29393E-07 carbohydrate (chondroitin 4) sulfotransferase 13 (CHST13), mRNA. S100A4 1.073098996 6.75593E-08 S100 calcium binding protein A4 (S100A4), transcript variant 2, mRNA. RDH10 1.070085978 5.02471E-08 retinol dehydrogenase 10 (all-trans) (RDH10), mRNA. RAB3IP 1.069233218 4.71764E-09 RAB3A interacting protein (rabin3) (RAB3IP), transcript variant beta 1, mRNA. LYPD1 1.065911277 6.10957E-08 LY6/PLAUR domain containing 1 (LYPD1), transcript variant 1, mRNA. ZSWIM6 1.065305281 1.16275E-07 PREDICTED: zinc finger, SWIM-type containing 6 (ZSWIM6), mRNA. FGF20 1.060549566 1.83403E-08 fibroblast growth factor 20 (FGF20), mRNA. ISL1 1.058179253 1.36779E-08 ISL1 transcription factor, LIM/homeodomain, (ISL1), mRNA. C21orf81 1.03398888 5.30943E-07 chromosome 21 open reading frame 81 (C21orf81), mRNA. ROBO1 1.03310441 2.21464E-05 roundabout, axon guidance receptor, homolog 1 (Drosophila) (ROBO1), transcript variant 2, mRNA. NCAM2 1.027355891 1.48218E-07 neural cell adhesion molecule 2 (NCAM2), mRNA. BASP1 1.014937229 5.27793E-05 brain abundant, membrane attached signal protein 1 (BASP1), mRNA. CGNL1 1.00834411 1.42716E-07 cingulin-like 1 (CGNL1), mRNA. ACPP 1.008313631 4.71869E-06 acid phosphatase, prostate (ACPP), mRNA. AP1S2 1.002837133 3.03148E-08 adaptor-related protein complex 1, sigma 2 subunit (AP1S2), mRNA. DHRSX -1.004135335 1.66222E-08 dehydrogenase/reductase (SDR family) X-linked (DHRSX), mRNA. HRASLS3 -1.013473548 1.42554E-06 HRAS-like suppressor 3 (HRASLS3), mRNA. ATP2B4 -1.014703858 1.60201E-08 ATPase, Ca++ transporting, plasma membrane 4 (ATP2B4), transcript variant 2, mRNA. EMP1 -1.03054527 6.23517E-06 epithelial membrane protein 1 (EMP1), mRNA. PLOD2 -1.034958234 5.60011E-05 procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2 (PLOD2), transcript variant 2, mRNA. CSF2RA -1.037618749 5.5567E-06 colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage) (CSF2RA), transcript variant 6, mRNA. PTGR1 -1.040498552 1.13392E-07 prostaglandin reductase 1 (PTGR1), mRNA. PLEKHG1 -1.054137993 4.74472E-09 pleckstrin homology domain containing, family G (with RhoGef domain) member 1 (PLEKHG1), mRNA. ACAT2 -1.058662883 8.55838E-08 acetyl-Coenzyme A acetyltransferase 2 (ACAT2), mRNA. SLC25A6 -1.06423572 4.19826E-06 solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 6 (SLC25A6), nuclear gene encoding mitochondrial protein, mRNA. SPA17 -1.079495967 3.42161E-08 sperm autoantigenic protein 17 (SPA17), mRNA. PSAT1 -1.084114156 1.6214E-07 phosphoserine aminotransferase 1 (PSAT1), transcript variant 2, mRNA. CD70 -1.084707741 2.46327E-08 CD70 molecule (CD70), mRNA. CYTH1 -1.086699581 6.58096E-06 cytohesin 1 (CYTH1), transcript variant 2, mRNA. RAB32 -1.088079952 2.91439E-07 RAB32, member RAS oncogene family (RAB32), mRNA. SIVA -1.091704411 1.4837E-06 CD27-binding (Siva) protein (SIVA), transcript variant 2, mRNA. SIVA1 -1.093609108 3.16001E-06 SIVA1, apoptosis-inducing factor (SIVA1), transcript variant 2, mRNA. MYO10 -1.097760671 1.32107E-06 myosin X (MYO10), mRNA. DPY30 -1.108703663 1.82829E-07 dpy-30 homolog (C. elegans) (DPY30), mRNA. LOC646723 -1.125059626 7.8722E-05 PREDICTED: similar to Keratin, type I cytoskeletal 18 (Cytokeratin-18) (CK-18) (Keratin-18) (K18) (LOC646723), mRNA. ABCG1 -1.134936883 2.4073E-08 ATP-binding cassette, sub-family G (WHITE), member 1 (ABCG1), transcript variant 2, mRNA. BEX2 -1.1357631 1.30424E-05 brain expressed X-linked 2 (BEX2), mRNA. PCDH7 -1.147057138 1.39551E-05 protocadherin 7 (PCDH7), transcript variant a, mRNA. C19orf46 -1.148392277 1.6111E-07 chromosome 19 open reading frame 46 (C19orf46), mRNA. MFSD3 -1.149833715 1.37237E-05 major facilitator superfamily domain containing 3 (MFSD3), mRNA. C5orf39 -1.158616743 1.38938E-06 chromosome 5 open reading frame 39 (C5orf39), mRNA. HOOK1 -1.161577921 2.15469E-08 hook homolog 1 (Drosophila) (HOOK1), mRNA. COL4A5 -1.16238486 3.65558E-08 collagen, type IV, alpha 5 (COL4A5), transcript variant 1, mRNA. OSBPL10 -1.176460807 1.23028E-07 oxysterol binding protein-like 10 (OSBPL10), mRNA. OPLAH -1.196572155 2.05185E-07 5-oxoprolinase (ATP-hydrolysing) (OPLAH), mRNA. 52 TSPAN31 -1.209696704 1.22204E-07 tetraspanin 31 (TSPAN31), mRNA. PRRG2 -1.243091197 8.55838E-08 proline rich Gla (G-carboxyglutamic acid) 2 (PRRG2), mRNA. DKK2 -1.265476921 2.78082E-06 dickkopf homolog 2 (Xenopus laevis) (DKK2), mRNA. PRRX2 -1.270779114 1.89029E-08 paired related homeobox 2 (PRRX2), mRNA. WIF1 -1.297659917 2.87826E-08 WNT inhibitory factor 1 (WIF1), mRNA. JAG2 -1.308943989 2.06045E-06 jagged 2 (JAG2), transcript variant 1, mRNA. KDELR3 -1.310666879 5.0271E-10 KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 3 (KDELR3), transcript variant 2, mRNA. PSCD1 -1.330205867 6.75593E-08 pleckstrin homology, Sec7 and coiled-coil domains 1(cytohesin 1) (PSCD1), transcript variant 2, mRNA. MARVELD2 -1.348444556 6.84611E-10 MARVEL domain containing 2 (MARVELD2), transcript variant 2, mRNA. IFT74 -1.351229683 8.63893E-09 intraflagellar transport 74 homolog (Chlamydomonas) (IFT74), transcript variant 2, mRNA. GPR155 -1.355447168 3.31338E-09 G protein-coupled receptor 155 (GPR155), transcript variant 9, mRNA. DCLK1 -1.381097896 6.12558E-08 doublecortin-like kinase 1 (DCLK1), mRNA. LHX8 -1.389902099 2.94778E-09 LIM homeobox 8 (LHX8), mRNA. MARCKS -1.39017369 1.06954E-09 myristoylated alanine-rich protein kinase C substrate (MARCKS), mRNA. FAM9C -1.422578603 3.67012E-10 family with sequence similarity 9, member C (FAM9C), mRNA. IFI27L2 -1.433965791 2.39259E-08 interferon, alpha-inducible protein 27-like 2 (IFI27L2), mRNA. DSG2 -1.464027269 3.04304E-08 desmoglein 2 (DSG2), mRNA. BMP7 -1.473784296 4.76326E-07 bone morphogenetic protein 7 (osteogenic protein 1) (BMP7), mRNA. TMSL3 -1.475708102 1.04099E-09 thymosin-like 3 (TMSL3), mRNA. IL28RA -1.53580284 1.88278E-10 interleukin 28 receptor, alpha (interferon, lambda receptor) (IL28RA), transcript variant 1, mRNA. CDH2 -1.537326911 3.18863E-08 cadherin 2, type 1, N-cadherin (neuronal) (CDH2), mRNA. GPR177 -1.563221158 1.39757E-07 G protein-coupled receptor 177 (GPR177), transcript variant 1, mRNA. GCA -1.585526342 1.32991E-09 grancalcin, EF-hand calcium binding protein (GCA), mRNA. SCML1 -1.605292043 2.86488E-09 sex comb on midleg-like 1 (Drosophila) (SCML1), transcript variant 1, mRNA. RAB17 -1.616143008 3.67012E-10 RAB17, member RAS oncogene family (RAB17), mRNA. PAGE4 -1.638755352 2.74366E-06 P antigen family, member 4 (prostate associated) (PAGE4), mRNA. LGI1 -1.656384408 2.26825E-06 leucine-rich, glioma inactivated 1 (LGI1), mRNA. LOC647886 -1.66270837 1.04099E-09 PREDICTED: misc_RNA (LOC647886), miscRNA. C9orf46 -1.666657397 2.86488E-09 chromosome 9 open reading frame 46 (C9orf46), mRNA. CITED2 -1.670293416 4.76729E-10 Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 2 (CITED2), transcript variant 1, mRNA. FSTL5 -1.672196875 1.9736E-08 follistatin-like 5 (FSTL5), mRNA. NR4A2 -1.707460089 7.27226E-07 nuclear receptor subfamily 4, group A, member 2 (NR4A2), transcript variant 1, mRNA. IFIH1 -1.749177549 1.23629E-10 interferon induced with helicase C domain 1 (IFIH1), mRNA. GCG -1.928084872 5.84857E-10 glucagon (GCG), mRNA. KANK1 -1.932669456 1.46131E-10 KN motif and ankyrin repeat domains 1 (KANK1), transcript variant 1, mRNA. ARHGAP4 -1.969476571 6.47364E-11 Rho GTPase activating protein 4 (ARHGAP4), mRNA. ANKRD32 -2.02233529 1.23629E-10 ankyrin repeat domain 32 (ANKRD32), mRNA. WDR72 -2.087903369 1.60804E-11 WD repeat domain 72 (WDR72), mRNA. CHES1 -2.148497263 1.46131E-10 checkpoint suppressor 1 (CHES1), mRNA. CRABP2 -2.202682571 3.89251E-08 cellular retinoic acid binding protein 2 (CRABP2), mRNA. GRP -2.325023224 2.78623E-10 gastrin-releasing peptide (GRP), transcript variant 3, mRNA. FAM5C -2.348837955 3.19042E-11 family with sequence similarity 5, member C (FAM5C), mRNA. NTS -2.382260661 3.74104E-10 neurotensin (NTS), mRNA. APOE -2.421834937 2.93753E-09 apolipoprotein E (APOE), mRNA. IFITM2 -2.808804156 3.54793E-11 interferon induced transmembrane protein 2 (1-8D) (IFITM2), mRNA. TACSTD1 -2.873664106 5.64412E-10 tumour-associated calcium signal transducer 1 (TACSTD1), mRNA. IFITM3 -2.911210487 1.07168E-10 interferon induced transmembrane protein 3 (1-8U) (IFITM3), mRNA. BEX1 -3.117400352 3.54793E-11 brain expressed, X-linked 1 (BEX1), mRNA. EPCAM -3.531153667 1.60804E-11 epithelial cell adhesion molecule (EPCAM), mRNA. TMSB4X -4.159006717 6.45906E-13 thymosin, beta 4, X-linked (TMSB4X), mRNA. Genes involved in cholesterol biosynthesis and in interferon response are highlighted in green and yellow respectively. These are genes that have been implicated in regulating norovirus lifecycle. 53 Table 3.3. Comparison of gene expression profiles between HGT cells and HGT-Cured cells at FC ≥ 2 and FDR = 0.01 SYMBOL Log2FC adj. P.Value DEFINITION ANXA1 5.471389544 1.67899E-10 annexin A1 (ANXA1), mRNA. ALDH1A1 4.586497529 3.36967E-10 aldehyde dehydrogenase 1 family, member A1 (ALDH1A1), mRNA. DLX5 3.631858223 5.07431E-10 distal-less homeobox 5 (DLX5), mRNA. TIMP1 3.25141016 2.00743E-05 TIMP metallopeptidase inhibitor 1 (TIMP1), mRNA. LMO3 3.228313922 8.67384E-09 LIM domain only 3 (rhombotin-like 2) (LMO3), transcript variant 1, mRNA. PPAP2B 3.212661949 6.162E-08 phosphatidic acid phosphatase type 2B (PPAP2B), transcript variant 1, mRNA. ENC1 2.939292668 9.55561E-08 ectodermal-neural cortex (with BTB-like domain) (ENC1), mRNA. CDH11 2.713446627 4.31736E-08 cadherin 11, type 2, OB-cadherin (osteoblast) (CDH11), mRNA. ADM 2.69221929 6.38444E-08 adrenomedullin (ADM), mRNA. C11orf88 2.57704685 5.01901E-07 chromosome 11 open reading frame 88 (C11orf88), transcript variant 2, mRNA. DYNC1I1 2.432891708 5.27711E-07 dynein, cytoplasmic 1, intermediate chain 1 (DYNC1I1), mRNA. DACT1 2.383728535 1.25302E-07 dapper, antagonist of beta-catenin, homolog 1 (Xenopus laevis) (DACT1), transcript variant 1, mRNA. GABRA2 2.313148854 3.10345E-09 gamma-aminobutyric acid (GABA) A receptor, alpha 2 (GABRA2), mRNA. FNDC3B 2.136820949 4.84495E-07 fibronectin type III domain containing 3B (FNDC3B), transcript variant 2, mRNA. EGR1 2.02891219 0.001203463 early growth response 1 (EGR1), mRNA. SPRY2 1.900324665 1.59614E-06 sprouty homolog 2 (Drosophila) (SPRY2), mRNA. ACTA2 1.876825651 0.000207567 actin, alpha 2, smooth muscle, aorta (ACTA2), mRNA. LMO2 1.802304899 4.13211E-07 LIM domain only 2 (rhombotin-like 1) (LMO2), mRNA. DACH1 1.685165698 1.31319E-07 dachshund homolog 1 (Drosophila) (DACH1), transcript variant 2, mRNA. EPDR1 1.65800063 3.36081E-07 ependymin related protein 1 (zebrafish) (EPDR1), mRNA. GABRB1 1.637527144 2.70135E-08 gamma-aminobutyric acid (GABA) A receptor, beta 1 (GABRB1), mRNA. HEY1 1.602300826 7.21938E-07 hairy/enhancer-of-split related with YRPW motif 1 (HEY1), transcript variant 2, mRNA. RBM20 1.560887902 5.60219E-05 PREDICTED: RNA binding motif protein 20 (RBM20), mRNA. MARCKS 1.553308358 1.25302E-07 myristoylated alanine-rich protein kinase C substrate (MARCKS), mRNA. BAMBI 1.549858865 0.000306921 BMP and activin membrane-bound inhibitor homolog (Xenopus laevis) (BAMBI), mRNA. FBXO8 1.530556403 3.52835E-05 F-box protein 8 (FBXO8), mRNA. VGF 1.52209266 0.00290602 VGF nerve growth factor inducible (VGF), mRNA. GLCE 1.520734436 8.13027E-07 glucuronic acid epimerase (GLCE), mRNA. ELF1 1.520460833 0.000274879 E74-like factor 1 (ets domain transcription factor) (ELF1), mRNA. ERI1 1.503672298 1.15793E-05 exoribonuclease 1 (ERI1), mRNA. ITSN1 1.492202193 1.0857E-07 intersectin 1 (SH3 domain protein) (ITSN1), transcript variant 2, mRNA. GAD1 1.47110597 1.28427E-06 glutamate decarboxylase 1 (brain, 67kDa) (GAD1), transcript variant GAD25, mRNA. LOC100133893 1.401237414 2.51864E-06 PREDICTED: similar to hCG1642672 (LOC100133893), mRNA. BHLHE22 1.392581009 2.40735E-07 basic helix-loop-helix family, member e22 (BHLHE22), mRNA. HAND2 1.312064659 1.76253E-06 heart and neural crest derivatives expressed 2 (HAND2), mRNA. VIM 1.265167032 5.14905E-05 vimentin (VIM), mRNA. KITLG 1.209443205 1.21835E-05 KIT ligand (KITLG), transcript variant b, mRNA. IGFBP6 1.209417917 4.10421E-05 insulin-like growth factor binding protein 6 (IGFBP6), mRNA. FGF13 1.209401164 2.87797E-06 fibroblast growth factor 13 (FGF13), transcript variant 1A, mRNA. PPP1R15A 1.201075133 0.002762603 protein phosphatase 1, regulatory (inhibitor) subunit 15A (PPP1R15A), mRNA. ANXA5 1.1800694 0.000145703 annexin A5 (ANXA5), mRNA. KIAA1712 1.146122737 7.21938E-07 KIAA1712 (KIAA1712), mRNA. CD68 1.120823199 9.96592E-06 CD68 antigen (CD68), mRNA. OTX2 1.116246213 1.23551E-05 orthodenticle homeobox 2 (OTX2), transcript variant 2, mRNA. MUDENG 1.084575793 1.0046E-06 MU-2/AP1M2 domain containing, death-inducing (MUDENG), mRNA. RNF43 1.081705459 1.59614E-06 ring finger protein 43 (RNF43), mRNA. AP1S2 1.07031995 1.20813E-05 adaptor-related protein complex 1, sigma 2 subunit (AP1S2), mRNA. MT2A 1.059628649 0.000598823 metallothionein 2A (MT2A), mRNA. USP3 1.059108777 4.53821E-06 ubiquitin specific peptidase 3 (USP3), mRNA. SDPR 1.05889558 4.32925E-05 serum deprivation response (phosphatidylserine binding protein) (SDPR), mRNA. 54 PMAIP1 1.056043423 0.000750078 phorbol-12-myristate-13-acetate-induced protein 1 (PMAIP1), mRNA. NES 1.048148776 1.75514E-06 nestin (NES), mRNA. BCL11A 1.038120999 4.78402E-06 B-cell CLL/lymphoma 11A (zinc finger protein) (BCL11A), transcript variant 1, mRNA. FAM164C 1.018603837 9.0981E-06 family with sequence similarity 164, member C (FAM164C), transcript variant 2, mRNA. KCNQ2 -1.001732831 0.000330671 potassium voltage-gated channel, KQT-like subfamily, member 2 (KCNQ2), transcript variant 3, mRNA. LCLAT1 -1.016470969 1.31094E-05 lysocardiolipin acyltransferase 1 (LCLAT1), transcript variant 2, mRNA. SCML1 -1.016834473 1.99131E-05 sex comb on midleg-like 1 (Drosophila) (SCML1), transcript variant 1, mRNA. ABCG1 -1.019091153 8.3763E-07 ATP-binding cassette, sub-family G (WHITE), member 1 (ABCG1), transcript variant 2, mRNA. PLEKHG1 -1.024348916 2.31558E-07 pleckstrin homology domain containing, family G (with RhoGef domain) member 1 (PLEKHG1), mRNA. SPA17 -1.027550951 9.47773E-07 sperm autoantigenic protein 17 (SPA17), mRNA. CD70 -1.029469169 1.41117E-06 CD70 molecule (CD70), mRNA. INSIG1 -1.042684569 0.00042443 insulin induced gene 1 (INSIG1), transcript variant 2, mRNA. SNORA61 -1.054578707 0.007625676 small nucleolar RNA, H/ACA box 61 (SNORA61), small nucleolar RNA. CHES1 -1.082667743 1.03766E-06 checkpoint suppressor 1 (CHES1), mRNA. TSPAN31 -1.087806457 1.07801E-05 tetraspanin 31 (TSPAN31), mRNA. PSAT1 -1.088392866 4.83847E-06 phosphoserine aminotransferase 1 (PSAT1), transcript variant 2, mRNA. TACSTD1 -1.08990083 7.76126E-05 tumour-associated calcium signal transducer 1 (TACSTD1), mRNA. RNY4 -1.120995848 0.000304247 RNA, Ro-associated Y4 (RNY4), small cytoplasmic RNA. DPY30 -1.127719985 5.3662E-06 dpy-30 homolog (C. elegans) (DPY30), mRNA. LOC389816 -1.135271179 1.41117E-06 cytokeratin associated protein (LOC389816), mRNA. OSBPL10 -1.153080387 2.14808E-06 oxysterol binding protein-like 10 (OSBPL10), mRNA. ALCAM -1.164754292 0.000187802 activated leukocyte cell adhesion molecule (ALCAM), mRNA. C19orf46 -1.166936236 3.99867E-06 chromosome 19 open reading frame 46 (C19orf46), mRNA. BMP7 -1.17032744 0.000140247 bone morphogenetic protein 7 (osteogenic protein 1) (BMP7), mRNA. ZDHHC14 -1.172377263 0.00011671 zinc finger, DHHC-type containing 14 (ZDHHC14), transcript variant 1, mRNA. WIF1 -1.176899787 9.30763E-06 WNT inhibitory factor 1 (WIF1), mRNA. PRRX2 -1.212851723 1.28427E-06 paired related homeobox 2 (PRRX2), mRNA. EPCAM -1.239473085 3.427E-05 epithelial cell adhesion molecule (EPCAM), mRNA. KDELR3 -1.2688205 5.35513E-08 KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 3 (KDELR3), transcript variant 2, mRNA. DCLK1 -1.27650471 4.78402E-06 doublecortin-like kinase 1 (DCLK1), mRNA. IFT74 -1.308493423 5.27711E-07 intraflagellar transport 74 homolog (Chlamydomonas) (IFT74), transcript variant 2, mRNA. LGI1 -1.337654429 0.000257513 leucine-rich, glioma inactivated 1 (LGI1), mRNA. FAM9C -1.349836465 4.31736E-08 family with sequence similarity 9, member C (FAM9C), mRNA. MARVELD2 -1.362636812 7.19784E-08 MARVEL domain containing 2 (MARVELD2), transcript variant 2, mRNA. TMSL3 -1.421147132 1.0857E-07 thymosin-like 3 (TMSL3), mRNA. IL28RA -1.479685852 2.70135E-08 interleukin 28 receptor, alpha (interferon, lambda receptor) (IL28RA), transcript variant 1, mRNA. RAB17 -1.551903163 5.62629E-08 RAB17, member RAS oncogene family (RAB17), mRNA. APOE -1.691949644 1.50712E-05 apolipoprotein E (APOE), mRNA. FAM5C -1.704338224 6.93704E-08 family with sequence similarity 5, member C (FAM5C), mRNA. C9orf46 -1.723515424 2.92464E-07 chromosome 9 open reading frame 46 (C9orf46), mRNA. LOC647886 -1.733299978 1.87883E-07 PREDICTED: misc_RNA (LOC647886), miscRNA. ARHGAP4 -1.826468525 3.24804E-08 Rho GTPase activating protein 4 (ARHGAP4), mRNA. NR4A2 -1.828905491 5.62629E-08 nuclear receptor subfamily 4, group A, member 2 (NR4A2), transcript variant 1, mRNA. GRP -1.87715751 3.15768E-07 gastrin-releasing peptide (GRP), transcript variant 3, mRNA. NTS -1.909734576 1.23551E-05 neurotensin (NTS), mRNA. WDR72 -1.972737905 3.10345E-09 WD repeat domain 72 (WDR72), mRNA. KANK1 -1.99898437 6.08388E-08 KN motif and ankyrin repeat domains 1 (KANK1), transcript variant 1, mRNA. ANKRD32 -2.20141555 3.19802E-09 ankyrin repeat domain 32 (ANKRD32), mRNA. BEX1 -2.426959973 4.97005E-09 brain expressed, X-linked 1 (BEX1), mRNA. TMSB4X -4.355672736 2.403E-10 thymosin, beta 4, X-linked (TMSB4X), mRNA. 55 3.5. Sensing of cytosolic RNA and DNA PAMPs by the innate immune system is functional in the HGT-based cells. Downregulation of the type III interferon receptor expression suggests that lambda interferons play a role in the negative regulation of the norovirus lifecycle, restricting replication and therefore reducing the amount of viral RNA in the cells. This provides a basis for selection of IFNLR1 downregulation in the HGT-NV cells. To probe this hypothesis, we measured both type I and type III interferon expression levels by quantitative RT-qPCR. While no difference in IFNB expression was detected between cell lines (Figure 3.5A), a significant 26-fold higher expression of interferon lambda 2/3 was detected in cells replicating the noroviral RNA suggesting that viral RNA is indeed readily detected in HGT-NV cells (Figure 3.5B). In line with this observation, we found a more than 6-fold increase in viperin expression when HGT-NV cells were compared to HGT parental cells (Figure 3.5C). To examine whether HGT-NV and HGT-Cured cells were able to detect and mount an innate immune response against cytosolic PAMPs, poly (I:C) and poly (dA:dT) were transfected in the various HGT-derived cell lines and viperin expression levels were measured by RT-qPCR (Fig. 3.5D-E). Although the cell lines exhibited upregulation of viperin mRNA to various extents, a significant increase of viperin expression above basal levels was detected in all the three cell lines in response to both poly(I:C) and poly(dA:dT). Given that the overall levels of viperin following treatment was comparable across the three cell lines, evident by the relative ratio with respect to β-actin, we concluded that PAMP sensing and downstream signalling pathways are functional in these cell lines. The model ISG used in this study was viperin, owing to its ubiquitous expression following all three types of IFNs responses and broad range antiviral activity (Helbig and Beard 2014; Ghosh and Marsh 2020) 56 Figure 3.5. Innate immune responses to RNA and DNA PAMPs are functional in HGT-based cells. A-C. Quantitative expression analysis of IFNB (A), IFNL2/3 (B) and Viperin (C) mRNAs. Relative gene expression was determined from one experiment performed in biological triplicate and compared to the expression levels measured in HGT cells. Statistical significance was determined using the unpaired t-test. Error bars represent the standard deviation between biological replicates. D-E. Cells were transfected with poly (I:C) (D) or poly (dA:dT) (E) and total RNA was harvested 8h post-transfection for quantification of viperin mRNA levels by RT-qPCR. Viperin mRNA levels were expressed as differences of cycle threshold (Ct) of viperin, relative to the Ct of beta-actin. The error bars represent standard deviation, determined from the result of three replicates. 3.6. The ability to respond to type III but not type I IFN in HGT-NV and HGT-Cured cells is debilitated. We next investigated the ability of type I and type III interferons to elicit ISGs induction. To this end, cells were incubated with human IFN-β or IFN-λ2 for 16 hours and viperin expression levels were measured by RT-qPCR. We observed that viperin mRNA was readily induced in all three cell lines in response to exogenous type I IFN(IFN-β) treatment (Fig. 3.6A). However, whereas HGT cells responded to exogenous type III 57 IFN (IFN-λ2) treatment, HGT-NV and HGT-Cured cells did not (Fig. 3.6B). To test whether the absence of ISG expression is linked to a defect of STAT1 phosphorylation Figure 3.6. The ability to respond to type III but not type I IFN is debilitated in HGT-NV and HGT-Cured cells. A-B. Cells were treated with type I (IFN-β) (A) or type III interferon (IFN-λ2) (B), incubated overnight and harvested for total RNA extraction and quantification of viperin mRNA levels by RT-qPCR. Viperin mRNA expression levels were expressed as differences of cycle threshold (Ct) of viperin, relative to the Ct of beta-actin. The error bars represent the standard deviation, determined from the result of three replicates. C-F. Western-blot analysis showing STAT1 phosphorylation after stimulation with type I and type III interferons in HGT, HGT-NV and HGT-Cured cell lines (C, E). HGT-NV Clone 2 (C2) and population of cells (pop) were included in the experiment (D, F). GAPDH was used as loading control. in response to type I or type III interferons, cells were incubated with either recombinant IFN-β or IFN-λ2 and STAT1 phosphorylation status was analysed by western blot using anti-STAT1 phospho-specific antibodies. We observed that 58 although STAT1 phosphorylation was detected in HGT-NV and HGT-Cured cells STAT1 was phosphorylated in all cell lines following IFN-β treatment (Fig. 3.6C), none was seen following IFN-λ2 treatment (Fig. 3.6D). To ensure that the absence of STAT1 phosphorylation in HGT-NV cells is not due to a potential clonal effect, different clones as well as a population of the HGT-NV cells were included in the experiment. Similarly, the clones represented here by clone 2 (C2) and the polyclonal cell population responded to IFN-β but not to IFN-λ2 (Fig. 3.6E-F). Taken together, these results indicate that signal transduction induced by type I IFN is intact while STAT1 phosphorylation induced in response to lambda interferon is inhibited in HGT cells that sustained HuNoV replication. 3.7. IFNLR1 overexpression rescues STAT1 phosphorylation in response to IFN lambda and decreases viral replication. To directly test whether the downregulation of IFNLR1 expression measured in HGT- NV and Cured cells is responsible for their unresponsiveness to lambda interferon, cells were transfected with an IFNLR1-expressing plasmid and stimulated with IFN-λ2 the day after. We observed that IFNLR1 expression rescued STAT1 phosphorylation in response to interferon lambda suggesting that IFNLR1 down-regulation in HGT-NV and HGT-Cured cells is responsible for IFN-λ insensitivity (Fig. 3.7A). In addition, this experiment shows that the JAK-STAT signalling cascade comprising JAK1, Tyk2 and possibly JAK2 (Odendall et al. 2014) is functional and leads to the phosphorylation of STAT1. We next investigated whether transient IFNLR1 overexpression negatively impacts HuNoV replication. To this end HGT-NV cells were transfected with an IFNLR1-expressing plasmid or an empty vector and to confirm success of receptor expression, STAT1 phosphorylation was measured after treatment with or without 59 Figure 3.7. Overexpression of IFNLR1 in HGT-NV and HGT-Cured cells rescues the ability to respond to type III IFN and negatively impacts HuNoV replication. A) HGT, HGT-NV and HGT-Cured were transfected with IFNLR1 expressing plasmid and STAT1 phosphorylation was measured in whole cell lysate by western blot after incubating cells with type III IFN for 15 min. STAT1 was used as a positive control and GAPDH was used as the loading control. HGT-NV cells were transfected with IFNLR1 expressing plasmid or an empty vector. After two days, cells were stimulated for 96h with type III interferon or were left untreated. B) STAT1 phosphorylation was measured in whole cell lysate by western blot. STAT1 was used as a positive control and GAPDH was used as the loading control. C) Total cellular RNA was extracted, and viral RNA was quantified by RT-qPCR. HuNoV replication levels were expressed as differences of cycle threshold (Ct) of HuNoV, relative to the Ct of beta-actin. The error bars represent the standard deviation, determined from the result of three replicates. Statistical significance was determined using the unpaired t-test. IFN-λ2 (Fig. 3.7B). HuNoV replication was monitored by quantitative RT-PCR. In the absence of IFN-λ2, we observed a modest but statistically significant reduction of viral replication when IFNLR1-transfected cells were compared to cells transfected with the empty vector, possibly owing to the basal or endogenously expressed IFN-λ2 in the cells (Fig. 3.7C). This reduction of HuNoV replication greatly increased when cells 60 were stimulated with IFN-λ2 suggesting that IFNLR1 downregulation in HGT-NV cells is prominently responsible for their ability to support enhanced viral replication. 3.8. Inactivation of interferon type I and III receptors increases HuNoV replication in epithelial cells. To directly test the influence of type I and type III IFNs on HuNoV replication, HGT cells lines deficient either for the interferon alpha/beta receptor IFNAR1 or for the Figure 3.8. Genetic ablation of IFNAR1 and IFNLR1 promotes HuNoV replication. HGT wild-type cells as well as IFNAR1 (A) and IFNLR1 (B) CRISPR/Cas9 clones were treated with type I (IFN-β) (A) or type III interferon (IFN-λ2) (B) for 15 min and STAT1 phosphorylation (pT701) was measured by immunoblot analysis. GAPDH was used as a loading control. C) Parental HGT, IFNAR1 and IFNLR1 knock-out cells were transfected with VPg-linked replicon RNA and subjected to G418 selection. Total cellular RNA was harvested at various time points post-transfection and viral RNA was quantified by RT-qPCR. Relative viral replication was determined from one experiment performed in biological triplicate and compared to the replication levels measured in HGT-Cured at day 0. Statistical significance was determined using the unpaired t test. Error bars represent the standard deviation between biological replicates. C 61 interferon lambda receptor IFNLR1 were generated using CRISPR/Cas9-mediated genome editing. To this end, parental HGT cells were transduced with lentiviruses expressing IFNAR1 or IFNLR1 single guide RNAs and clonally selected in the presence of puromycin. Individual clones were screened for gene inactivation by IFN- β or IFN-λ2 challenging followed by analysis of STAT1 phosphorylation by western- blot and viperin induction by RT-qPCR (Fig. 3.8A-B). VPg-linked viral RNA was then transfected and cells were selected in the presence of 0.5mg/mL G418 for up to 6 days. Relative to day 0 taken as reference, we observed a significant increase in genomic viral RNA in all cell lines with the exception of parental HGT cells corroborating the antiviral activity of both type I and type III IFNs on HuNoV replication (Fig. 3.8C). 3.9. IFNLR1 is methylated in HGT-NV and HGT-Cured cells. The dimeric interferon lambda receptor consists of the ubiquitously expressed IL10RB chain subunit and the interferon lambda specific chain IFNLR1 whose expression is limited to cells of epithelial origin (Sommereyns et al. 2008). Cell-type specific expression of the IFNLR1 subunit was later shown to be inversely correlated with the methylation of its promoter (Ding et al. 2014). To examine whether viral replication induced, or lead to the selection of, alterations of IFNLR1 gene expression through epigenetic modifications, cells were incubated in the presence 5-aza-2’-deoxycytidine (5azadC), a deoxynucleoside analogue that strongly inhibits DNA methyltransferase (DNMT) activity (Christman 2002). As shown in Fig. 3.9A, we observed a significant 6-fold increase of IFNLR1 mRNA levels in HGT-NV cells when compared to cells incubated with the vehicle only. A statistically significant increase in IFNLR1 gene expression was also observed in the case of HGT-Cured cells but to a lower extent (2.8-fold). In contrast, 62 Figure 3.9. IFNLR1 promoter is methylated during long-term HuNoV replication. A-B. HGT, HGT-NV and HGT-Cured cells were incubated in the presence of 10 µM 5azadC for 72 hours or left untreated. When indicated cells were also incubated in the presence of 1 µM MS-275 in the last 24h. Total cell RNA was extracted and IFNLR1 (A) and IL10RB (B) expression levels were measured by RT-qPCR. Relative gene expression was determined from one experiment performed in biological triplicate and compared to the expression levels measured in corresponding vehicle-treated cells. Statistical significance was determined using the unpaired t-test. Error bars represent the standard deviation between biological replicates. no change in IL10RB expression was detected when the same cells were incubated with 5azadC (Fig. 3.9B). In addition, incubation in the presence of the HDAC inhibitor MS-275 (Saito et al. 1999) alone or in combination with 5azadC did not result in increased IFNLR1 or IL10RB expression suggesting that replicating HuNoV did not modify the chromatin structure of these genes. 3.10. IFNLR1 promoter is methylated across the transcription start site We next assessed the methylation status of the IFNLR1 promoter by methylation- sensitive PCR using McrBC, a GTP-dependent endonuclease that cleaves DNA fragments containing methylated cytosines. To this end, as summarised in Fig. 3.10A, genomic DNA extracted from HGT, HGT-NV and HGT-Cured cell lines were digested 63 with McrBC and digestion products were amplified by PCR. As represented in Fig. 3.10B, the amplicon (red region), which spans a CpG island from -211 to +216 bp relative to the IFNLR1 transcription start site (TSS), is located in a promoter region previously shown to be methylated in cells from non-epithelial origin (Ding et al. 2014). Figure 3.10. Assessment of IFNLR1 promoter methylation status in HGT-based cells. A) Genomic DNA extracted from HGT, HGT-NV and HGT-Cured cells was digested with McrBC in the absence or presence of GTP. Digestion products were subsequently subjected to PCR amplification analysis using primers specific for the IFNLR1 promoter. B) Piece of the IFNLR1 promoter showing the CpG regions (gray bars) below. The region indicated in red spans the transcription start site (TSS) which was amplified with forward and reverse primers (purple). Green arrow indicates the nature of the island targeted by the enzyme. C) PCR products were subjected to gel electrophoresis with beta-actin PCR products used as loading control. See text for details. Regions on the DNA that are recognized by McrBC consist of two half-sites separated by up to 3kb in the form 5’…PumC(N40-3000)PumC…3’ (Fig 3.10B). Interestingly, we observed less PCR amplification in McrBC-digested samples originating from HGT- 5’….PumC(N40-3000)Pu mC….3’ A B Enzyma'c diges'on of genomic DNA (±GTP) C Overnight (16h) incuba'on at 37°C Extrac'on of DNA from diges'on PCR and agarose gel electrophoresis Flow of work - + - + - + HGT HGT-NV HGT-Cured 500 400 200 100 bp GTP IFNLR1 promoter β-actin 64 NV or HGT-Cured cells than in parental HGT cells confirming a greater degree of methylation of their IFNLR1 promoters (Fig. 3.10C). In addition, this experiment shows that the same region of the IFNLR1 promoter is methylated both in physiological and pathological processes suggesting that epigenetic control is the main mechanism of IFNLR1 gene expression regulation. Taken together, these results suggest that the replication of HuNoV in HGT epithelial cells induces a long-term transcriptional silencing of the IFNLR1 gene through the methylation of its promoter. 3.11. Cellular factors beyond interferon response possibly enhance HuNoV replication. In our observation so far, ablation of IFNAR1 or IFNLR1 promotes HuNoV replication but not to the level observed in the HGT-Cured cells which is limited in the expression of IFNLR1 (Fig. 3.7C). We next examined the combinatorial effect of both receptors on virus replication as compared to what we observed in HGT-Cured cells. To this end, IFNAR1-/- HGT cells (clone R1-2) were transduced with lentiviruses expressing IFNLR1 single guide RNAs and clonally selected in the presence of blasticidin to produce IFNAR1 and IFNLR1 double knockout cells (DKO). Clones were expanded and screened for gene inactivation by incubating with recombinant IFN-β or IFN-λ2 followed by analysis of STAT1 phosphorylation by western-blot (Fig. 3.11A). Next, VPg-linked viral RNA was transfected into the HGT-based cells and selected in the presence of 0.5mg/mL G418 for up to 5 days. Relative to day 0 taken as reference, we again observed a significant increase in genomic viral RNA in all cell lines with the exception of parental HGT cells. Consistent with the data in Fig. 3.7C, HGT-Cured cells were better at supporting HuNoV replication and colony formation compared to either single knockout or double knockout cells (Fig. 3.11B-C). Interestingly, we observed a significantly higher level of HuNoV replication in the DKO cells compared 65 with either of the single knockout cells, indicating the potency of the combinatorial antiviral activity of both type I and type III IFNs on HuNoV replication (Fig. 3.11B-C). Together, our data suggests that some other factors apart from the compromised immune response due to the loss of IFNLR1 expression may be contributing to HuNoV replication in HGT-Cured cells. Figure 3.11. Additional factors to type I and type III interferon response are important in restricting HuNoV replication. A) HGT wild-type cells, IFNAR-/- (R1-2) as well as IFNAR/IFNLR1 double knock-out (DKO) clones were treated with type I (IFN-β) or type III interferon (IFN-λ2) for 15 min and STAT1 phosphorylation (pT701) was measured by immunoblot analysis. GAPDH was used as a loading control. Parental HGT, IFNAR1-/-, IFNLR1-/- and DKO cells were transfected with VPg-linked replicon RNA and subjected to 0.5mg/ml G418 selection. A) Total cellular RNA was harvested 5 days post-transfection and viral RNA was quantified by RT-qPCR. Relative viral replication was determined from one experiment performed in biological triplicate and compared to the replication at day 0. Statistical significance was determined using the unpaired t test. Error bars represent the standard deviation between biological replicates. For colony forming assay, cells were washed and stained with toluidine blue 5 days post-selection. Number of colonies was determined using the ImageJ 1.51m9 software. 66 Discussion The purpose of this study was to identify pathways that may be restricting HuNoV replication. With this, we compared genome-wide transcriptional responses of epithelial cells supporting autonomous HuNoV replication with those elicited by IFN- cured derivatives showing increased viral replication abilities. It had already been established that unlike the type I IFN receptor that is expressed on most cell types, expression of the IFNLR1 subunit is restricted to cells of the mucosal epithelium, neutrophils and human hepatocytes (Blazek et al. 2015; Sommereyns et al. 2008; De Weerd et al. 2007). Although the immune cells of the blood were also reported to express the IFNLR1 subunit, they lack the ability to respond to IFN-λ, possibly due to the expression of a soluble variant of the receptor through alternative splicing (Santer et al. 2020; Witte et al. 2009). The role of IFNLR1 in IFN-λ-mediated control of viruses have been reported (reviewed by Syedbasha and Egli 2017). Two single nucleotide polymorphisms in IFNLR1 in a Chinese population was responsible for their susceptibility to HCV infection (Cui et al. 2011). Sheppard and co pre-treated 293 HEK cells overexpressing the receptor with recombinant IFNL2 and infected with EMCV. Compared with the wildtype cells, a reduced infection of EMCV was observed in the cells overexpressing the receptor (Sheppard et al. 2003). Another study reported that in mice infected with influenza A virus, influenza B virus, respiratory syncytial virus, human metapneumovirus and severe acute respiratory syndrome coronavirus, the loss of IFNLR1 and IFNAR1 resulted in an increase in virus titres in the lungs (Mordstein et al. 2010). Cells infected by noroviruses are mostly epithelial cells of the gastrointestinal tract and are therefore expected to extensively express IFNLR1. In fact, the influence of lambda interferons on murine noroviruses has been highlighted in previous studies using different experimental setups 67 (Baldridge et al. 2015a; 2017a; Joana Rocha-Pereira et al. 2018a). In the case of the human norovirus, recent work using the replicon in Huh-7 human hepatoma cell line showed that all three types of IFN, when exogenously added, were able to inhibit HuNoV replication leading to virus clearance during long-term treatment (Dang et al. 2018). In our current study, we found that the interferon lambda receptor is downregulated in HGT-based cells that sustained HuNoV replication. Mechanistically, this down- regulation of IFNLR1 was mediated by promoter methylation as shown by methylation- sensitive PCR and by the fact that treatment with 5azadC, a DNA methyltransferase inhibitor, rescued the phenotype. This suggests that the lambda IFN pathway is a key constituent of the innate intrinsic defence against human norovirus and shows that an endogenous IFN lambda signalling activity is able to modulate the replication of the virus. The present results add further evidence for the involvement of type III IFN in the control of human noroviruses, but extend earlier findings, by showing that physiological levels of type III IFN signalling can effectively restrict HuNoV replication. One of the major concerns with replicon systems is that gene expression landscapes might reflect clonal selection of RNA-replicating cells rather than a universal impact of viral replication on cellular gene expression. To exclude that differences in gene expression were exclusive to a specific cell type or population, we compared our dataset with previous genome wide-transcription profiles from Huh-7 hepatoma cells supporting autonomous replication of HuNoV RNAs (K. O. Chang 2009). We found a (significant) positive correlation between the two datasets when statistically differentially expressed genes were compared (r=0.19; p=0.04; n=115 or r=0.49; p=0.1; n=12, FC>2; Table 3.4), suggesting that analogous cellular responses were induced in response to HuNoV replication in both cell lines. 68 It is interesting to note that IFNLR1 mRNA is also down-regulated in HGT-NV cells which have not been treated with exogenous type I IFN. This indicates that in the absence of selective pressure mediated by type I IFN, modulation of the type III IFN pathway is preferentially selected over other genes with antiviral properties as exemplified in other studies using RNA replicons with selectable marker. For example, in the case of HCV replicon systems, several antiviral genes including Viperin and MX1 were shown to be silenced through gene methylation, rendering Huh-7 cells permissive to HCV replication (Chen et al. 2013; Naka et al. 2006). An important observation in this study is the upregulation of several IRF3-dependent genes when HGT-NV cells were compared to parental HGT cells. As IRF3 activation is essential for type I and III interferon induction, upregulation of IRF3-dependent genes suggests that HuNoV replication produces PAMPs that are sensed by RIG-I like receptor(s) which in turn activate the cell-intrinsic immune signalling pathways. Similarly, down-regulation of ISRE-dependent genes in HGT-NV when compared to HGT-Cured cells, which have silenced the IFNLR1 gene to the same extent, put forward the idea that HuNoV replication induces IFN-dependent responses. In line with this, a recent study using the same replicon identified RIG-I and MDA5 proteins as potent negative regulator of HuNoV replication suggesting that viral RNA secondary structures can readily be detected during replication (Dang et al. 2018). These observations are however in striking contrast to the study of Qu and colleagues in which transfection of stool-derived HuNoV RNA readily replicated in 293FT cells but failed to induce detectable interferon responses (Qu et al. 2016). In the study by Qu and colleagues (Qu et al. 2016), it is possible that the lack of IFN induction during HuNoV replication might be due to mutations in cell lines during passages rendering some of the cells incompetent to induce innate immune response upon viral infection. 69 Also, during transfection of viral RNA, active replication occurred in less than 1% of cells leading to insufficient replication which is not sufficient to induce IFN response. In fact, GII.4 an GII.3 HuNoV induced IFN responses in cell-derived human intestinal enteroids (Hosmillo et al. 2020), confirming that in general, HuNoV replication is capable of inducing IFN response. Increased replication of HuNoV in HGT-Cured compared to either IFNAR or IFNLR1 knock-out, as well as DKO cells suggests that differentially regulated genes other than IFN receptors may favour virus replication. However, manual curation of genes differentially regulated between parental and IFN-cured cells did not reveal individual genes convincingly known to modulate viral replication other than IFNLR1 and genes involved in the biosynthesis and trafficking of cholesterol such as OSBPL10 and APOE (Mahley et al. 1983; 1984; Ridgway et al. 1992; Chang 2009). This suggests either that a low but collective influence of these genes contributes to the increased replication of HuNoV observed in HGT-Cured cells, or that some of the differentially expressed genes identified have a potent yet unknown proviral activity towards the human norovirus. It was difficult to attribute the sustained or enhanced replication of the HuNoV replicons in HGT-NV or HGT-Cured cells to a specific cellular pathway as no specific pathway was significantly enriched in our dataset of significantly up- or down-regulated genes. Further, we analysed the significantly up- or down- regulated ISGs in our data set for transcription factors that were associated with them. We found that for IFIT1 and IFIT2 which were up-regulated in HGT-NV, the transcription factors IRF1, IRF2, IRF3, IRF7 and IRF8 were common between both genes. IFIH1 (MDA5), IFITM2 and IFITM3 which were down-regulated had STAT3 as the only transcription factor that is commonly associated with them. Although the role of IRF1, IRF3 and IRF7 on norovirus replication has been reported (Thackray et al. 2012; Dang et al. 70 2018), the exact roles of IRF2, IRF8 and STAT3 remain unexplored. Further study to determine the role of these transcription factors on norovirus replication will be interesting. In Fig. 3.12, we summarise the possible events that may lead to the establishment of stable replication HGT-NV cells and colonies in HGT-Cured cells. This highlights the interplay between cellular and viral factors that affects viral RNA replication. First, a non-transfected cell remains viable, however, following transfection with a viral RNA, cellular processes are altered. The host machinery for translation are recruited and used for the first-round of translation of the viral RNA into viral proteins (Thorne and Goodfellow 2014). Additionally, host proteins and vesicular membranes are utilised in the formation of a replication complex (Hyde et al. 2009; Thorne and Goodfellow 2014), followed by the induction of RNA synthesis. These processes increase stress in the cells and reduce cell viability (Brocard et al. 2020). To counter this effect, innate immune response is activated which ensures that the virus replication is inhibited. Also, stress pathways in the cells are activated to mount a defence mechanism by turning off translation machinery and activating the mRNA accumulation into stress granules (McCormick and Khaperskyy 2017). This process ensures that the cells conserve energy and nutrients to allow for the effective and rapid expression of antiviral proteins. To select for cells that support the replication of the viral replicons, the translation inhibitor, G418, is added to the cells. This process introduces additional stress on the cells so that those cells which do not contain or maintain replication of the viral RNA die off. Here, cell death can be escaped only when the cells maintain a high level of viral genome replication which will express the G418 resistant protein. In general, for cells to survive the pressures from drug selection and virus replication, cellular defences may be compromised, and the transcriptional and translational 71 landscapes modified. In our system, we found that these changes included the epigenetic suppression of the IL28RA expression which resulted in the loss of IFN-λ2- mediated inhibition of virus replication. Subsequently, between four- and 14-days post- selection, a metastable condition is established, and cell colonies are formed. It is also important to note that from our observation, some of the cell colonies died off beyond 14 days, possibly due to the loss of expression of cellular proteins that may be important for cell survival or that excess viral replication activated pathways that resulted in cell death. Figure 3.12. Schematic of cellular adaptation that leads to permissibility to stable HuNoV replication. The introduction of the viral RNA replicon into the cells through transfection increases stress in the cells and decreases cell viability. Addition of G418 selection affects protein synthesis and further increases stress. Up to 3 days post-selection, cell viability significantly reduces with only a few live cells remaining. The cell numbers and viability are inversely proportional to the level of virus replication. From 4 days on, the few cells begin to double and form colonies. Cellular adaptation and sustained replication may be driven by the suppression of IFNLR1 expression or some other gene modifications. Eventually, number of cells begin to increase and form colonies and cell viability increases. Cells adapt to the stress induced by increased 72 viral RNA replication which means more resistance to G418. Green columns represent indicators for cell viability and level of virus RNA replication. Overall, our results provide insights into the interactions between the human norovirus and innate cellular responses and show that endogenous levels of λ-IFNs control HuNoV replication suggesting that they may have a therapeutic potential in the treatment of noroviral infections. In addition, the high confidence gene expression datasets provided with this study is expected to be useful for the selection and examination of new targets aimed to antiviral therapy. Finally, the data suggest that both cellular and viral factors are important in determining the outcome of a virus infection and that factors other than interferon response determine the level of HuNoV replication. Table 3.4. Comparison between HGT-NV and Huh-7-NV transcriptomes filtered at FDR < 0.01 SYMBOL P.Value Log2FC adj. P.Value Log2FC DEFINITION Huh7 HGT-NV MT1X 6.19E-03 2.64 0.00119753 -0.4494402 metallothionein 1X SGPP2 2.15E-03 2.63 2.264E-06 0.66968801 sphingosine-1-phosphate phosphatase 2 SYDE1 1.21E-04 2.47 0.00240316 0.41895082 synapse defective Rho GTPase homolog 1 FAH 7.68E-03 2.18 0.00410434 -0.3042287 fumarylacetoacetate hydrolase GAD1 7.01E-05 2 4.1656E-07 1.1620631 glutamate decarboxylase 1 MAMLD1 1.75E-04 1.9 1.0679E-08 1.20438905 mastermind like domain containing 1 GALNT9 3.93E-03 1.79 9.0358E-05 0.37243318 polypeptide N-acetylgalactosaminyltransferase 9 CPT1A 7.25E-04 1.76 0.00829582 -0.2583508 carnitine palmitoyltransferase 1A FAM84A 6.84E-04 1.67 0.00763548 -0.2464692 family with sequence similarity 84 member A LEF1 3.57E-03 1.43 0.00021382 0.45448586 lymphoid enhancer binding factor 1 ITPRIP 6.90E-03 1.35 0.00042845 0.33092886 inositol 1,4,5-trisphosphate receptor interacting protein AKAP12 5.38E-04 1.35 9.4929E-05 -0.5358911 A-kinase anchoring protein 12 SYCP2 2.55E-03 1.27 0.00077746 0.33990983 synaptonemal complex protein 2 CADM2 4.12E-03 1.19 0.00157818 -0.3246779 cell adhesion molecule 2 GABRA2 5.84E-03 1.17 7.6414E-10 2.46602555 gamma-aminobutyric acid type A receptor alpha2 subunit RTN1 1.14E-03 1.09 0.00778064 -0.2592787 reticulon 1 IDS 3.58E-03 1.07 0.00177492 0.2636052 iduronate 2-sulfatase CBX6 4.31E-03 1.06 0.00556797 0.36285316 chromobox 6 DOCK11 2.41E-03 1.06 0.00411008 0.2898684 dedicator of cytokinesis 11 COBL 4.06E-03 1.05 0.00053307 0.46855359 cordon-bleu WH2 repeat protein RAB9B 4.40E-03 1.05 0.00323189 -0.2337302 RAB9B, member RAS oncogene family RBPMS2 6.50E-03 1.03 0.00345345 0.3293507 RNA binding protein with multiple splicing 2 SLIT2 2.06E-03 1.02 2.9144E-07 -0.9375262 slit guidance ligand 2 GRB10 3.19E-03 1 0.00019355 0.38559506 growth factor receptor bound protein 10 CYP26A1 4.28E-03 9.79E-01 1.8936E-06 -0.745315 cytochrome P450 family 26 subfamily A member 1 PPP1R14C 2.67E-03 9.50E-01 0.00435014 -0.2876876 protein phosphatase 1 regulatory inhibitor subunit 14C 73 SPATA6 5.62E-03 9.47E-01 0.00339042 0.2401871 spermatogenesis associated 6 ZNF503 2.11E-03 9.18E-01 0.00234961 0.3424146 zinc finger protein 503 HOXA5 9.42E-03 9.10E-01 0.00206559 0.24998773 homeobox A5 ZYX 8.87E-03 9.00E-01 1.585E-05 0.78336371 zyxin KLHL5 3.68E-03 8.74E-01 0.00203353 -0.3469412 kelch like family member 5 FBRS 5.16E-03 8.60E-01 0.0043798 0.37056132 fibrosin NFIX 8.84E-03 8.50E-01 0.00012405 -0.5777444 nuclear factor I X ABHD12 5.37E-03 8.36E-01 0.00711842 -0.2855271 abhydrolase domain containing 12 GRIN2C 7.58E-03 8.23E-01 0.00907445 -0.2487741 glutamate ionotropic receptor NMDA type subunit 2C PRKAA2 3.01E-03 8.20E-01 3.0094E-05 0.43552786 protein kinase AMP-activated catalytic subunit alpha 2 GPD1L 6.50E-03 7.71E-01 0.00078694 -0.3077422 glycerol-3-phosphate dehydrogenase 1-like IFT74 3.61E-03 7.66E-01 8.6389E-09 -1.3512297 intraflagellar transport 74 PSPC1 4.17E-03 7.65E-01 0.00729125 0.37062882 paraspeckle component 1 GABRB1 6.03E-03 7.42E-01 1.7058E-09 2.12360479 gamma-aminobutyric acid type A receptor beta1 subunit AES 6.16E-03 7.03E-01 0.00623602 0.25057701 amino-terminal enhancer of split ASXL3 7.37E-03 6.98E-01 0.00140047 0.2862369 additional sex combs like 3, transcriptional regulator OPN3 6.44E-03 6.68E-01 6.8297E-06 0.74024096 opsin 3 IVD 9.72E-03 6.05E-01 0.00812364 -0.2078793 isovaleryl-CoA dehydrogenase SDC1 7.30E-03 -6.67E-01 0.002973 -0.3941132 syndecan 1 ACTR3 6.08E-03 -6.82E-01 0.00082596 0.75827256 ARP3 actin related protein 3 homolog NR4A2 7.33E-03 -6.90E-01 7.2723E-07 -1.7074601 nuclear receptor subfamily 4 group A member 2 PLOD2 5.83E-03 -7.08E-01 5.6001E-05 -1.0349582 procollagen-lysine,2-oxoglutarate 5-dioxygenase 2 DTNA 8.36E-03 -7.22E-01 4.7176E-09 1.25376774 dystrobrevin alpha MFSD3 7.30E-03 -7.93E-01 1.3724E-05 -1.1498337 major facilitator superfamily domain containing 3 ELAVL3 4.50E-03 -8.12E-01 0.00021113 0.49008546 ELAV like neuron-specific RNA binding protein 3 TSPAN31 9.50E-03 -8.17E-01 1.222E-07 -1.2096967 tetraspanin 31 GALC 3.71E-03 -8.18E-01 0.00620905 -0.2430258 galactosylceramidase PHLDA1 3.53E-03 -8.23E-01 1.893E-07 1.35922259 pleckstrin homology like domain family A member 1 SEMA3A 9.38E-03 -8.54E-01 6.517E-07 0.98504915 semaphorin 3A MITD1 5.38E-03 -8.59E-01 6.4364E-05 -0.4161591 microtubule interacting and trafficking domain containing 1 TFDP2 2.67E-03 -8.73E-01 0.00703801 -0.2801647 transcription factor Dp-2 HELZ 5.66E-03 -8.78E-01 0.00171979 0.28691073 helicase with zinc finger MID1 2.50E-03 -9.33E-01 3.1538E-05 -0.506983 midline 1 POLR2B 7.62E-03 -1.01 0.00280585 0.39952935 RNA polymerase II subunit B DYNC1I1 5.42E-03 -1.04 3.0725E-08 0.93982984 dynein cytoplasmic 1 intermediate chain 1 SEL1L3 2.75E-03 -1.04 7.5865E-06 -0.8145702 SEL1L family member 3 GCA 9.82E-03 -1.04 1.3299E-09 -1.5855263 grancalcin APOBEC3B 7.60E-03 -1.07 0.00409216 0.39833286 apolipoprotein B mRNA editing enzyme catalytic subunit 3B PRKCA 3.34E-03 -1.13 0.00074742 -0.338139 protein kinase C alpha OSMR 9.91E-04 -1.23 0.0003281 -0.4306799 oncostatin M receptor SRGAP3 4.52E-03 -1.24 0.00798824 -0.23268 SLIT-ROBO Rho GTPase activating protein 3 OSBPL10 2.54E-04 -1.25 1.2303E-07 -1.1764608 oxysterol binding protein like 10 GABBR2 3.45E-04 -1.26 0.00019507 0.53634594 gamma-aminobutyric acid type B receptor subunit 2 AIM1L 8.06E-03 -1.26 0.00482627 -0.2834709 absent in melanoma 1-like TPD52L1 4.54E-03 -1.28 7.0175E-06 -0.6035533 tumour protein D52-like 1 RPS9 1.87E-03 -1.29 0.00534344 -0.3581035 ribosomal protein S9 MARVELD3 2.17E-03 -1.29 1.3489E-05 -0.5438594 MARVEL domain containing 3 FNDC3B 2.08E-03 -1.32 1.5514E-11 2.25119357 fibronectin type III domain containing 3B EPCAM 3.24E-04 -1.33 1.608E-11 -3.5311537 epithelial cell adhesion molecule CDH1 1.82E-03 -1.35 0.00736476 -0.2090945 cadherin 1 HIST1H2BD 5.85E-03 -1.42 0.0098526 0.3071779 histone cluster 1, H2bd SAT1 3.73E-04 -1.46 0.00045754 0.39288661 spermidine/spermine N1-acetyltransferase 1 OVOL2 5.81E-04 -1.47 2.0184E-07 -0.9510114 ovo like zinc finger 2 74 DDAH1 4.03E-04 -1.54 2.0979E-05 -0.614028 dimethylarginine dimethylaminohydrolase 1 ADSSL1 4.33E-03 -1.67 8.1088E-05 -0.4130657 adenylosuccinate synthase like 1 WIF1 2.16E-04 -1.7 2.8783E-08 -1.2976599 WNT inhibitory factor 1 CNTNAP2 3.72E-04 -1.76 0.00035259 -0.4494602 contactin associated protein-like 2 ATP2B4 3.01E-04 -1.81 1.602E-08 -1.0147039 ATPase plasma membrane Ca2+ transporting 4 RORA 2.50E-03 -1.83 0.0080408 0.26662314 RAR related orphan receptor A HIST1H2BK 3.82E-04 -1.84 3.64E-05 0.52194941 histone cluster 1, H2bk PDGFD 8.32E-04 -1.92 0.00015587 -0.4001169 platelet derived growth factor D FOS 5.20E-03 -1.94 1.2756E-06 0.68910163 Fos proto-oncogene, AP-1 transcription factor subunit FNBP1 3.85E-03 -1.95 0.00387566 0.24293239 formin binding protein 1 TCEAL3 4.39E-03 -1.97 0.00033855 -0.432027 transcription elongation factor A like 3 MCF2 3.70E-03 -2.04 5.7428E-07 -0.7524879 MCF.2 cell line derived transforming sequence LPAR1 5.49E-05 -2.17 0.00028603 -0.3880637 lysophosphatidic acid receptor 1 FAM46C 3.33E-03 -2.19 0.00739838 0.2461104 family with sequence similarity 46 member C ABCC8 1.99E-04 -2.28 0.0010895 0.44610426 ATP binding cassette subfamily C member 8 HIST1H1C 4.79E-04 -2.3 0.00026578 0.43476183 histone cluster 1, H1c ACTA2 1.11E-03 -2.32 0.00526628 0.2427869 actin, alpha 2, smooth muscle, aorta SULF2 4.31E-03 -2.41 0.00041907 0.36088259 sulfatase 2 DPY19L2 2.56E-03 -2.41 8.5318E-06 -0.4662302 dpy-19 like 2 TSPAN18 9.02E-05 -2.44 0.00017347 0.42449586 tetraspanin 18 ANXA1 1.72E-03 -2.56 1.7266E-10 1.81408862 annexin A1 SMPDL3B 2.92E-03 -2.59 0.00014296 -0.6188358 sphingomyelin phosphodiesterase acid like 3B PKP4 6.88E-04 -2.62 0.00152317 0.35141575 plakophilin 4 NTS 2.82E-05 -2.63 3.741E-10 -2.3822607 neurotensin CDC42EP5 8.58E-05 -2.7 7.3045E-08 0.86518925 CDC42 effector protein 5 SNX25 4.05E-03 -2.75 0.00016026 -0.3782146 sorting nexin 25 RCN1 4.00E-06 -2.77 0.00184034 0.37378544 reticulocalbin 1 MCOLN3 3.78E-05 -2.8 7.355E-05 -0.4363948 mucolipin 3 PCDH7 4.04E-04 -2.83 1.3955E-05 -1.1470571 protocadherin 7 ZNF518B 7.07E-03 -2.99 0.00076756 0.37536821 zinc finger protein 518B ENPP5 4.81E-04 -3.5 6.1677E-06 -0.5712181 ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative) ITPR3 7.61E-06 -3.61 1.4484E-06 -0.9986967 inositol 1,4,5-trisphosphate receptor type 3 ELOVL4 8.48E-05 -3.69 0.00056815 -0.4320442 ELOVL fatty acid elongase 4 MARK1 1.88E-03 -4.04 0.00242668 -0.2543125 microtubule affinity regulating kinase 1 GJA1 2.99E-07 -5.12 0.00287117 0.50891284 gap junction protein alpha 1 MAP7 8.04E-04 -5.39 9.2195E-06 -0.8562221 microtubule associated protein 7 Genes differentially regulated in microarray (affymetrix) data of Norwalk replicon-harbouring Huh- 7 (HG23) cells, deposited in NCBI’s Gene Expression Omnibus (GEO series accession number GSE15520) (Chang, 2009) compared to differentially regulated genes in HGT-NV cells in this study. 75 Chapter 4 Interferon-mediated restriction of human norovirus replication requires Hsp90 activity 76 Background Molecular chaperones are proteins that are involved in ATP-dependent protein folding, maintenance and homeostasis (Frydman 2001; Taipale et al. 2010; Young et al. 2004). They also regulate many other pathways in cells, including protein degradation (Taipale et al. 2010). Heat shock proteins (Hsp) are a family of molecular chaperones conserved across many different organisms, made up of proteins that are so named according to the size of each protein—Hsp40, Hsp70, Hsp90, Hsp105, and so on. The Hsp90 protein is the most extensively studied among the Hsp family. This highly abundant protein has two isoforms present in the cytoplasm, Hsp90α and Hsp90β, which are stress-induced and constitutively expressed, respectively (Chen et al. 2005). Glucose-regulated protein 94 (grp94) is an Hsp90 homolog found in the endoplasmic reticulum (Marzec et al. 2012) and TRAP1 (also Hsp75) is a Hsp90 orthologue in the mitochondria (Chen et al. 1996; Kang 2012). Hsp90 functions in combination with other proteins known as co-chaperones. It recognizes partially folded proteins from co-chaperone proteins such as Cdc37 and the Hsp70 chaperone system. Numerous proteins interact with Hsp90 through these different co-chaperones, defining Hsp90’s client specificity (Geller et al. 2012). The function of Hsp90 is not limited to protein folding, unfolding and maintenance. It has been shown to participate in protein degradation through its interaction with CHIP (Dickey et al. 2008; Murata et al. 2003). Hsp90 chaperones numerous proteins involved in signal transduction and tumorigenesis, (Sharp et al. 2014; Workman 2004), making it a therapeutic target for many cancers and leading to the development of several pharmacological inhibitors. These inhibitors are classified based on the site on the Hsp90 they bind. First is the N-terminal ATP/ADP binding domain competitors which include geldanamycin, 77 radicicol, the geldanamycin derivatives 17-allyl-17-demethoxygeldanamycin (17-AAG) and 17-desmethoxy-17-N,N-dimethylaminoethylaminogeldanamycin (17-DMAG) (Jhaveri et al. 2012), and ganetespib (Modi and Jhaveri 2015; Ying et al. 2012). There are also the C-terminal ATP-binding domain inhibitors which include novobiocin and coumermycin (Marcu et al. 2000a; Marcu et al. 2000b; Yun et al. 2004). In addition to their consideration in cancer therapeutics, these inhibitors have been used to investigate the role of Hsp90 in other cellular pathways and host-pathogen interactions (Geller et al. 2012; Nagy et al. 2011). RNA viruses utilize host factors in their life cycle, including regulation of the host translational and transcriptional landscape (Vidalain and Tangy 2010). These events may require that the virus utilizes the activity of host chaperones to ensure proper folding or misfolding of host proteins which creates a favourable environment for translation and replication (Geller et al. 2012; Nagy et al. 2011). Also, RNA viruses have small genomes that encode only a few but complex proteins with multiple functions. This sophistication suggests that viral protein homeostasis is regulated, hence, their dependence on Hsp90 (Geller et al. 2007; 2012). Third, viral capsids are exposed to adverse conditions of chemicals and temperatures in their hosts. However, infectivity must be maintained by protecting the capsid protein (Rossmann 1984). This may prompt the need for their dependence on Hsp90. Lastly, adaptation of an RNA virus in host cells can be a high-risk event, with increased mutation rates leading to the production of mutant viral proteins that can negatively impact the virus and render it incapable of withstanding adverse conditions (Crowder and Kirkegaard 2005). Since mutations in this group of viruses are inevitable, mutant proteins produced may require the activity of Hsp90 to buffer the negative effect that the protein may have on the virus (Pfeiffer and Kirkegaard 2005). 78 Our lab has previously shown that the major capsid proteins (VP1) of both MNV and HuNoV interact with Hsp90 to maintain their integrity and in MNV, inhibition or knockdown of Hsp90 negatively impacted virus replication and infectious virus production (Vashist et al. 2015). Specifically, Hsp90 was required for MNV replication at the post-entry step since pre-treatment of MNV-1 stocks with the Hsp90 inhibitor, 17-DMAG, prior to inoculation onto cells did not have any effect on virus titres. Although the interaction with HuNoV VP1 suggests a role for Hsp90 in the HuNoV life cycle, no evidence suggesting its effect on virus replication and production was reported. This lack of information was partly due to the unavailability of a cell culture system or small animal model to study the HuNoV in the past. Currently, an unpublished data produced by Dr. Myra Hosmillo in our lab demonstrated that treatment of the newly established human intestinal organoid with 17-DMAG reduced GII.4 HuNoV replication. In this chapter, we show that inhibiting Hsp90 with small molecule inhibitors increased HuNoV replication in replicon-containing cells. We identified Hsp90 as required for the induction of IFN and ISGs in virus-replicating cells. Mechanistically, we show that Hsp90 inhibition led to the degradation of several key proteins in IFN induction and signaling pathways leading to a compromise in the antiviral state in the cells. Results 4.1. Hsp90 restricts HuNoV replication. Previous data from our lab showed that Hsp90 interacts with the MNV genome and that small molecule-mediated inhibition or siRNA-mediated knockdown of Hsp90 led to the destabilization of the major viral capsid protein (VP1), subsequently leading to a significant decrease in virus replication (Vashist et al. 2015). In the same study, inhibition of Hsp90 activity with 17-DMAG, a small molecule inhibitor of Hsp90, 79 resulted in the degradation of the HuNoV VP1 but the effect of this on HuNoV life cycle was not determined. To examine the role of Hsp90 in the HuNoV life cycle, I examined the impact of small molecule inhibition of Hsp90 using the human norovirus replicon system. To this end HGT-NV cells were incubated with different concentrations of Hsp90 inhibitors for 72 h. A significant increase in viral mRNA levels were observed in the cells incubated with 17-DMAG, ganetespib, and 17-AAG, compared to DMSO control, in a dose- dependent manner (Fig. 4.1A). Ruxolitinib (RUX) which is a pan-JAK inhibitor (Mascarenhas et al. 2012) and the viral RNA polymerase inhibitor 2′-C-methylcytidine (2-CMC) (Rocha-Pereira et al. 2012; 2013; 2015) were used as positive and negative controls for replication, respectively. We also analyzed the impact of Hsp90 inhibitors on protein levels and we observed a significant increase in HuNoV proteins (Fig. 4.1B). Akt, a known client protein of Hsp90 (Majumder and Sellers 2005; Sato et al. 2000; Theodoraki et al. 2007), was used as a positive control for Hsp90 inhibition in this study. To exclude cell line- and genotype-specificity in our observation, we used HuNoV GI replicon-harboring baby hamster kidney cells (BHK-NV GI.1). BHK-NV GI.1 cells were incubated with increasing concentrations of ganetespib for 72 h and viral mRNA levels were measured. A dose-dependent increase in viral mRNA was observed in the cells (Fig. 4.1C). Overall, the data suggest that Hsp90 activity elicits an antiviral role against HuNoV in vitro. 80 Figure 4.1. Hsp90 restricts HuNoV replication. (A) HGT-NV cells were incubated in the presence of various inhibitors of Hsp90 at the indicated concentrations for 72 hours. 2-CMC and Rux were included as negative and positive controls, respectively. After the incubation, cells were harvested for total RNA extraction and measurement of viral mRNA level by RT-qPCR. Relative gene expression normalized to β-actin was determined from at least three independent experiments performed in biological triplicates and compared to the expression levels measured in DMSO-treated cells. Statistical significance was determined using the unpaired t-test. Error bars represent the standard error of the mean. (B) Whole cell lysates from HGT-NV cells treated with various inhibitors were subjected to protein quantification by western blotting. GAPDH was included as loading control. (C) GI.1 HuNoV replicon harboring-BHK cells were incubated in the presence of increasing concentration of ganetespib for 72 h, followed by RNA extraction and measurement of viral RNA levels. Relative viral RNA level was determined from two independent experiments performed in biological triplicates. The error bars represent standard error of the mean. 81 4.2. Hsp90 is required for robust induction of ISGs in HuNoV replication. From our previous chapter, an enhanced replication of HuNoV in replicon-harboring cured HGT cells (HGT-Cured) was reported. We further observed from transcriptomics analysis that several genes including IL28RA, which is important in type III IFN signaling, is downregulated in HGT-NV and HGT-Cured cells compared to wildtype HGT cells. Finally, we reported a differential regulation of some ISGs in HGT-NV and HGT-Cured cells compared to HGT cells. Taken together, we reasoned that the increased level of viral RNA we observed in HGT-NV cells following treatment with Hsp90 inhibitors (Fig. 4.1A-B) was potentially due to a direct effect of the Hsp90 inhibitors on those ISGs such as IFIT1 and IFIT2 which are upregulated in the HGT- NV cells. Upon viral infection of a cell, a cascade of events leading to the establishment of an antiviral state is activated. Among these events is the interferon-mediated induction of ISGs, some of which have direct or indirect antiviral activities on the invading virus. Noroviruses are considerably responsive to interferons (Baldridge et al. 2016). Existing data suggests that in the context of Sendai virus infection, Hsp90 is required to induce an interferon response, and that small molecule-mediated inhibition of Hsp90 activity downregulated ISG expression (Yang et al. 2006). To this end, we examined the impact of Hsp90 inhibition on the induction of ISGs in HGT-NV cells. Ruxolitinib was added as a control for inhibition of ISG induction as it inhibits JAK/STAT signaling (Mascarenhas et al. 2012). As expected, we found that inhibiting Hsp90 activity with ganetespib stimulated viral replication (Fig. 4.2A) and that this was accompanied by a significantly reduced ISG induction (Fig. 4.2B-F). In contrast, there was an increase in the induction of the proinflammatory cytokine IL6 when cells were treated with ganetespib (Fig. 4.2G). 82 Figure 4.2. Hsp90 is required for robust induction of ISGs in HuNoV replication. HGT-NV cells were incubated in the presence or absence of ganetespib (0.5µM) or ruxolitinib (20µM) for 48 h, followed by total RNA extraction and the levels of viral RNA (A), ISGs (B-F) and the pro-inflammatory cytokine IL6 (G) were measured by RT- qPCR. Gene expression relative to β-actin was determined from experiments performed in biological triplicates and compared to the expression levels measured in DMSO-treated cells. Error bars represent standard error of the mean. (H) Mock- or ganetespib-treated HGT-NV cells were harvested after 48 h of incubation and whole cell protein lysate were extracted for the determination of various protein levels by western blotting. Alpha-tubulin was included as loading control. A B D E F Fo ld c ha ng e DM SO Ga ne tes bip Ru xo liti nib 0 2 4 6 8 10 ** ** HuNoV Fo ld c ha ng e DM SO Ga ne tes bip Ru xo liti nib 0.0 0.5 1.0 1.5 *** * ns Viperin Fo ld c ha ng e DM SO Ga ne tes bip Ru xo liti nib 0.0 0.5 1.0 1.5 ** ns MDA5 Fo ld c ha ng e DM SO Ga ne tes bip Ru xo liti nib 0.0 0.5 1.0 1.5 **** ns IFIT1 Fo ld c ha ng e DM SO Ga ne tes bip Ru xo liti nib 0.0 0.5 1.0 1.5 *** * *** ISG15 Fo ld c ha ng e DM SO Ga ne tes bip Ru xo liti nib 0.0 0.5 1.0 1.5 **** * IFIT2 Fo ld c ha ng e DM SO Ga ne tes bip Ru xo liti nib 0 10 20 30 40 * ** IL6 G H C 50 50 50 50α-Tubulin VIPERIN Akt NS3 Ganetespib kDa+- 83 We also measured viperin protein levels and found that its expression level in the presence or absence of ganetespib was consistent with the mRNA levels (Fig. 4.2H). Taken together, our data suggest that Hsp90 activity is required for the induction of IRF3- and IFN-dependent genes in HuNoV replicon-containing cells but not NFκB- dependent genes. 4.3. Hsp90 inhibition impairs the induction of IFN in human norovirus replicon harbouring cells. To further dissect the mechanism involved in the inhibition of ISG expression following ganetespib treatment, we examine the impact of Hsp90 on IFN induction in HGT-NV cells. It has been established that active replication of HuNoV RNA induces the expression of IFN and ISGs (Arthur et al. 2019; Van Dycke et al. 2019). From our current data, we observed that in the presence of ganetespib, HuNoV RNA levels was increased (Figs. 4.1A and 4.3A) while IFNβ and IFNλ RNA levels were decreased (Fig. 4.3B-C). To exclude the possibility of a HuNoV replication-specific effect on role of Hsp90 on the induction of IFN genes, we examined the impact of Hsp90 inhibition on Poly (I:C)-mediated induction of IFN and ISGs in wildtype HGT cells. A striking reduction in IFNβ and IFNλ expression was observed in ganetespib-treated cells compared to DMSO-treated cells (Fig. 4.3D-E). Also, ISG expression was reduced (Fig. 4.3F-G), consistent with the reduction in IFN level. The data collectively suggests that Hsp90 activity is required for IFN induction in cells permissive for HuNoV replication. 84 Figure 4.3. Hsp90 inhibition impairs the induction of IFN in human norovirus replicon harbouring cells. HGT-NV cells incubated in the presence or absence of 0.5µM ganetespib for 48 hours were harvested and total RNA was extracted and the levels of viral (A), IFNβ (B) and IFN-λ2 (C) mRNA were measured by RT-qPCR. Relative gene expression normalized to β-actin was determined from experiments performed in biological triplicates and compared to the expression levels measured in DMSO-treated cells. Error bars represent standard error of the mean. Wildtype HGT- Cells were pre-incubated in serum-free cell culture medium supplemented with or without 0.5µM ganetespib for 48 h and transfected with different concentrations of poly(I:C). Cells were harvested 6 h post-transfection and total RNA was extracted. The mRNA expression levels of IFNs (D-E) and ISGs (F-G) were determined by RT-qPCR. Data is represented as fold change relative to mock transfected and error bars represent standard error of the mean from two independent experiments. D E F G IFNλ2 Poly I:C (mg/mL) Fo ld c ha ng e 0 0.1 1 10 0 200 400 600 DMSO Ganetesbip IFNβ Poly I:C (mg/mL) Fo ld c ha ng e 0 0.1 1 10 0 10 20 30 40 Ganetesbip DMSO Viperin Poly I:C (mg/mL) Fo ld c ha ng e 0 0.1 1 10 0 20 40 60 DMSO Ganetesbip MDA5 Poly I:C (mg/mL) Fo ld c ha ng e 0 0.1 1 10 0 200 400 600 DMSO Ganetesbip A B C HuNoV Fo ld c ha ng e DM SO Ga ne tes pib 0 2 4 6 8 **** IFNβ R el at iv e ex pr es si on to β -a ct in DM SO Ga ne tes pib 0.0 0.5 1.0 1.5 ** IFNλ R el at iv e ex pr es si on to β -a ct in DM SO Ga ne tes pib 0.0 0.5 1.0 1.5 ** 85 4.4. Hsp90 inhibition abrogates JAK/STAT signaling in human norovirus replicon-harbouring cells. Next, we examined the effect of inhibiting Hsp90 activity on IFN signaling through the JAK/STAT pathway. Existing data suggests that the JAK/STAT signaling pathway restricts norovirus replication in intestinal epithelial cells (Hosmillo et al. 2020). HGT- NV cells were incubated in the presence or absence of ganetespib for 48h, followed Figure 4.4. Hsp90 inhibition abrogates JAK/STAT signaling in human norovirus replicon harbouring cells. (A-C) HGT-NV cells were incubated in the presence of 0.5µM ganetespib or DMSO control for 48h, followed by treatment of cells with or without 1000U/ml IFNα. After 18 h post treatment with IFNα, cells were harvested for total RNA extraction and HuNoV, viperin and MDA5 mRNA levels were measured by RT-qPCR. Relative gene expression normalized to β-actin was determined from experiments performed in biological triplicates. Error bars represent standard error of the mean. (D) HGT-NV cells incubated with 0.5µM ganetespib or DMSO control for 48h and treated with or without 1000U/ml IFNα for 18 h were harvested and lysed for protein extraction. Proteins of various interferon stimulated genes were analysed by western blotting. Alpha-tubulin was included as loading control. A B C D Viperin Fo ld ch an ge DMSO Ganetespib 0 2 4 6 8 -IFNa +IFNa*** ns HuNoV Fo ld ch an ge DMSO Ganetespib 0.0 0.5 1.0 1.5 -IFNa +IFNa ** ns MDA5 Fo ld ch an ge DMSO Ganetespib 0.0 0.5 1.0 1.5 2.0 * ns -IFNa +IFNa 86 by incubation with or without recombinant IFNα for an additional 18h. In the absence of ganetespib, INFα reduced HuNoV replication by approximately 40% but there was no effect in the presence of ganetespib (Fig. 4.4A). Ganetespib inhibited IFNα- mediated induction of viperin and MDA5 (Fig. 4.4B-C). Further, STAT1 phosphorylation and ISG protein levels were measured following IFNα-treatment in cells incubated in the presence or absence of ganetespib. Figure 4.4D shows that phosphorylation of STAT1 and the protein expression of ISGs were inhibited by ganetespib in the presence or absence of IFNα treatment. Overall, our data suggests that Hsp90 activity is required for the establishment of an antiviral state during HuNoV replication. 4.5. Hsp90 is required for the stabilization of key proteins in the IFN response pathway. The list of Hsp90 clientele includes several components of the IFN response pathway. This includes kinases and transcription factors (detailed list of Hsp90 client proteins can be accessed at https://www.picard.ch/downloads/Hsp90facts.pdf). To examine the effect of inhibition of Hsp90 on the stability of key components of the IFN response pathway, we measured the levels of proteins upstream of IFN production such as MAVS, TBK1, IRF3 and NFκB. We also measured proteins that are downstream of IFN production, including Tyk2, STAT1 and STAT2. To this end, HGT cells incubated with ganetespib were subjected to protein analysis by western blotting. MDA5 was affected by ganetespib, consistent with Fig.4.4D as it is an ISG. While MAVS was not affected by Hsp90 inhibition, TBK1 was downregulated, consistent with previous studies which show that Hsp90 inhibition leads to the degradation of TBK1 (Liu et al. 2018; Yang et al. 2006). The phosphorylation of IRF3 by activated TBK in the context of virus infection was also shown to be reduced when Hsp90 was inhibited, but protein 87 levels of IRF3 remain unchanged (Liu et al. 2018; Yang et al. 2006). Conversely, we showed that IRF3 proteins were affected in the presence of ganetespib (Fig. 4.5A). Since IL-6 expression was not affected by Hsp90 inhibition (Fig.4.2G), it was likely that the NFκB pathway is not dependent on Hsp90 activity. Consistent with this, inhibition of Hsp90 with ganetespib did not affect NFκB expression. It was previously shown that whereas phosphorylation of STAT1 was affected when Hodgkin’s lymphoma cells were treated with Hsp90 inhibitors, STAT1 protein expression was not affected (Schoof et al. 2009). However, in our hands, the endogenous expression of STAT1 was affected by Hsp90 inhibition in the Figure 4.5. Hsp90 stabilizes proteins in the IFN response pathway. A) HGT-NV cells were incubated with 0.5µM ganetespib or DMSO control for 18 h. The cells were harvested and lysed for protein extraction and analysis by western blotting. Alpha- tubulin was included as loading control. B) Simplified annotation of the IFN response pathway showing Hsp90 clients (circled in red) and ISGs which are also reliant on Hsp90 activity (green arrows). HGT-NV cells (Fig. 4.5A). Tyk2 and STAT2 expressions were also affected by Hsp90 inhibition. Fig.4.5B, simplifies the IFN-mediated antiviral response pathways, showing the clients of Hsp90 highlighted in red circles. Components that are also ISGs and were shown to be affected by Hsp90 in this study are marked in green arrows. Taking 100 75 50 75 50 50 75 kDa α-Tubulin Akt STAT1 STAT2 NF-κB IRF3 TBK1 Ganetespib - + MAVS MDA5 75 50 150Tyk2 RIG-I / MDA5 MAVS NFkB TBK1/IKKε IRF3/7 IRF3/7NFkB IFN mRNA STAT1/2 ISGF3 IKKα/β/γ IFN α/β IFN λ IF N AR TYK2/JAK1 IF N LR JAK1/2 IRF9 STAT1/2 ISGF3 ISG mRNA ISRE Nucleus Nucleus Cytosol IFN λIFN α/β Cytosol Virus Viral RNA A B 88 together, the data here suggest that the key components of IRF3-dependent IFN induction and JAK/STAT signaling rely on Hsp90 activity for their stability, so that inhibition of Hsp90 compromises the innate antiviral response. Discussion In this present study, the HuNoV replicon system in HGT cells was used to investigate the role of Hsp90 in HuNoV replication. To do this, we examined the impact of small molecule-mediated inhibition of Hsp90 activity in HGT-NV cells and found that inhibition of Hsp90 significantly increased virus replication. In order to assess the ability of the inhibitors to affect replication under the conditions used, we added molecules that have been previously shown to increase or decrease replication. The data suggested that since our Hsp90 inhibitors specifically blocked the ATP-binding site in the N-terminal domain of Hsp90, the function of this domain is not a requirement for HuNoV replication. A previous study in our group showed that Hsp90 inhibition by small molecule inhibitors or knockdown using siRNA resulted in the degradation of MNV proteins and reduced virus production (Vashist et al. 2015). Additional data from the same study suggested that HuNoV capsid protein VP1 required Hsp90 for its stability since inhibition of Hsp90 led to the degradation of VP1; the exact mechanism was not shown (Vashist et al. 2015). Despite this data showing the requirement of Hsp90 for VP1 stability, there was no evidence for the role of Hsp90 in HuNoV genome replication. The difference in the two systems, MNV and HuNoV replicon, is that the former is an infectious system which relies on VP1 capsid protein and the latter is a non-infectious model where the VP1 protein is not required for genome replication. As described in the previous chapter, the norovirus VP1 sequence interacts with RdRp to initiate the 89 de novo synthesis of virus replication to produce the negative sense RNA (Thorne and Goodfellow 2014). Inhibiting Hsp90 degrades VP1 which has some impact on viral RNA synthesis and massively affects viral infectivity as very little infectious virus particles is produced in the case of MNV. On the contrary, in the replicon system, intact VP1 is not present and therefore has no specific effect on the innate response in the cells. Inhibiting Hsp90 means degradation of VP1 which affects MNV genome replication but not the replication of the HuNoV replicon. Our present study is in line with a more recent study which aimed at developing an anti-HuNoV drug (Harmalkar et al. 2019). It was shown that an amide derivative of vinyl stilbenes (18k) inhibits HuNoV replication in the replicon-containing huh7 cells (HG23) but not MNV replication (Harmalkar et al. 2019). Mechanistically, the authors reported that 18k significantly activated the heat shock factor 1 (Hsf1)-dependent stress-inducible pathway and nuclear factor erythroid 2-related factor 2-dependent anti-oxidative pathway, the latter showing no significant effect on HuNoV replication. The authors suggested that 18k inhibited HuNoV replication by activating Hsf1 (Harmalkar et al. 2019). Interestingly, the virus polymerase inhibitor 2-CMC, which is known to inhibit HuNoV, was also shown to activate the HSF1-dependent stress- inducible pathway (Harmalkar et al. 2019). Increasing stress levels in a cell leads to the homotrimerization and phosphorylation of Hsf1. Phosphorylated Hsf1 interacts with heat shock elements, leading to the expression of Hsps including Hsp90 (reviewed by Prodromou 2016). We therefore speculate that Hsf1 activation by 18k (and 2-CMC) leads to an increase in Hsp90 expression levels and subsequently resulting in the inhibition of HuNoV replication. 90 Both studies suggesting possible antiviral effect for Hsp90 are based on a replicon system rather than an infection model, hence, it is likely that any antiviral effect of Hsp90 observed is specific to the RNA synthesis step in the replicon. The invasion of a host cell by a virus triggers the innate immune response pathway when the genomic material of the virus is detected by pattern recognition receptors (PRRs). This activates a cascade of events leading to the production of interferons (IFNs). The downstream events include IFNs binding to their receptors and activate the JAK-STAT pathway whose downstream effect is the transcription of interferon- stimulated genes (ISGs). The ISGs directly or indirectly antagonize virus replication and production in the invaded cells and/or neighbouring cells. This rather complex system contains proteins, some of which are known clients of Hsp90. The signaling kinase, TANK binding kinase 1 (TBK1), is central to IFN induction and IRF3 is an important transcription factor in the innate immune response pathway (Kawai and Akira 2006; Thompson et al. 2011). These proteins have been reported as dependent on Hsp90 for their stability and activation, respectively. The inhibition of Hsp90 led to the degradation of TBK1 and inhibited the activation of IRF3 in Sendai virus infected cells (Yang et al. 2006). Inhibition of Hsp90 with 17-AAG or RNA interference in classical Hodgkin lymphoma cells attenuated JAK/STAT activation (Schoof et al. 2009). The IFN response system has been shown to play a vital role in the host defence against noroviruses (Baldridge et al. 2016). The role of Hsp90 in stabilizing HuNoV VP1 seems to be redundant in the HuNoV replicon system, hence, we hypothesized that based on previous data on Hsp90 stabilizing proteins in the IFN response pathway, Hsp90 is required for the IFN response during HuNoV replication. To this end, cells treated with ganetespib showed downregulation of IRF3-dependent genes but not NFκB-dependent genes. Further, our analysis showed that poly (I:C)- 91 mediated activation of the IRF3-pathway, measured by IFN and ISG induction, was debilitated by ganetespib treatment. Lastly, direct effect of Hsp90 on IFN signaling was shown to be negatively impacted by ganetespib, leading to the lack of expression of ISGs and no effect on HuNoV replication. Protein analysis by western blot on key components of IFN induction and signaling was done in the presence or absence of ganetespib. We showed that ganetespib downregulated the expression of TBK1 and IRF3 but not NFκB. Also, Tyk2, STAT1 and STAT3 were all shown to be downregulated following ganetespib treatment of the cells. This suggests a role for Hsp90 in the establishment of an antiviral state during HuNoV replication. In the study by Harmalkar and colleagues (2019), it was shown that Hsf1 activation by 18k reduced feline calicivirus (FCV) production while increasing MNV titres. It is unknown whether FCV VP1 interacts with Hsp90 but existing data show that FCV non- structural protein p39 (NS3) interferes with IRF3-dependent induction of IFNβ genes and the subsequent ISG induction (Yumiketa et al. 2016) as a strategy of antiviral evasion by the virus. In our current system where there is no VP1 expression, Hsp90 may be accessible to client proteins in the innate immune pathway and activate host antiviral response. It is possible that the norovirus VP1 interaction with Hsp90 sequesters the protein and deprive its chaperoning activity on client proteins in the innate immune pathway. This is a possible host antiviral evasion mechanism used by the noroviruses. A similar strategy was demonstrated in herpes simplex virus-1 (HSV- 1). The US11 of HSV-1 was shown to interact with Hsp90, blocking access of TBK1 to Hsp90 and inhibiting phosphorylation of IRF3 and expression of cytokines (Liu et al. 2018). It is therefore entirely possible that in the presence of VP1 in noroviruses, Hsp90 is made unavailable host proteins involved in the IFN response, negatively 92 regulating the innate immune response in the invaded cells. Future studies are required to explore this further. Overall, our data indicate that Hsp90 stabilizes key proteins in the IFN response pathway in that small-molecule inhibition of Hsp90 activity led the degradation of those proteins. This resulted in a compromise of the antiviral state and an increase in HuNoV replication. 93 Chapter 5 Single amino acid substitution in human norovirus NS1/2 confers resistance to COX-1 inhibition-mediated inhibition of replication in vitro 94 Background Within the Caliciviridae family, the importance of COX/PGE2 pathway has been demonstrated for porcine sapovirus (PSaV) Cowden strain, feline calicivirus (FCV) and MNV. First, Alfajaro et al. (2017) reported a significantly elevated level of COX-2 mRNA and protein with a transient expression of COX-1 at later time points during PSaV infection. The authors found that small molecule- or small interfering RNA (siRNA)-mediated inhibition of COX-1 and COX-2 decreased the production of PGE2 and PSaV replication. Further, addition of exogenous PGE2 to infection media containing COX inhibitors reversed the inhibition of COX, leading to an increase in virus replication (Alfajaro et al. 2017). The COX/PGE2 pathway was found to be activated by PSaV non-structural (NS) proteins, VPg and ProPol. Nitric oxide (NO) is a vital component in the host defence mechanism against viruses and other pathogens (Akaike and Maeda 2000). Its production is known to be regulated by PG production (Chen et al. 2000). During PSaV infection, the induction of COX-2 and the resulting increase in PGE2 levels inversely correlated with NO levels in infected cells, suggesting an inhibitory role for COX-2 on NO (Alfajaro et al. 2017). Consistent with the previous observation on PSaV, MNV and FCV infection activated the COX-2/PGE2 pathway (Alfajaro et al. 2018). Inhibiting the different COX isoforms with small molecule inhibitors or siRNA reduced the replication of both viruses. Exogenously adding PGE2 to culture media in an infection partially restored replication of both MNV and FCV (Alfajaro et al. 2018). Taken together, the data suggests that calicivirus- mediated induction of COX results in increased levels of PGE2, inhibiting NOS production. Therefore, inhibition of COX results in NOS-mediated inhibition of calicivirus replication. 95 To examine the COX/PGE2 pathway in the life cycle of other members of the Caliciviridae family, we used the recently described HGT-NV cells (Arthur et al. 2019; Kitano et al. 2018). We found that inhibiting COX-1 activity in the HGT-NV cells with a selective inhibitor, sc-560, decreased viral RNA and protein levels in a dose- dependent manner, consistent with previous observations in PSaV, FCV and MNV infection (Alfajaro et al. 2018; 2017). We further observed that persistent treatment of the replicon-harboring cells with sc-560 led to the generation of a single point mutation in NS1 protein conferring resistance to the drug without affecting virus replication. This study suggests that HuNoV is sensitive to COX-1 and -2 activities and that NS1/2 is a possible target for SC-560. The study also suggest mechanism by which HuNoV can alter its genome to compensate for the loss of activity of a proviral protein. Almost all the work in this chapter was done by Dr. Mitsutaka Kintano. My contribution was to add key data which aided in the conclusion of the work. Data generated by Dr. Kitano are indicated in the figure or table legends. Results 5.1. COX-1 is required for the replication of HuNoV replicon Our lab has previously reported that the Cowden strain of PSaV, MNV and FCV significantly induce the COX/PGE2 pathway upon infection (Alfajaro et al. 2017; 2018). Although FCV and MNV replication significantly increased COX-2 mRNA more than COX-1 mRNA, inhibition of both enzymes with selective or non-selective inhibitors significantly reduced virus replication (Alfajaro et al. 2018). To determine the role of COX/PGE2 in HuNoV replication, we first examined the efficacy of various pharmacological inhibitors of COX-1 and COX-2 to inhibit PGE2 production. It is established that the downstream effects of the COX enzyme activity include the production of PGE2 (Smith et al. 2000). To determine the efficacy of the COX- 96 inhibitors, we measured their ability to reduce the level of PGE2 in HGT cells. To this end, HGT cells were incubated in the presence of COX-1 selective inhibitor (SC-560), COX-2 selective inhibitor (NS-398 or celecoxib) or COX non-selective inhibitor (indomethacin). As expected, all the inhibitors significantly reduced the level of PGE2 in HGT cells compared to the DMSO control (Fig. 5.1A). Following the confirmation that the inhibitors are effective, we incubated HGT-NV cells with the COX inhibitors for the assessment on their effect on HuNoV replication. We observed that the COX-1 selective inhibitor, SC-560, showed a 50% effective concentration (EC50) of 1.64µM and 50% cytotoxic concentration (CC50) of 61.9µM (Table 5.1). COX-2 selective inhibitors, celecoxib and NS-398, showed minimal effect in inhibiting replication with EC50 >20µM (CC50 of 64.5 µM) and >200µM (CC50 of 291.7 µM), respectively (Table 5.1). Similarly, inhibiting COX-1 and -2 simultaneously with indomethacin had a very low effect on virus replication (EC50 >200µM; CC50 =317 µM). These suggest that replication of HuNoV replicons are more sensitive to COX-1 specific inhibition but not the inhibition of COX-2 alone. The data may also suggest that in the HuNoV replicon model, SC-560 has a specific effect on replication which might be independent of COX. Narrowing down on COX-1, we examined the effect of SC-560 on viral protein Table 5.1. Inhibitory effect of COX inhibitors in HuNoV replicon-containing cells Compounds Human norovirus GI replicon cells Human cyclooxygenase* *Reference EC50 (μM) CC50 (μM) SI IC50 (μM) Mean SD Mean SD COX-1 COX-2 Celecoxib 20< NA 64.5 3.6 NA 15 0.04 (Zebardast et al., 2009) NS-398 200< NA 291.7 23 NA 28.9 0.04 (Miralpeix et al. 1997) SC-560 1.64 0.16 61.9 4.8 13< 0.009 6.3 (Smith et al., 1998) Indomethacin 200< NA 317 37 NA 0.05 0.15 (Miralpeix et al. 1997) Rupintrivir 1.24 0.17 100< NA NA EC50 (50% effective concentration); CC50 (50% cytotoxic concentration); IC50 (50% effective concentration); SD (Standard deviation); SI (Selectivity index). Data generated by Dr. Mitsutaka Kitano. 97 Figure 5.1. Small molecule inhibition of COX/PGE2 reduces HuNoV replication. A) HGT cells were incubated in the presence of 50µM SC-560, 100µM NS-398, 50µM celecoxib or 150µM indomethacin, and harvested 48 h post-treatment. Cell culture supernatant was collected for the measurement of PGE2 level by ELISA. PGE2 concentration was determined by interpolating from a standard curve and represented as percentage of PGE2 for each treatment relative to DMSO-treated cells. Statistical significance was determined using the unpaired t test. Error bars represent standard error of the mean from three biological replicates. B) HGT-NV cells were incubated with different doses of SC560 for 72h. Total RNA extraction and determination of HuNoV replicon RNA levels in HGT-NV cells by RT-qPCR were done. The level of replicon RNA in HGT-NV cells treated with SC560 was plotted relative to that in DMSO-treated cells. Error bars represent mean ± standard deviations of three independent experiments (Generated Dr. Kitano). C) Protein analysis by western blot was done on whole cell lysate after 72h post-treatment with SC-560 for the viral protease (NS6) in HGT-NV cells. GAPDH was used as loading control (Generated Dr. Kitano). D) Human intestinal epithelial enteroid cells (D169) infected with GII.3 HuNoV and incubated in the presence of 100µM SC-560. 50µM NS938 and 150µM indomethacin for 48h. The level of viral RNA in the cells was plotted relative to that in DMSO-treated cells. Error bars represent standard error of the mean of three independent experiments (Generated Dr. Myra Hosmillo). % PG E 2 re la tiv e to D M SO DM SO SC 56 0 NS 39 8 CE LE CO XI B IN DO ME TH AC IN 0 40 80 120 **** **** **** **** A B C D DM SO SC -56 0 NS -39 8 IN DO ME TH AC IN 0 40 80 120 % In cr ea se in re pl ic at io n vs D M SO 92% 60% 86% GII.3 in Organoid (D196) 2.50 2010 5 40 SC-560µM NS6 GAPDH 20 15 37 kDa 98 levels in HGT-NV cells. Our observation was that similar to HuNoV RNA reduction, SC-560 significantly reduced HuNoV protein levels in a dose dependent manner (Fig. 5.1B-C). Contrary to the previous studies that reported both enzymes to be important in PSaV, FCV and MNV replication (Alfajaro et al. 2017; 2018), our data suggest that COX-1, but not COX-2, is important for maintaining HuNoV replication in the case of the GI replicon. To eliminate the replicon- and strain-specific effect of COX inhibition on HuNoV, human intestinal organoids were infected with GII.3 HuNoV, treated with the various COX inhibitors. We observed a significant decrease in replication with all the drugs used with SC-560 inhibiting the most (92%) compared to NS-398 and indomethacin (86% and 60%, respectively) (Fig. 5.1D). Taken together, our observations suggest that COX-1 may have a proviral effect on GI HuNoV whereas both COX isoforms have a proviral effect on GII.3 HuNoV. 5.2. PGE2 supplementation abrogates the effect of COX-1 inhibitor on HuNoV replication As stated earlier, the downstream effect of COX-1 enzyme activity includes the production of PGE2 (Smith et al. 2000) and from Fig. 5.1A, inhibition of COX-1/2 reduces PGE2 levels in the replicon-containing cells. We therefore sought to examine whether the inhibition of replication was an effect from the reduction in PGE2. For this, HGT-NV cells were treated with or without 50µM SC-560. After 24 h of incubation, the media was supplemented with or without 5µM or 50µM of PGE2 and incubated for an additional 48 hours (Fig. 5.2A). We observed a significant reduction in replication when the cells were treated with SC-560 alone and this effect was reversed with the addition of exogenous PGE2 (Fig. 5.2B). This is consistent with the previous study which reported that addition of exogenous PGE2 removed the inhibitory effect of the COX 99 inhibitor on PaSV, MNV and FCV replication (Alfajaro et al. 2017; 2018). Interestingly we observed that the exogenous PGE2 further increased HuNoV with or without SC- 560 (Fig. 5.2B), suggesting that PGE2 directly promotes HuNoV replication. Figure 5.2. COX-1-mediated inhibition of HuNoV is reversed by the addition of exogenous PGE2. HGT-NV cells were incubated with SC-560 or DMSO for 24 h and with PGE2 for an additional 48 h. Total RNA was harvested for quantification of HuNoV mRNA levels by RT-qPCR. Error bars represent standard error of the mean from at least three biological repeats. Statistical significance was determined using the unpaired t test. 5.3. Selection of HGT-NV cells with reduced susceptibility to SC-560-mediated inhibition of replication. Next, we examined the importance of COX-1 in maintaining HuNoV replication in HGT- NV cells. To this end, HGT-NV cells were passaged in the presence of SC-560 at different concentrations without G418 selection, followed by an assessment viral mRNA levels after 15 days, and their ability to support cell colonies (Fig. 5.2A). A dose- dependent reduction in viral mRNA in the HGT-NV cells was observed (Fig. 5.2B). An A - + - + 0 1 2 3 Fo ld c ha ng e in H uN oV re pl ic at io n no rm al is ed to β -a ct in SC-560 50µM PGE2 50µM - - + + ** ** ns **** B 0 24 72 ± 50µM SC-560 ± 50µM SC-560 ± 50µM PGE2 Time of Culture (h) 100 additional 5 days of incubation of cells in the presence or absence of G418 was performed to test the ability of the cells to support virus replication by colony formation. In the absence of G418, we observe no reduction in cell numbers with or without SC- 560. However, in the presence of G418, a significant reduction in the number of cell colonies was apparent with 20µM of SC-560 treatment (Fig 5.2C). Despite this reduction, we still observed a few colonies at the highest concentration of the COX-1 inhibitor used. The SC-560-treated remaining HGT-NV cells and HGT-NV cells that were treated with DMSO in parallel were collected and expanded to probe for their susceptibility to SC-560. To this end, SC-560-treated and DMSO-treated HGT-NV cells were incubated with 20µM SC-560 or DMSO and selected with G418 for 20 days, followed by an additional 10 days of incubation with SC-560 without G418 (Fig 5.3D). Cells were either harvested at this time point for RNA extraction and determination of viral mRNA level or cultured for an additional 5 days in G418 before staining for cell colonies (Fig 5.3D). As shown in Fig 3E, we observed that there was no effect of SC- 560 on the viral mRNA levels in the SC-560-treated HGT-NV cells compared to the DMSO-treated cells which showed a significantly reduced viral mRNA levels in a dose- dependent manner. Consistent with the level of viral mRNA (Fig. 5.3F), compared to mock (DMSO) treatment, 20µM SC-560 significantly decreased the number of DMSO- treated HGT-NV cell colonies whereas no significant difference was observed in SC- 560-treated HGT-NV cells. Overall, the data suggest that prolonged treatment of HGT- NV cells in SC-560 lead to the development of resistance to the inhibitor. 101 Figure 5.3. HGT-NV cells develop resistance to SC-560 following repeated treatment with the drug. A) Schematic overview of the experimental procedure used to assess time-dependent inhibition of virus replication by SC-560 in HGT-NV cells. B) Reduction in the GI replicon RNA level over time in HGT-NV cells treated with SC-560 in the absence of G418. The levels of HuNoV replicon RNA relative to those observed A D B E Without G418 With 5, 10 or 20 µM SC-560 With G418 Time of culture (d) 0 15 20 1% 10% 100% 2 4 6 8 10 12 14 16 20 µM 10 µM 5 µM SC-560 (µM) w/o G418 With G418 DMSO 5 10 20 C Time of culture (d) Without G418 With DMSO or SC-560 (20 µM) 0 20 With G418 With DMSO or SC-560 (5, 10, 20 µM) With G418 30 35 0% 20% 40% 60% 80% 100% 120% 140% 20 10 5 DMSO-treated HGT-NV SC560-treated HGT-NV SC-560 (µM) DMSO 5 10 20 SC-560 (µM) DMSO treated HGT-NV SC-560 treated HGT-NV F G I r ep lic on R N A (% o f D M SO c on tro l) G I r ep lic on R N A (% o f D M SO c on tro l) 102 in control DMSO-treated cells were plotted. Error bars represent means ± standard deviations from three biological replicates. C) Colony formation assays with HGT-NV cells treated with DMSO or SC-560 for 15 days. Colonies were stained and photographed on day 5 after treatment with 1.5 mg/ml G418 in the absence of SC- 560. (D) Schematic overview of the experimental procedure used for the repetitive cultivation of HGT-NV cells in the presence of SC-560 or DMSO control. HGT-NV cells were maintained in cultures with DMSO or 5, 10 or 20 μM SC-560 and selected with 1mg/mL G418 and passaged every 2 to 3 days for 20 days. (E) Viral RNA was measured from total RNA extracted from HGT-NV cells treated with SC-560 or DMSO. The level of HuNoV RNA was expressed as percentage of DMSO control. Error bars represent means ± standard deviations from three biological replicates. (F) Colony formation assays with HGT-NV cells treated with DMSO or 5, 10, 20 μM SC-560 for 10 days after 20 days culture. Colonies were stained and photographed on day 5 after treatment with 1.5mg/mL G418 in the absence of SC-560. All data generated by Dr. Kitano. 5.4. Characterization of HGT-NV-based cells. To further assess the source of resistance in SC-560–resistant HGT-NV cells (HGT- NV560R) to the COX-1 inhibitor, we first examined the susceptibility of the cells to rupintrivir by passaging them in the presence of the inhibitor for 20 days without G418 Figure 5.4. Characterization of HGT-NV based cells. A) Schematic overview of the procedure used to examine the efficacy of rupintrivir in inhibiting replication and clearing cell colonies in HGT-NV-based cells. B) HGT-NVDMSO and HGT-NV560R cells were treated with 50µM rupintrivir or DMSO for 20 days without G418. Total RNA was harvested, and viral RNA was quantified by RT-qPCR. Viral RNA levels were determined by comparison to a standard curve and normalized to the input RNA. Error bars represent standard error of the mean form at least three replicates. Colonies were stained and photographed on day 5 after treatment with 1.5mg/ml G418 in the absence of SC-560. Data generated by Dr. Mitsutaka Kitano. BA With G418 With 50 μM Rupintrivir or DMSO Without G418 Time of culture (d) 0 2520 0 1 2 3 4 5 6 7 DMSO 50 μM Rupintrivir DMSO 50 μM Rupintrivir HGT-NV560RHGT-NVDMSO Vi ru s ge no m e eq ui va le nt (L og 10 c op ie s/ m L) 103 and harvested the cells for total RNA extraction and determination of viral mRNA level, or continued selection in G418 in the absence of rupintrivir for an additional 5 days followed by staining for cell colonies (Fig. 5.4A). As observed in Fig. 5.4B, rupintrivir completely reduced viral RNA in both HGT-NVDMSO and HGT-NV560R to levels below the limit of detection after 20 days, corresponding to the total clearance of the cell colonies after 25 days. This result confirmed that the replicon remained susceptible to a known inhibitor. 5.5. Resistance of HGT-NV cells to SC-560 is conferred by the viral genome. Next, we examined whether the resistance to SC-560 observed in both HGT-NV560R was due to adaptation of the cells or changes in the viral RNA sequence. To do this, HGT-NV560R and HGT-NVDMSO cells were cured with rupintrivir as described previously (Kitano et al. 2018). Briefly, cells were passage for 2 to 3 days in media containing rupintrivir for up to 20 days. Following curing, VPg-linked RNA extracted from either HGT-NVDMSO or HGT-NV560R cells were re-transfected into the cured cells (Fig. 5.5A). Cells transfected with VPg-linked RNA were passaged in the presence of 20µM and 40µM SC-560 or DMSO control for 10 days, followed by an additional 5 days in the presence of G418 only and staining for colonies (Fig. 5.5B). Fig. 5.5C is a control experiment showing the reduced susceptibility of HGT-NV560R cells compared to HGT- NVDMSO at both concentrations of SC-560. A reduced susceptibility of the COX-1 inhibitor in HGT-NVDMSO cured cells was observed when the cells were re- transfected with VPg-linked RNA derived from HGT-NV560R compared to HGT-NVDMSO cured re- transfected with VPg-linked RNA derived from HGT-NVDMSO cells (Fig. 5.5D). The observation with HGT-NVDMSO was consistent with that of the HGT-NV560R cured cells which were increased in susceptibility upon transfection with VPg-linked RNA from 104 Figure 5.5. HuNoV replicon is responsible for resistance to SC-560 in HGT-NV cells. A) Schematic overview of the procedure used for identification of causes of low susceptibility to SC-560. HGT-NVDMSO and HGT-NV560R, cells were cultured in the presence of 50 μM rupintrivir and passaged every 2 to 3 days for 20 days. After obtaining rupintrivir-cured HGT-NV cells, these cells were transfected with VPg-linked RNA derived from HGT-NVDMSO and HGT-NV560R and then cultured for colony formation assays B) Schematic overview of the procedure used to determine the source of resistance to SC-560 in HGT-NV-derived cells. C) HGT-NVDMSO and HGT- NV560R cells were incubated with DMSO, 20µM or 40 µM SC-560 for 10 days. D) HGT- NVDMSO and HGT-NV560R cells were transfected with VPg-linked RNA derived from HGT-NVDMSO or HGT-NV560R cells and incubated in the presence of DMSO, 20 μM or 40 μM SC560 for 10 days. All colonies were stained and photographed on day 5 after treatment with 1.5mg/ml G418 and in the absence of SC560. Data generated by Dr. Mitsutaka Kitano. HGT-NVDMSO Cured cell HGT-NV560RHGT-NV560RHGT-NVDMSO HGT-NVDMSOVPg-linked RNA DMSO 20µM SC-560 40µM SC-560 HGT-NVDMSO HGT-NV560R Cured cell DMSO 20µM SC-560 40µM SC-560 HGT-NV560R AAA AAAAAA AAA AAA AAA HGT-NVDMSO HGT-NVDMSO Cured VPg-linked RNA transfection Derived from HGT-NVDMSO HGT-NV560R HGT-NV560R Cured Derived from HGT-NV560RHuNoV replicon cured with rupintrivir Time of Culture (d) Without G418 With 20 or 40 µM SC-560 or DMSO With G418 0 10 15 VPg-linked RNA transfection A B C D 105 HGT-NVDMSO and reduced in susceptibility transfected with VPg-linked RNA from HGT-NV560R (Fig. 5.5D). Taken together, the data suggest that the reduced susceptibility observed in the HGT-NV560R cured cells to SC-560-mediated inhibition of viral replication is conferred by the viral RNA, likely through sequence changes that affect the viral proteins involved in the interaction with COX-1. 5.6. Resistance to SC-560-medaited inhibition of replication is due to mutation the virus nonstructural protein NS1/2. We previously reported that a single mutation in the norovirus protease, NS6 lead to the development of rupintrivir-resistant HGT-NV cell (Kitano et al. 2018). Here, we hypothesized that the generation of resistance to SC-560 conferred by the viral RNA replicon is due to mutations in the RNA. To examine this, we extracted total RNA from HGT-NVDMSO and HGT-NV560R and processed for sequencing. Our sequence analysis showed several silent mutations and an amino acid substitution of threonine 229 to alanine (T229A) in the NS1/2 region of the polyprotein (Fig 5.6A). More specifically, the T229A mutation occurred within the NS2 domain. From our comparison of the sequence in GI replicon from HGT-NV560R and other genogroups and genotypes of norovirus we observed that the amino acid sequence of NS1/2 is conserved between them (Fig. 5.6A). To test for the effect of the single amino acid substitution in response to COX-1 inhibition, a recombinant viral RNA carrying the T229A mutation in the NS1/2 (pNV101NS1/2T229A) was generated. The recombinant RNA or wildtype RNA (pNV101) were transfected in HGT-Cured cells and selected with G418 for up to 6 days, and in the presence of 20µM SC-560. At days 0 and 6 post-selection and treatment, cells were harvested, and RNA was extracted for viral mRNA quantification. We observed a very signification increase in pNV101NS1/2T229A replication compared 106 to the pNV101 RNA (Fig. 5.6B), suggesting a reduced susceptibility of the mutant- containing replicon RNA to SC-560. Figure 5.6. Single amino acid change in the HuNoV replicon confers resistance to SC-560-mediated inhibition of replication. A) HuNoV genome organization showing NS1/2 sequences of G1.1 replicon RNA derived from HGT-NV560R (highlighted) compared with other norovirus genogroups. Single amino acid substitution T229A is indicated with red arrow. (Insert) Other silent mutations identified in the NS1/2 sequence of the replicon RNA derived from HGT-NV560R are indicated in the table. B) HGT-Cured cells were transfected with wildtype replicon RNA (pNV101WT) or recombinant RNA replicon carrying the T299A mutation in NS1/2 (pNV101NS1/2T229A). The cells were incubated with 20µM SC-560 and selected with 0.5mg/ml G418 for up to 6 days. Cells were harvested at day 0 and day 6 post- selection for total RNA extraction. Viral RNA was quantified by RT-qPCR and HuNoV replication levels were expressed as differences of cycle threshold (CT) of HuNoV from the CT of beta-actin. The error bars represent standard error of the mean from two independent experiments. Statistical significance was determined using the unpaired t test. Only sequence analysis was done by Dr. Mitsutaka Kitano. Silent Mutation Amino Acid Mutation A979T A689G (T229A) A1123G T1390C T2425C G3667A A C Fo ld c ha ng e in v ira l R N A ge no m e eq ui va le nt re la tiv e to d ay 0 pNV101WT pNV101NS1/2T229A 0 3 6 9 12 Day 0 Day 6 *** * NS1-2 NS3 NS4 NS5 NS6 NS7 VP2VP1 AAAVPg Time of Culture (d) With G418 With 20 µM SC-560 No selection 0 1 6 VPg-linked RNA transfection B 107 Discussion Our findings in this study suggest that HuNoV replication requires the COX/PGE2 pathway. We observed that different genogroups of HuNoV possibly differ in their requirements of this pathway. HuNoV GI RNA replication decreased significantly upon inhibition of COX-1 but not COX-2 in replicon-harboring cells (table 5.1). However, in the intestinal enteriod cells infected with GII.3 HuNoV, we observed a significant reduction in viral RNA replication with inhibition of both COX isoforms, although COX- 1 inhibition resulted in 6% reduction in replication more than COX-2 inhibition (Fig. 5.1D). The difference observed may be as a result of the different systems used. In the replicon system, there is an already established replication prior to the addition of the drug. In this, replication complexes are formed, and viral RNA is already present relatively high levels in the cells. The organoid system is different in that the virus need to enter the cell, uncoat and release the RNA before replication will start. Moreover, organoids are primary cells whereas the replicon system is in a cancerous cell. The observation that inhibition of COX-2 does not affect replication in the replicon system suggests that the enzyme may be required during the early stages in the virus life cycle, probably at the entry, uncoating and replication complex formation stages. COX-1 inhibition affected replication in both systems, suggesting that the enzyme may play roles in stages ranging from virus entry to exit. Additional experiments will be required to elucidate the exact mechanism of action of these enzymes in both systems. The requirements for MNV, FCV and PSaV differ from that of HuNoV. COX-1 induction was less than COX-2 upon MNV and FCV replication but inhibition of both isoforms inhibited replication (Alfajaro et al. 2018). Contrary to this, we observed that inhibiting COX-1 alone with SC-560, but not COX-2 specifically with NS-398 or celecoxib, reduced the level of replication of GI HuNoV replicon. Our result is consistent with 108 studies in influenza virus (IAV) which reported that in an infection of mice with influenza A virus (IAV), SC-560 treatment reduced the rate of survival of the mice compared to control or celecoxib treatment (Carey et al. 2005). The authors added that in the infected mice, whereas COX-2 deficiency was beneficial, COX-1 deficiency was detrimental (Carey et al. 2005). Some members of several other virus families such as Adenoviridae, Arteriviridae, Caliciviridae, Flaviviridae Herpesviridae, Orthomyxoviridae, Picornaviridae, Rhabdoviridae, Retroviridae and Paramyxoviridae have also been reported to induce the COX/PGE2 pathway to produce PGE2 (Bi et al. 2014; Chen et al. 2000; Lin et al. 2015; Tung et al. 2010a; Tung et al. 2010b; Wang et al. 2015; Zhu et al. 2002). These observations are consistent with the idea that the COX/PGE2 pathway has differential effects on the outcomes of virus infections. That is, the pathway may be proviral or antiviral depending on the virus under study. For example, the pathways was reported to be proviral in cytomegalovirus, vesicular stomatitis virus, dengue virus, herpes simplex virus 1 and H5N1 virus (Chen et al. 2000; Khyatti and Menezes 1990; Lee et al. 2011; Lin et al. 2017; Rott et al. 2003; Zhu et al. 2002). In the case of other viruses such as hepatitis B virus, human adenovirus, measles virus, parainfluenza 3 virus and HIV-1, the COX/PGE2 was reported to have an antiviral effect (Hyman et al. 1999; Ongrádi et al. 1994; Dore-Duffy 1982; Flowers et al. 1994; Luczak et al. 1975; Hayes et al. 2002). Therefore, our observation that inhibition of only COX-1 decreased replication of the GI HuNoV replicon and inhibition of only COX-2 had a very minimal to no effect (Table 5.1) suggests a proviral activity for COX-1 and a marginal antiviral activity for COX-2 inhibitors on GI HuNoV. Consistent with the previous studies on other caliciviruses (Alfajaro et al. 2017; 2018), addition of exogenous PGE2 abrogated the effect of COX inhibitors on HuNoV 109 replication in HGT-NV cells. Interestingly, adding PGE2 slightly increased HuNoV genome replication in the absence or presence of SC-560, compared to mock PGE2 treatment. On the contrary, exogenous addition of the same amount of PGE2 only partially restored FCV or MNV infection in the presence of NS-398 or indomethacin. It is possible, therefore, that the antiviral effect of SC-560 through the reduction of PGE2 production is reversible whereas the effects of NS-398 and indomethacin are not, although these are observations carried out on related but still different viruses. The reversibility may also be explained by the fact that SC-560 inhibits COX-1 which is constitutively expressed whereas NS-398 inhibits the inducible COX-2. Our replicon system recapitulates a model of persistent infection useful for drug screening. Antiviral resistance is commonly developed upon repeated treatment with a single drug type. It was previously reported by our lab that repeated cultivation of HGT-NV cells in the presence of rupintrivir led to the generation of resistant clones (Kitano et al. 2018). Similarly, in this current study, a prolonged treatment of HGT-NV cells with COX-1 inhibitor led to the generation of a population of resistant cells. Initial propagation of the cells in SC-560 for 15 days significantly reduced viral RNA levels and an additional 5 days of selection in G418 did not completely clear cell colonies (Fig. 3A-C). Remaining colonies were collected, expanded and screened for their susceptibility to the COX-1 inhibitor. After 20 days of incubation in the presence of different concentrations of SC-560, resistant cells maintained high levels of replication compared to control cells that were previously treated with DMSO. An additional incubation for 15 days in the presence of the drug minimally reduced the number of cell colonies, confirming the reduced susceptibility possessed by the cells following prolonged treatment in the COX-1 inhibitor. Analysis of the GI HuNoV replicon in HGT- NV and GI replicon-harboring baby hamster kidney cells (BHK-NV) revealed several 110 mutations across the genome which likely increases viral fitness in this specific environment (Arthur et al. 2019). Also, the consequence of repeated treatment of viral infections with drugs is the selection of mutations which may produce antiviral resistance (reviewed by Strasfeld and Chou 2010). Repeated treatment of the HGT- NV cells with rupintrivir led to the development of two amino acid substitutions of alanine 105 to valine (A105V) and isoleucine 109 to valine (I109V) in the viral protease which conferred resistance to rupintrivir (Kitano et al. 2018). In line with these, we suspected that the viral genome in the HGT-NV560R cells has acquired mutations that rendered the virus less susceptible to SC-560-mediated inhibition of replication. To this end, we sequenced viral RNA extracted from HGT-NV560R cells and compared to the wildtype HuNoV replicon. A single amino acid substitution of threonine 229 to alanine (T229A) was mapped to a region in the NS1/2. The norovirus genome is expressed as a polyprotein which is further processed by the virus protease NS6 into protein precursors including the N-term protein, NS1/2 (Thorne and Goodfellow 2014) which has been ascribed several functions in the norovirus lifecycle. This divergent protein precursor has been reported to contain a caspase-3 cleavage site in MNV (Robinson et al. 2019). A single mutation in the cleavage site abrogated the production of NS1 and negatively impacted virus replication. In fact a recent study reported that secreted MNV NS1 is able to block IFN-λ-mediated innate immune response in an intestinal infection (Lee et al. 2019). A single amino acid change from aspartic acid 94 to glutamic acid (D94E) in the NS1/2 of MNV persistent strain CR6 was responsible for persistence in the colon and recombinant NS1/2 carrying the same mutation caused the acute strain of MNV, CW3, to be persistent (Nice et al. 2013). The MNV NS1/2 interaction with VAMP-associated protein A (VAPA) and VAPB is proviral and mutations in the NS1 domain of the MNV NS1/2 showed that a phenylalanine– 111 phenylalanine-acidic-tract-motif was mimicked in the NS1/2 to enable its interaction with the VAP proteins (McCune et al. 2017). The T229A mutation identified in this study seems to appear in the NS2 domain of the N-term protein. Although little is known about the functions of the NS2 domain in virus replication, there is evidence of it co-localising with the Golgi complex to induce rearrangement of the Golgi membrane when transfected in a cell (Fernandez-Vega et al. 2004). Its role in regulating vesicle transport and inhibiting the expression of cell surface protein has also been reported (Ettayebi and Hardy 2003). These implicate the NS2 protein of noroviruses in replication through the formation of the viral replication complex. To examine the effect of the T229A mutation on HuNoV replication in our replicon system, we made a recombinant HuNoV replicon RNA carrying this mutation (pNV101NS1/2T229A) and tested its susceptibility to SC-560. We observed from our data that transfection of HGT-Cured cells with pNV101NS1/2T229A rendered the replicon less susceptible to SC-560 when incubated in the presence of SC-560 and selected in G418 for up to 6 days. Taken together, the data indicate that HuNoV circumvents its susceptibility to SC-560 by generating a specific single amino acid mutation in NS1/2. We also add to the existing data that reported the importance of the non-structural protein NS1/2 in the life cycle of HuNoV. Finally, since the PGE2 level is affected by SC-560 and exogenous treatment of the HGT-NV cells rescues virus replication in the presence of SC-560, our data suggest that the effect of SC-560 is a direct effect on the COX-1/PGE2 pathway and that the pathway is required for HuNoV replication in vitro. However, a direct effect of SC-560 on the HuNoV NS1/2, specifically the NS2 domain, remains a possibility. 112 Chapter 6 Conclusions and future studies 113 The study of HuNoV life cycle has been hampered by the absence of a cell culture system or a small animal model. Advances made in understanding the HuNoV biology have relied on the MNV cell culture system and the HuNoV replicon system. The recent development of the human intestinal epithelial organoid system is the latest breakthrough that has provided a physiologically relevant system for studying HuNoV. However, the system is still under optimisation to remove its limitations including reproducibility, cost efficiency and labour intensity. Using the HuNoV replicon system in HGT cells developed by Dr Myra Hosmillo, my study aimed at identifying host factors that are important in HuNoV replication. After the replicon-harbouring HGT cells (HGT- NV) were generated, a repeated treatment of a population of those cells with recombinant IFN-⍺ produced HGT-Cured cells. Compared to the wildtype HGT cells, the cured cells were enhanced in their ability to support the replication of VPg-linked HuNoV replicon. We subsequently observed from transcriptomics analysis that several genes were significantly modified in the HGT-NV and HGT-Cured cells compared with the wildtype HGT cells. Importantly, IFNLR1 was significantly downregulated in the HGT-NV and HGT-Cured cells. Overexpression of this receptor in HGT-NV cells followed by incubation with recombinant IFN-λ2 reduced virus replication. Epigenetic analysis showed that IFNLR1 promotor was methylated at the transcription start site in HGT-NV and HGT-Cured cells. Together, our data suggested that the epigenetically supressed IFNLR1 expression contributed to the enhanced replication we observed in the HGT-Cured cells compared to the wildtype HGT cells. HGT-Cured cells were also found to be enhanced in their ability to support HuNoV replication compared to IFN receptor knockout HGT cells. This suggests that the significantly up- or down-regulated genes that are not involved in IFN response may be important in virus replication in the HGT-Cured cells. Suppression or 114 overexpression of these genes in the wildtype HGT cells, followed by transfecting the viral RNA replicon and measuring replication will help in examining the role of the genes in HuNoV replication. VPg-linked HuNoV RNA extracted from BHK-NV cells replicated better in BHK cells whereas that extracted from HGT-NV replicated better in HGT-Cured cells. Sequence analysis of the RNA from the two sources resulted in the identification of several specific and non-specific adaptive mutations which may be responsible for the phenotype observed. Going forward, by introducing the mutations into the wildtype HuNoV replicon RNA, followed by transfection into the wildtype HGT cells or HGT- Cured cells and measuring genome replication by RT-qPCR, the potential roles of the various mutations in HuNoV replication will be identified. Hsp90 was previously reported to stabilize norovirus proteins and its inhibition resulted in the degradation of the VP1 protein and reduction in virus replication. The observation was similar when human intestinal organoids were incubated with Hsp90 inhibitors and infected with GII.3 HuNoV (Dr. Myra Hosmillo, unpublished data). However, in the cells stably replicating GI.1 HuNoV replicon RNA, inhibition of HSP90 activity with small molecule inhibitors increased HuNoV replication. The key component missing in the replicon is an intact VP1 which may be the source of the discrepancy observed. The VP1 is involved in the initial round of virus replication where the negative strand RNA intermediate is made so that the inhibition of Hsp90 reduces the amount of virus genome and infectious particles produced. Since VP1 is already not required in replication in the replicon system, the inhibition of Hsp90 does not affect replication. We also found that inhibiting Hsp90 in the replicon-containing cells resulted in the degradation of several proteins in the innate immune response pathway. This suggested a role for Hsp90 in the innate immune response during 115 HuNoV replication. A further study is required to examine how reconstitution of a complete VP1 in the HuNoV replicon-harbouring cells will affect replication, following the inhibition of Hsp90. Ongoing studies is examining the role of Hsp90 at early timepoints after infection in order to map out the stages at which Hsp90 activity is required in the virus life cycle. Previous studies have reported that FCV, PaSV and MNV require the COX/PGE2 pathway for replication. In this current study, we have examined and observed that the COX/PGE2 pathway is also required for HuNoV replication. Specifically, GI.1 HuNoV replicon replication was significantly reduced with COX-1 inhibition but not COX-2 inhibition. COX non-specific inhibitor had no effect on virus replication. Contrary to this, the inhibition of both COX isoforms reduced GII.3 HuNoV replication in the human intestinal organoid, suggesting different requirements of the COX/PGE2 pathway for different genogroups of HuNoV. However, the differences may possibly be due to the different systems used for the study. We finally found that a specific single amino acid mutation (T229A) in the virus NS1/2 conferred resistance to inhibition of replication when COX-1 is specifically inhibited. In conclusion, the work described in my thesis provides new information on the host factors involved in the restriction of HuNoV replication in cell culture and provides further insights into the role of the innate immune response in HuNoV replication. The information in my thesis has the potential to increase the utilization of the HuNoV of the HuNoV replicon for drug development. 116 References Akaike, T., and H. Maeda. 2000. “Nitric Oxide and Virus Infection.” Immunology 101 (3): 300–308. Al-Salam, Suhail, Aktham Awwad, Manjusha Sudhadevi, Sayel Daoud, Nico J D Nagelkerke, Antonio Castella, S. M. Chong, and Mouied Alashari. 2013. “Epstein- Barr Virus Infection Correlates with the Expression of COX-2, P16(INK4A) and P53 in Classic Hodgkin Lymphoma.” International Journal of Clinical and Experimental Pathology 6 (12): 2765–77. Alfajaro, Mia Madel, Eun-Hyo Cho, Jun-Gyu Park, Ji-Yun Kim, Mahmoud Soliman, Yeong-Bin Baek, Mun-Il Kang, Sang-Ik Park, and Kyoung-Oh Cho. 2018. “Feline Calicivirus- and Murine Norovirus-Induced COX-2/PGE2 Signaling Pathway Has Proviral Effects.” PLOS ONE 13 (7): e0200726. Alfajaro, Mia Madel, Jong-Soon Choi, Deok-Song Kim, Ja-Young Seo, Ji-Yun Kim, Jun-Gyu Park, Mahmoud Soliman, et al. 2017. “Activation of COX-2/PGE2 Promotes Sapovirus Replication via the Inhibition of Nitric Oxide Production.” Journal of Virology 91 (3): e01656-16. Alvarado, Gabriela, Khalil Ettayebi, Robert L. Atmar, Robin G. Bombardi, Nurgun Kose, Mary K. Estes, and James E. Crowe. 2018. “Human Monoclonal Antibodies That Neutralize Pandemic GII.4 Noroviruses.” Gastroenterology 155 (6): 1898– 1907. Ank, Nina, Marie B. Iversen, Christina Bartholdy, Peter Staeheli, Rune Hartmann, Uffe B. Jensen, Frederik Dagnaes-Hansen, et al. 2008. “An Important Role for Type III Interferon (IFN-Lambda/IL-28) in TLR-Induced Antiviral Activity.” Journal of Immunology (Baltimore, Md. : 1950) 180 (4): 2474–85. 117 Arias, Armando, Dalan Bailey, Yasmin Chaudhry, and Ian Goodfellow. 2012. “Development of a Reverse-Genetics System for Murine Norovirus 3: Long-Term Persistence Occurs in the Caecum and Colon.” Journal of General Virology 93 (7): 1432–41. Arthur, Sabastine E., Frédéric Sorgeloos, Myra Hosmillo, and Ian G. Goodfellow. 2019. “Epigenetic Suppression of Interferon Lambda Receptor Expression Leads to Enhanced Human Norovirus Replication In Vitro.” MBio 10 (5):e02155-19. Bai, Weiqi, and Jianguo Tang. 2009. “The Expression and Relationship of Cyclooxygenase-2 and Latent Membrane Protein-1 in Nasopharyngeal Carcinoma.” Lin Chuang Er Bi Yan Hou Tou Jing Wai Ke Za Zhi = Journal of Clinical Otorhinolaryngology, Head, and Neck Surgery 23 (3): 105–8. Baldridge, Megan T., Sanghyun Lee, Judy J. Brown, Nicole McAllister, Kelly Urbanek, Terence S. Dermody, Timothy J. Nice, and Herbert W. Virgin. 2017a. “Expression of Ifnlr1 on Intestinal Epithelial Cells Is Critical to the Antiviral Effects of Interferon Lambda against Norovirus and Reovirus.” Journal of Virology 91 (7): e02079-16. Baldridge, Megan T., Holly Turula, and Christiane E. Wobus. 2016. “Norovirus Regulation by Host and Microbe.” Trends in Molecular Medicine 22 (12): 1047– 59. Baldridge, Megan T, Timothy J Nice, B. T. McCune, Christine C Yokoyama, Amal Kambal, Michael Wheadon, Michael S Diamond, Yulia Ivanova, Maxim Artyomov, and Herbert W Virgin. 2015a. “Commensal Microbes and Interferon- Determine Persistence of Enteric Murine Norovirus Infection.” Science 347 (6219): 266–69. Bartsch, Sarah M, Benjamin A Lopman, Sachiko Ozawa, Aron J Hall, and Bruce Y Lee. 2016. “Global Economic Burden of Norovirus Gastroenteritis.” PLOS ONE 118 11 (4): e0151219. Becker, Karen M, Christine L Moe, Karen L Southwick, and J Newton MacCormack. 2000. “Transmission of Norwalk Virus during a Football Game.” New England Journal of Medicine 343 (17): 1223–27. Belliot, G., B. A. Lopman, K. Ambert-Balay, and P. Pothier. 2014. “The Burden of Norovirus Gastroenteritis: An Important Foodborne and Healthcare-Related Infection.” Clinical Microbiology and Infection 20 (8): 724–30. Belliot, Gaël, Stanislav V. Sosnovtsev, Tanaji Mitra, Carl Hammer, Mark Garfield, and Kim Y. Green. 2003. “In Vitro Proteolytic Processing of the MD145 Norovirus ORF1 Nonstructural Polyprotein Yields Stable Precursors and Products Similar to Those Detected in Calicivirus-Infected Cells.” Journal of Virology 77 (20): 10957–74. Bi, Y., X.-k. Guo, H. Zhao, L. Gao, L. Wang, J. Tang, W.-h. Feng, and S. Perlman. 2014. “Highly Pathogenic Porcine Reproductive and Respiratory Syndrome Virus Induces Prostaglandin E2 Production through Cyclooxygenase 1, Which Is Dependent on the ERK1/2-p-C/EBP- Pathway.” Journal of Virology 88 (5): 2810– 20. Blazek, Katrina, Hayley L. Eames, Miriam Weiss, Adam J. Byrne, Dany Perocheau, James E. Pease, Sean Doyle, Fiona McCann, Richard O. Williams, and Irina A. Udalova. 2015. “IFN-λ Resolves Inflammation via Suppression of Neutrophil Infiltration and IL-1β Production.” Journal of Experimental Medicine 212 (6): 845– 53. Blight, K J, A A Kolykhalov, and C M Rice. 2000. “Efficient Initiation of HCV RNA Replication in Cell Culture.” Science (New York, N.Y.) 290 (5498): 1972–74. 119 Blight, Keril J., Jane A. McKeating, and Charles M. Rice. 2002. “Highly Permissive Cell Lines for Subgenomic and Genomic Hepatitis C Virus RNA Replication.” Journal of Virology 76 (24): 13001–14. Boerries, Melanie, Ricarda Herr, Tilman Brummer, and Hauke Busch. 2015. “Global Gene Expression Profiling Analysis Reveals Reduction of Stemness after B-RAF Inhibition in Colorectal Cancer Cell Lines.” Genomics Data 4 (June): 158–61. Bok, Karin, Gabriel I. Parra, Tanaji Mitra, Eugenio Abente, Charlene K. Shaver, Denali Boon, Ronald Engle, et al. 2011. “Chimpanzees as an Animal Model for Human Norovirus Infection and Vaccine Development.” Proceedings of the National Academy of Sciences of the USA 108 (1): 325–30. Bowie, Andrew G., and Leonie Unterholzner. 2008. “Viral Evasion and Subversion of Pattern-Recognition Receptor Signalling.” Nature Reviews Immunology 8 (12): 911–22. Brocard, Michèle, Valentina Iadevaia, Philipp Klein, Belinda Hall, Glenys Lewis, Jia Lu, James Burke, et al. 2020. “Norovirus Infection Results in EIF2α Independent Host Translation Shut-off and Remodels the G3BP1 Interactome Evading Stress Granule Formation.” Edited by Stephanie M. Karst. PLOS Pathogens 16 (1): e1008250. Bui, Tammy, Jacob Kocher, Yanru Li, Ke Wen, Guohua Li, Fangning Liu, Xingdong Yang, Tanya LeRoith, Ming Tan, and Ming Xia. 2013. “Median Infectious Dose of Human Norovirus GII. 4 in Gnotobiotic Pigs Is Decreased by Simvastatin Treatment and Increased by Age.” Journal of General Virology 94 (9): 2005–16. Bull, Rowena A, Jennifer Hyde, Jason M Mackenzie, Grant S Hansman, Tomoichiro Oka, Naokazu Takeda, and Peter A White. 2011. “Comparison of the Replication 120 Properties of Murine and Human Calicivirus RNA-Dependent RNA Polymerases.” Virus Genes 42 (1): 16–27. Burroughs, J N, and F Brown. 1978. “Presence of a Covalently Linked Protein on Calicivirus RNA.” Journal of General Virology 41 (2): 443–46. Caddy, S., A. Breiman, J. le Pendu, and I. Goodfellow. 2014. “Genogroup IV and VI Canine Noroviruses Interact with Histo-Blood Group Antigens.” Journal of Virology 88 (18): 10377–91. Camarillo, Cynthia, Mavis Swerdel, and Ronald P. Hart. 2011. “Comparison of Microarray and Quantitative Real-Time PCR Methods for Measuring MicroRNA Levels in MSC Cultures.” Methods in Molecular Biology (Clifton, N.J.) 698: 419– 29. Carey, Michelle A., J. Alyce Bradbury, John M. Seubert, Robert Langenbach, Darryl C. Zeldin, and Dori R. Germolec. 2005. “Contrasting Effects of Cyclooxygenase- 1 (COX-1) and COX-2 Deficiency on the Host Response to Influenza A Viral Infection.” The Journal of Immunology 175 (10): 6878–84. Carey, Michelle A., Dori R. Germolec, Robert Langenbach, and Darryl C. Zeldin. 2003. “Cyclooxygenase Enzymes in Allergic Inflammation and Asthma.” Prostaglandins, Leukotrienes and Essential Fatty Acids 69 (2–3): 157–62. Chakraborty, I., S. K. Das, J. Wang, and S. K. Dey. 1996. “Developmental Expression of the Cyclo-Oxygenase-1 and Cyclo-Oxygenase-2 Genes in the Peri- Implantation Mouse Uterus and Their Differential Regulation by the Blastocyst and Ovarian Steroids.” Journal of Molecular Endocrinology 16 (2): 107–22. Chang, K.-O., S. S. Sosnovtsev, G. Belliot, Q. Wang, L. J. Saif, and K. Y. Green. 2005. 121 “Reverse Genetics System for Porcine Enteric Calicivirus, a Prototype Sapovirus in the Caliciviridae.” Journal of Virology 79 (3): 1409–16. Chang, K O. 2009. “Role of Cholesterol Pathways in Norovirus Replication.” Journal of Virology 83 (17): 8587–95. Chang, Kyeong-Ok, Stanislav V Sosnovtsev, Gaël Belliot, Adriene D King, and Kim Y Green. 2006. “Stable Expression of a Norwalk Virus RNA Replicon in a Human Hepatoma Cell Line.” Virology 353 (2): 463–73. Chaudhry, Yasmin, Arabinda Nayak, Marie-Eve Bordeleau, Junichi Tanaka, Jerry Pelletier, Graham J. Belsham, Lisa O. Roberts, and Ian G. Goodfellow. 2006. “Caliciviruses Differ in Their Functional Requirements for EIF4F Components.” Journal of Biological Chemistry 281 (35): 25315–25. Chaudhry, Yasmin, Michael A. Skinner, and Ian G. Goodfellow. 2007. “Recovery of Genetically Defined Murine Norovirus in Tissue Culture by Using a Fowlpox Virus Expressing T7 RNA Polymerase.” Journal of General Virology 88 (8): 2091–2100. Cheetham, Sonia, Menira Souza, Tea Meulia, Sheila Grimes, Myung Guk Han, and Linda J. Saif. 2006. “Pathogenesis of a Genogroup II Human Norovirus in Gnotobiotic Pigs.” Journal of Virology 80(21):10372-10381. Chen, Bin, William H. Piel, Liming Gui, Elspeth Bruford, and Antónia Monteiro. 2005. “The HSP90 Family of Genes in the Human Genome: Insights into Their Divergence and Evolution.” Genomics 86 (6): 627–37. Chen, C F, Y Chen, K Dai, P L Chen, D J Riley, and W H Lee. 1996. “A New Member of the Hsp90 Family of Molecular Chaperones Interacts with the Retinoblastoma Protein during Mitosis and after Heat Shock.” Molecular and Cellular Biology 16 122 (9): 4691–99. Chen, Nannan, Jennifer L. Warner, and Carol Shoshkes Reiss. 2000. “NSAID Treatment Suppresses VSV Propagation in Mouse CNS.” Virology 276 (1): 44– 51. Chen, Q., B. Denard, H. Huang, and J. Ye. 2013. “Epigenetic Silencing of Antiviral Genes Renders Clones of Huh-7 Cells Permissive for Hepatitis C Virus Replication.” Journal of Virology 87 (1): 659–65. Choi, J.-M., Anne M. Hutson, Mary K. Estes, and B. V. V. Prasad. 2008. “Atomic Resolution Structural Characterization of Recognition of Histo-Blood Group Antigens by Norwalk Virus.” Proceedings of the National Academy of Sciences of the USA 105 (27): 9175–80. Christman, Judith K. 2002. “5-Azacytidine and 5-Aza-2’-Deoxycytidine as Inhibitors of DNA Methylation: Mechanistic Studies and Their Implications for Cancer Therapy.” Oncogene 21 (35): 5483–95. Collaco, Roy F., Vivian Kalman-Maltese, Andrew D. Smith, John David Dignam, and James P. Trempe. 2003. “A Biochemical Characterization of the Adeno- Associated Virus Rep40 Helicase.” Journal of Biological Chemistry 278 (36): 34011–17. Conley, Michaela J., Marion McElwee, Liyana Azmi, Mads Gabrielsen, Olwyn Byron, Ian G. Goodfellow, and David Bhella. 2019. “Calicivirus VP2 Forms a Portal-like Assembly Following Receptor Engagement.” Nature 565 (7739): 377–81. Costantini, Veronica, Esther K. Morantz, Hannah Browne, Khalil Ettayebi, Xi-Lei Zeng, Robert L. Atmar, Mary K. Estes, and Jan Vinjé. 2018. “Human Norovirus 123 Replication in Human Intestinal Enteroids as Model to Evaluate Virus Inactivation.” Emerging Infectious Diseases 24 (8): 1453–64. Cotton, Ben T., Jennifer L. Hyde, Soroush T. Sarvestani, Stanislav V. Sosnovtsev, Kim Y. Green, Peter A. White, and Jason M. Mackenzie. 2017. “The Norovirus NS3 Protein Is a Dynamic Lipid- and Microtubule-Associated Protein Involved in Viral RNA Replication.”. Journal of Virology 91 (3): e02138-16. Crowder, Scott, and Karla Kirkegaard. 2005. “Trans-Dominant Inhibition of RNA Viral Replication Can Slow Growth of Drug-Resistant Viruses.” Nature Genetics 37 (7): 701–9. Cui, Qian, Yong-Xiang Zhang, Jing Su, Xin Chen, Keqin Ding, Na Lei, Yan Liu, Jun Li, Yun Zhang, and Rong-Bin Yu. 2011. “Genetic Variation in IL28RA Is Associated with the Outcomes of HCV Infection in a High-Risk Chinese Population.” Infection, Genetics and Evolution 11 (7): 1682–89. Dang, Wen, Lei Xu, Yuebang Yin, Sunrui Chen, Wenshi Wang, Mohamad S. Hakim, Kyeong-Ok Chang, Maikel P. Peppelenbosch, and Qiuwei Pan. 2018. “IRF-1, RIG-I and MDA5 Display Potent Antiviral Activities against Norovirus Coordinately Induced by Different Types of Interferons.” Antiviral Research 155 (July): 48–59. Daughenbaugh, Katie F. 2003. “The Genome-Linked Protein VPg of the Norwalk Virus Binds EIF3, Suggesting Its Role in Translation Initiation Complex Recruitment.” The EMBO Journal 22 (11): 2852–59. Deas, T S, C J Bennett, S A Jones, M Tilgner, P Ren, M J Behr, D A Stein, et al. 2007. “In Vitro Resistance Selection and in Vivo Efficacy of Morpholino Oligomers against West Nile Virus.” Antimicrobial Agents and Chemotherapy 51 (7): 2470– 82. 124 Denard, Bray, Joachim Seemann, Qiuyue Chen, Austin Gay, Hua Huang, Yan Chen, and Jin Ye. 2011. “The Membrane-Bound Transcription Factor CREB3L1 Is Activated in Response to Virus Infection to Inhibit Proliferation of Virus-Infected Cells.” Cell Host & Microbe 10 (1): 65–74. Desselberger, Ulrich. 2019. “Caliciviridae Other Than Noroviruses.” Viruses 11 (3): 286. Dickensheets, H., F. Sheikh, O. Park, B. Gao, and R. P. Donnelly. 2013. “Interferon- Lambda (IFN-Lambda) Induces Signal Transduction and Gene Expression in Human Hepatocytes, but Not in Lymphocytes or Monocytes.” Journal of Leukocyte Biology 93 (3): 377–85. Dickey, Chad A., John Koren, Y.J. Zhang, Y.f. Xu, Umesh K. Jinwal, Morris J. Birnbaum, Bobby Monks, et al. 2008. “Akt and CHIP Coregulate Tau Degradation through Coordinated Interactions.” Proceedings of the National Academy of Sciences of the USA 105 (9): 3622–27. Ding, Siyuan, William Khoury-Hanold, Akiko Iwasaki, and Michael D. Robek. 2014. “Epigenetic Reprogramming of the Type III Interferon Response Potentiates Antiviral Activity and Suppresses Tumor Growth.” Edited by Hidde L. Ploegh. PLoS Biology 12 (1): e1001758. Doerflinger, Sylvie Y., Mirko Cortese, Inés Romero-Brey, Zach Menne, Thibault Tubiana, Christian Schenk, Peter A. White, et al. 2017. “Membrane Alterations Induced by Nonstructural Proteins of Human Norovirus.” Edited by Karla Kirkegaard. PLOS Pathogens 13 (10): e1006705. Dore-Duffy, P. 1982. “Differential Effect of Prostaglandins and Other Products of Arachidonic Acid Metabolism on Measles Virus Replication in Vero Cells.” 125 Prostaglandins, Leukotrienes and Medicine 8 (1): 73–82. Duizer, Erwin, Kellogg J. Schwab, Frederick H. Neill, Robert L. Atmar, Marion P G Koopmans, and Mary K. Estes. 2004. “Laboratory Efforts to Cultivate Noroviruses.” Journal of General Virology 85 (1): 79–87. Dycke, Jana Van, Annelii Ny, Nádia Conceição-Neto, Jan Maes, Myra Hosmillo, Arno Cuvry, Ian Goodfellow, et al. 2019. “A Robust Human Norovirus Replication Model in Zebrafish Larvae.” Edited by Mehul Suthar. PLOS Pathogens 15 (9): e1008009. Emmott, Edward, Frederic Sorgeloos, Sarah L Caddy, Surender Vashist, Stanislav Sosnovtsev, Richard Lloyd, Kate Heesom, Nicolas Locker, and Ian Goodfellow. 2017. “Norovirus-Mediated Modification of the Translational Landscape via Virus and Host-Induced Cleavage of Translation Initiation Factors.” Molecular & Cellular Proteomics : MCP 16 (4 suppl 1): S215–29. Estes, Mary K., Khalil Ettayebi, Victoria R. Tenge, Kosuke Murakami, Umesh Karandikar, Shih-Ching Lin, B. Vijayalakshmi Ayyar, et al. 2019. “Human Norovirus Cultivation in Nontransformed Stem Cell-Derived Human Intestinal Enteroid Cultures: Success and Challenges.” Viruses 11 (7): 638. Ettayebi, Khalil, Sue E. Crawford, Kosuke Murakami, James R. Broughman, Umesh Karandikar, Victoria R. Tenge, Frederick H. Neill, et al. 2016. “Replication of Human Noroviruses in Stem Cell-Derived Human Enteroids.” Science (New York, N.Y.) 353 (6306): 1387–93. Ettayebi, Khalil, and Michele E. Hardy. 2003. “Norwalk Virus Nonstructural Protein P48 Forms a Complex with the SNARE Regulator VAP-A and Prevents Cell Surface Expression of Vesicular Stomatitis Virus G Protein.” Journal of Virology 77 (21): 126 11790–97. Farkas, Tibor, Brittney Fey, Gary Keller, Vito Martella, and Laszlo Egyed. 2012. “Molecular Detection of Murine Noroviruses in Laboratory and Wild Mice.” Veterinary Microbiology 160(3-4):463-467. Fernandez-Vega, Virneliz, Stanislav V Sosnovtsev, Gaël Belliot, Adriene D King, Tanaji Mitra, Alexander Gorbalenya, and Kim Y Green. 2004. “Norwalk Virus N- Terminal Nonstructural Protein Is Associated with Disassembly of the Golgi Complex in Transfected Cells.” Journal of Virology 78 (9): 4827–37. Fletcher, Stephanie M., Mary-Louise McLaws, and John T. Ellis. 2013. “Prevalence of Gastrointestinal Pathogens in Developed and Developing Countries: Systematic Review and Meta-Analysis.” Journal of Public Health Research 2 (1): 9. Flowers, Michele, Averell Sherker, Stephen B. Sinclair, Paul D. Greig, Ross Cameron, M. James Phillips, Laurence Blendis, Stephen W. Chung, and Gary A. Levy. 1994. “Prostaglandin E in the Treatment of Recurrent Hepatitis B Infection After Orthotopic Liver Transplantation.” Transplantation 58 (2): 183–92. Ford-Siltz, Lauren, Lisa Mullis, Yasser Sanad, Kentaro Tohma, Cara Lepore, Marli Azevedo, and Gabriel Parra. 2019. “Genomics Analyses of GIV and GVI Noroviruses Reveal the Distinct Clustering of Human and Animal Viruses.” Viruses 11 (3): 204. Foy, E, K Li, C Wang, R Sumpter Jr, M Ikeda, S M Lemon, and M Gale Jr. 2003. “Regulation of Interferon Regulatory Factor-3 by the Hepatitis C Virus Serine Protease.” Science (New York, N.Y.) 300 (5622): 1145–48. Fritzlar, Svenja, Turgut E. Aktepe, Yi-Wei Chao, Nathan D. Kenney, Michael R. 127 McAllaster, Craig B. Wilen, Peter A. White, and Jason M. Mackenzie. 2019. “Mouse Norovirus Infection Arrests Host Cell Translation Uncoupled from the Stress Granule-PKR-EIF2α Axis.” MBio 10 (3): e00960-19. Frydman, Judith. 2001. “Folding of Newly Translated Proteins In Vivo: The Role of Molecular Chaperones.” Annual Review of Biochemistry 70 (1): 603–47. Gale, Michael, and Eileen M Foy. 2005. “Evasion of Intracellular Host Defence by Hepatitis C Virus.” Nature 436 (7053): 939–45. Geller, Ron, Shuhei Taguwa, and Judith Frydman. 2012. “Broad Action of Hsp90 as a Host Chaperone Required for Viral Replication.” Biochimica et Biophysica Acta (BBA) - Molecular Cell Research 1823 (3): 698–706. Geller, Ron, Marco Vignuzzi, Raul Andino, and Judith Frydman. 2007. “Evolutionary Constraints on Chaperone-Mediated Folding Provide an Antiviral Approach Refractory to Development of Drug Resistance.” Genes & Development 21 (2): 195–205. Ghosh, Soumi, and E. Neil G. Marsh. 2020. “Viperin: An Ancient Radical SAM Enzyme Finds Its Place in Modern Cellular Metabolism and Innate Immunity.” The Journal of Biological Chemistry 295(33): 11513-11528. Giuliano, Christopher J., Ann Lin, Vishruth Girish, and Jason M. Sheltzer. 2019. “Generating Single Cell-Derived Knockout Clones in Mammalian Cells with CRISPR/Cas9.” Current Protocols in Molecular Biology 128 (1): e100. Glass, P. J., L. J. White, J. M. Ball, I. Leparc-Goffart, M. E. Hardy, and M. K. Estes. 2000. “Norwalk Virus Open Reading Frame 3 Encodes a Minor Structural Protein.” Journal of Virology 74 (14): 6581–91. 128 Glass, Roger I, Umesh D Parashar, and Mary K Estes. 2009. “Norovirus Gastroenteritis.” New England Journal of Medicine 361 (18): 1776–85. Gohara, D. W., S. Crotty, J. J. Arnold, J. D. Yoder, R. Andino, and C. E. Cameron. 2000. “Poliovirus RNA-Dependent RNA Polymerase (3Dpol): Structural, Biochemical, and Biological Analysis of Conserved Structural Motifs A and B.” The Journal of Biological Chemistry 275 (33): 25523–32. Gonzalez-Hernandez, Marta J, Anupama Pal, Kofi E Gyan, Marie-Eve Charbonneau, Hollis D Showalter, Nicholas J Donato, Mary O’Riordan, and Christiane E Wobus. 2014. “Chemical Derivatives of a Small Molecule Deubiquitinase Inhibitor Have Antiviral Activity against Several RNA Viruses.” PLoS One 9 (4): e94491. Goodfellow, Ian. 2011. “The Genome-Linked Protein VPg of Vertebrate Viruses — a Multifaceted Protein.” Current Opinion in Virology 1 (5): 355–62. Goodfellow, Ian, Yasmin Chaudhry, Ioanna Gioldasi, Andreas Gerondopoulos, Alessandro Natoni, Louisette Labrie, Jean-François Laliberté, and Lisa Roberts. 2005. “Calicivirus Translation Initiation Requires an Interaction between VPg and EIF4E.” EMBO Reports 6 (10): 968–72. Grau, Katrina R., Alexa N. Roth, Shu Zhu, Abel Hernandez, Natacha Colliou, Bayli B. DiVita, Drake T. Philip, et al. 2017. “The Major Targets of Acute Norovirus Infection Are Immune Cells in the Gut-Associated Lymphoid Tissue.” Nature Microbiology 2 (12): 1586–91. Graziano, Vincent R., Forrest C. Walker, Elizabeth A. Kennedy, Jin Wei, Khalil Ettayebi, Madison S. Strine, Renata B. Filler, et al. 2020. “CD300lf Is the Primary Physiologic Receptor of Murine Norovirus but Not Human Norovirus.” PLoS Pathogens 16 (4): e1008242. 129 Graziano, Vincent R., Jin Wei, Craig B. Wilen, Vincent R. Graziano, Jin Wei, and Craig B. Wilen. 2019. “Norovirus Attachment and Entry.” Viruses 11 (6): 495. Green, K. Y., T. Ando, M. S. Balayan, T. Berke, I. N. Clarke, M. K. Estes, D. O. Matson, et al. 2000. “Taxonomy of the Caliciviruses.” The Journal of Infectious Diseases 181 (s2): S322–30. Green, Kim Y., Aaron Mory, Mark H. Fogg, Andrea Weisberg, Gaël Belliot, Mariam Wagner, Tanaji Mitra, Ellie Ehrenfeld, Craig E. Cameron, and Stanislav V. Sosnovtsev. 2002. “Isolation of Enzymatically Active Replication Complexes from Feline Calicivirus-Infected Cells.” Journal of Virology 76 (17): 8582–95. Guarino, Alfredo, Shai Ashkenazi, Dominique Gendrel, Andrea Lo Vecchio, Raanan Shamir, and Hania Szajewska. 2014. “European Society for Pediatric Gastroenterology, Hepatology, and Nutrition/European Society for Pediatric Infectious Diseases Evidence-Based Guidelines for the Management of Acute Gastroenteritis in Children in Europe.” Journal of Pediatric Gastroenterology and Nutrition 59 (1): 132–52. Gutierrez-Escolano, A. L., Z. U. Brito, R. M. del Angel, and X. Jiang. 2000. “Interaction of Cellular Proteins with the 5’ End of Norwalk Virus Genomic RNA.” Journal of Virology 74 (18): 8558–62. Gutiérrez-Escolano, Ana Lorena, Melina Vázquez-Ochoa, Jaime Escobar-Herrera, and Javier Hernández-Acosta. 2003. “La, PTB, and PAB Proteins Bind to the 3′ Untranslated Region of Norwalk Virus Genomic RNA.” Biochemical and Biophysical Research Communications 311 (3): 759–66. Haga, Kei, Akira Fujimoto, Reiko Takai-Todaka, Motohiro Miki, Yen Hai Doan, Kosuke Murakami, Masaru Yokoyama, Kazuyoshi Murata, Akira Nakanishi, and Kazuhiko 130 Katayama. 2016. “Functional Receptor Molecules CD300lf and CD300ld within the CD300 Family Enable Murine Noroviruses to Infect Cells.” Proceedings of the National Academy of Sciences of the USA 113 (41): E6248–55. Hainzl, Otmar, Maria Claribel Lapina, Johannes Buchner, and Klaus Richter. 2009. “The Charged Linker Region Is an Important Regulator of Hsp90 Function.” Journal of Biological Chemistry 284 (34): 22559–67. Hall, Aron J, Mary E Wikswo, Karunya Manikonda, Virginia a Roberts, Jonathan S Yoder, and L Hannah Gould. 2013. “Acute Gastroenteritis Surveillance through the National Outbreak Reporting System, United States.” Emerging Infectious Diseases 19 (8): 1305–9. Hannemann, Holger. 2020. “Viral Replicons as Valuable Tools for Drug Discovery.” Drug Discovery Today 25 (6): 1026–33. Harmalkar, Dipesh S., Sung-Jin Lee, Qili Lu, Mi Il Kim, Jaehyung Park, Hwayoung Lee, Minkyung Park, Ahrim Lee, Choongho Lee, and Kyeong Lee. 2019. “Identification of Novel Non-Nucleoside Vinyl-Stilbene Analogs as Potent Norovirus Replication Inhibitors with a Potential Host-Targeting Mechanism.” European Journal of Medicinal Chemistry 184 (December): 111733. Hayes, Michael M., Brian R. Lane, Steven R. King, David M. Markovitz, and Michael J. Coffey. 2002. “Prostaglandin E2 Inhibits Replication of HIV-1 in Macrophages through Activation of Protein Kinase A.” Cellular Immunology 215 (1): 61–71. Helbig, Karla J., and Michael R. Beard. 2014. “The Role of Viperin in the Innate Antiviral Response.” Journal of Molecular Biology 426 (6): 1210–19. Hemann, Emily A., Michael Gale, and Ram Savan. 2017. “Interferon Lambda Genetics 131 and Biology in Regulation of Viral Control.” Frontiers in Immunology 8 (December): 1707. Hooks, John J., Marian S. Chin, Kumar Srinivasan, Yuko Momma, Laura C. Hooper, Chandrasekharam N. Nagineni, Chi-Chao Chan, and Barbara Detrick. 2006. “Human Cytomegalovirus Induced Cyclooxygenase-2 in Human Retinal Pigment Epithelial Cells Augments Viral Replication through a Prostaglandin Pathway.” Microbes and Infection 8 (8): 2236–44. Horscroft, Nigel, Vicky C.H. Lai, Wayne Cheney, Nanhua Yao, Jim Z. Wu, Zhi Hong, and Weidong Zhong. 2005. “Replicon Cell Culture System as a Valuable Tool in Antiviral Drug Discovery against Hepatitis C Virus.” Antiviral Chemistry and Chemotherapy 16 (1): 1–12. Hosmillo, Myra, Yasmin Chaudhry, Komal Nayak, Frederic Sorgeloos, Bon-Kyoung Koo, Alessandra Merenda, Reidun Lillestol, Lydia Drumright, Matthias Zilbauer, and Ian Goodfellow. 2020. “Norovirus Replication in Human Intestinal Epithelial Cells Is Restricted by the Interferon-Induced JAK/STAT Signaling Pathway and RNA Polymerase II-Mediated Transcriptional Responses.” Edited by Carolyn B. Coyne. MBio 11 (2): e00215-20. Hosmillo, Myra, Jia Lu, Michael R. McAllaster, James B. Eaglesham, Xinjie Wang, Edward Emmott, Patricia Domingues, et al. 2019. “Noroviruses Subvert the Core Stress Granule Component G3BP1 to Promote Viral VPg-Dependent Translation.” ELife 8:e46681. Hosmillo, Myra, Frédéric Sorgeloos, Rintaro Hiraide, Jia Lu, Ian Goodfellow, and Kyoung-Oh Cho. 2015. “Porcine Sapovirus Replication Is Restricted by the Type I Interferon Response in Cell Culture.” Journal of General Virology 96 (1): 74–84. 132 Hutson, A. M., R. L. Atmar, D. M. Marcus, and M. K. Estes. 2003. “Norwalk Virus-Like Particle Hemagglutination by Binding to H Histo-Blood Group Antigens.” Journal of Virology 77 (1): 405–15. Hutson, Anne M., Robert L. Atmar, and Mary K. Estes. 2004. “Norovirus Disease: Changing Epidemiology and Host Susceptibility Factors.” Trends in Microbiology 12(6): 279-287. Hyde, J. L., S. V. Sosnovtsev, K. Y. Green, C. Wobus, H. W. Virgin, and J. M. Mackenzie. 2009. “Mouse Norovirus Replication Is Associated with Virus-Induced Vesicle Clusters Originating from Membranes Derived from the Secretory Pathway.” Journal of Virology 83 (19): 9709–19. Hyde, Jennifer L., and Jason M. Mackenzie. 2010. “Subcellular Localization of the MNV-1 ORF1 Proteins and Their Potential Roles in the Formation of the MNV-1 Replication Complex.” Virology 406 (1): 138–48.. Hyman, A., C. Yim, M. Krajden, S. Read, A. S. H. Basinski, I. Wanless, G. Levy, and J. Heathcote. 1999. “Oral Prostaglandin (PGE2) Therapy for Chronic Viral Hepatitis B and C.” Journal of Viral Hepatitis 6 (4): 329–36. Isaacs, A., J. Lindenmann, and R. C. Valentine. 1957. “Virus Interference. II. Some Properties of Interferon.” Proceedings of the Royal Society B: Biological Sciences 147(927): 268-273 Jhaveri, Komal, Tony Taldone, Shanu Modi, and Gabriela Chiosis. 2012. “Advances in the Clinical Development of Heat Shock Protein 90 (Hsp90) Inhibitors in Cancers.” Biochimica et Biophysica Acta (BBA) - Molecular Cell Research 1823 (3): 742–55. 133 Jones, Melissa K., Katrina R. Grau, Veronica Costantini, Abimbola O. Kolawole, Miranda de Graaf, Pamela Freiden, Christina L. Graves, et al. 2015. “Human Norovirus Culture in B Cells.” Nature Protocols 10 (12): 1939–47. Jones, Melissa K., Makiko Watanabe, Shu Zhu, Christina L. Graves, Lisa R. Keyes, Katrina R. Grau, Mariam B. Gonzalez-Hernandez, et al. 2014. “Enteric Bacteria Promote Human and Mouse Norovirus Infection of B Cells.” Science 346 (6210): 755–59. Jung, Kwonil, Qiuhong Wang, Yunjeong Kim, Kelly Scheuer, Zhenwen Zhang, Quan Shen, Kyeong-Ok Chang, and Linda J Saif. 2012. “The Effects of Simvastatin or Interferon-α on Infectivity of Human Norovirus Using a Gnotobiotic Pig Model for the Study of Antivirals.” PloS One 7 (7): e41619. Kang, Byoung-Heon. 2012. “TRAP1 Regulation of Mitochondrial Life or Death Decision in Cancer Cells and Mitochondria-Targeted TRAP1 Inhibitors.” BMB Reports 45 (1): 1–6. Kaplan, G, and V R Racaniello. 1988. “Construction and Characterization of Poliovirus Subgenomic Replicons.” Journal of Virology 62 (5): 1687–96. Karademir, Betul, and Gulce Sari-Kaplan. 2018. “Heat Shock Protein (HSP).” In Encyclopedia of Signaling Molecules, 2330–39. Cham: Springer International Publishing. Karandikar, Umesh C., Sue E. Crawford, Nadim J. Ajami, Kosuke Murakami, Baijun Kou, Khalil Ettayebi, Genovefa A. Papanicolaou, et al. 2016. “Detection of Human Norovirus in Intestinal Biopsies from Immunocompromised Transplant Patients.” Journal of General Virology 97(9): 2291-2300. 134 Karst, Stephanie M., Christiane E. Wobus, Ian G. Goodfellow, Kim Y. Green, and Herbert W. Virgin. 2014. “Advances in Norovirus Biology.” Cell Host & Microbe 15 (6): 668–80. Karst, Stephanie M., Christiane E Wobus, Margarita Lay, John Davidson, and Herbert W Virgin. 2003. “STAT1-Dependent Innate Immunity to a Norwalk-like Virus.” Science (New York, N.Y.) 299 (5612): 1575–78. Kawai, Taro, and Shizuo Akira. 2006. “Innate Immune Recognition of Viral Infection.” Nature Immunology 7 (2): 131–37. Khromykh, A A, and E G Westaway. 1997. “Subgenomic Replicons of the Flavivirus Kunjin: Construction and Applications.” Journal of Virology 71 (2): 1497–1505. Khyatti, Meriem, and José Menezes. 1990. “The Effect of Indometacin, Prostaglandin E2 and Interferon on the Multiplication of Herpes Simplex Virus Type 1 in Human Lymphoid Cells.” Antiviral Research 14 (3): 161–72. Kitajima, M., E. Haramoto, C. Phanuwan, H. Katayama, and S. Ohgaki. 2009. “Detection of Genogroup IV Norovirus in Wastewater and River Water in Japan.” Letters in Applied Microbiology 49 (5): 655–58. Kitano, Mitsutaka, Myra Hosmillo, Edward Emmott, Jia Lu, and Ian Goodfellow. 2018. “Selection and Characterization of Rupintrivir-Resistant Norwalk Virus Replicon Cells In Vitro.” Antimicrobial Agents and Chemotherapy 62 (5): e00201-18. Koopmans, Marion, and Erwin Duizer. 2004. “Foodborne Viruses: An Emerging Problem.” International Journal of Food Microbiology 90 (1): 23–41. Koromyslova, Anna D., Vasily A. Morozov, Lisa Hefele, and Grant S. Hansman. 2018. “Human Norovirus Neutralized by a Monoclonal Antibody Targeting the Histo- 135 Blood Group Antigen Pocket.” Edited by Rozanne M. Sandri-Goldin. Journal of Virology 93 (5): e02174-18. Kotenko, Sergei V., Grant Gallagher, Vitaliy V. Baurin, Anita Lewis-Antes, Meiling Shen, Nital K. Shah, Jerome A. Langer, Faruk Sheikh, Harold Dickensheets, and Raymond P. Donnelly. 2003. “IFN-Λs Mediate Antiviral Protection through a Distinct Class II Cytokine Receptor Complex.” Nature Immunology 4 (1): 69–77. Kuyumcu-Martinez, Muge, Gaël Belliot, Stanislav V. Sosnovtsev, Kyeong-Ok Chang, Kim Y. Green, and Richard E. Lloyd. 2004. “Calicivirus 3C-Like Proteinase Inhibits Cellular Translation by Cleavage of Poly(A)-Binding Protein.” Journal of Virology 78 (15): 8172–82. Lateef, Zabeen, Gregory Gimenez, Estelle S. Baker, and Vernon K. Ward. 2017. “Transcriptomic Analysis of Human Norovirus NS1-2 Protein Highlights a Multifunctional Role in Murine Monocytes.” BMC Genomics 18 (1): 39. Lee, Sanghyun, and Megan T. Baldridge. 2017. “Interferon-Lambda: A Potent Regulator of Intestinal Viral Infections.” Frontiers in Immunology 8 (June): 749. Lee, Sanghyun, Hejun Liu, Craig B. Wilen, Zoi E. Sychev, Chandni Desai, Barry L. Hykes, Robert C. Orchard, et al. 2019. “A Secreted Viral Nonstructural Protein Determines Intestinal Norovirus Pathogenesis.” Cell Host & Microbe 25 (6): 845- 857.e5. Lee, Sanghyun, Craig B. Wilen, Anthony Orvedahl, Broc T. McCune, Ki-Wook Kim, Robert C. Orchard, Stefan T. Peterson, Timothy J. Nice, Megan T. Baldridge, and Herbert W. Virgin. 2017. “Norovirus Cell Tropism Is Determined by Combinatorial Action of a Viral Non-Structural Protein and Host Cytokine.” Cell Host & Microbe 22 (4): 449-459.e4. 136 Lee, Sanghyun, Craig B Wilen, Anthony Orvedahl, Timothy J Nice, Megan T Baldridge, Herbert W Virgin, Sanghyun Lee, et al. 2017. “Norovirus Cell Tropism Is Determined by Combinatorial Action of a Viral Non-Structural Protein and Host Cytokine Article Norovirus Cell Tropism Is Determined by Combinatorial Action of a Viral Non-Structural Protein and Host Cytokine.” Cell Host and Microbe 22 (4): 449-459.e4. Lee, Suki M.Y., W.W. Gai, Timothy K.W. Cheung, and J.S.M. Peiris. 2011. “Antiviral Effect of a Selective COX-2 Inhibitor on H5N1 Infection in Vitro.” Antiviral Research 91 (3): 330–34. Li, Dawei, Rui Zhao, Wayne Lilyestrom, Dahai Gai, Rongguang Zhang, James A. DeCaprio, Ellen Fanning, Andrzej Jochimiak, Gerda Szakonyi, and Xiaojiang S. Chen. 2003. “Structure of the Replicative Helicase of the Oncoprotein SV40 Large Tumour Antigen.” Nature 423 (6939): 512–18. Li, Teng-Feng, Myra Hosmillo, Hella Schwanke, Ting Shu, Zhaowei Wang, Lei Yin, Stephen Curry, Ian G. Goodfellow, and Xi Zhou. 2017. “Human Norovirus NS3 Has RNA Helicase and Chaperoning Activities.” Edited by Susana López. Journal of Virology 92 (5): e01606-17. Li, Zihai, and Pramod Srivastava. 2003. “Heat-Shock Proteins.” Current Protocols in Immunology 58 (1): Appendix 1T. Lin, Biing Yuan, Alexander M. Makhov, Jack D. Griffith, Thomas R. Broker, and Louise T. Chow. 2002. “Chaperone Proteins Abrogate Inhibition of the Human Papillomavirus (HPV) E1 Replicative Helicase by the HPV E2 Protein.” Molecular and Cellular Biology 22 (18): 6592–6604. Lin, Chun-Kuang, Chin-Kai Tseng, Kai-Hsun Chen, Shih-Hsiung Wu, Chih-Chuang 137 Liaw, and Jin-Ching Lee. 2015. “Betulinic Acid Exerts Anti-Hepatitis C Virus Activity via the Suppression of NF-ΚB- and MAPK-ERK1/2-Mediated COX-2 Expression.” British Journal of Pharmacology 172 (18): 4481–92. Lin, Chun-Kuang, Chin-Kai Tseng, Yu-Hsuan Wu, Chih-Chuang Liaw, Chun-Yu Lin, Chung-Hao Huang, Yen-Hsu Chen, and Jin-Ching Lee. 2017. “Cyclooxygenase- 2 Facilitates Dengue Virus Replication and Serves as a Potential Target for Developing Antiviral Agents.” Scientific Reports 7 (1): 44701. Lin, Lin, Jiagang Han, Tingbin Yan, Lili Li, Jinsong Li, Yuanyun Ao, Zhaojun Duan, and Yunde Hou. 2019. “Replication and Transcriptionomic Analysis of Human Noroviruses in Human Intestinal Enteroids.” American Journal of Translational Research 11 (6): 3365–74. Lin, Xiaoyan, Lucy Thorne, Zhinan Jin, Loubna A. Hammad, Serena Li, Jerome Deval, Ian G. Goodfellow, and C. Cheng Kao. 2015. “Subgenomic Promoter Recognition by the Norovirus RNA-Dependent RNA Polymerases.” Nucleic Acids Research 43(3): 446-460. Liu, B, I N Clarke, and P R Lambden. 1996. “Polyprotein Processing in Southampton Virus: Identification of 3C-like Protease Cleavage Sites by in Vitro Mutagenesis.” Journal of Virology 70 (4): 2605–10. Liu, Xing, David Main, Yijie Ma, and Bin He. 2018. “Herpes Simplex Virus 1 Inhibits TANK-Binding Kinase 1 through Formation of the Us11-Hsp90 Complex.” Edited by Richard M. Longnecker. Journal of Virology 92 (14): e00402-18. Lohmann, V. 1999. “Replication of Subgenomic Hepatitis C Virus RNAs in a Hepatoma Cell Line.” Science 285 (5424): 110–13. 138 Lopez-Manriquez, E., S. Vashist, L. Urena, I. Goodfellow, P. Chavez, J. E. Mora- Heredia, C. Cancio-Lonches, E. Garrido, and A. L. Gutierrez-Escolano. 2013. “Norovirus Genome Circularization and Efficient Replication Are Facilitated by Binding of PCBP2 and HnRNP A1.” Journal of Virology 87 (21): 11371–87. Lopman, B, S M Ahmed, A Robinson, L Verhoef, M Koopmans, and A J Hall. 2013. “The Global Prevalence of Norovirus among Cases of Gastroenteritis.” Bangkok, Thailand: Vaccines for Enteritis Diseases. Lopman, Benjamin A, Duncan Steele, Carl D Kirkwood, and Umesh D Parashar. 2016. “The Vast and Varied Global Burden of Norovirus: Prospects for Prevention and Control.” PLoS Medicine 13 (4): e1001999. Luczak, M., W. Gumulka, S. Szmigielski, and M. Korbecki. 1975. “Inhibition of Multiplication of Parainfluenza 3 Virus in Prostaglandin-Treated WISH Cells.” Archives of Virology 49 (4): 377–80. Ludwig, A., O. Adams, H.-J. Laws, H. Schroten, and T. Tenenbaum. 2008. “Quantitative Detection of Norovirus Excretion in Pediatric Patients with Cancer and Prolonged Gastroenteritis and Shedding of Norovirus.” Journal of Medical Virology 80 (8): 1461–67. Mahley, R. W., T. L. Innerarity, S. C. Rall, and K. H. Weisgraber. 1984. “Plasma Lipoproteins: Apolipoprotein Structure and Function.” Journal of Lipid Research 25 (12): 1277–94. Mahley, Robert W., and Thomas L. Innerarity. 1983. “Lipoprotein Receptors and Cholesterol Homeostasis.” Biochimica et Biophysica Acta 737 (2): 197–222. Majumder, Pradip K., and William R. Sellers. 2005. “Akt-Regulated Pathways in 139 Prostate Cancer.” Oncogene 24 (50): 7465–74. Marcu, Monica G., Ahmed Chadli, Ilham Bouhouche, Maria Catelli, and Leonard M. Neckers. 2000a. “The Heat Shock Protein 90 Antagonist Novobiocin Interacts with a Previously Unrecognized ATP-Binding Domain in the Carboxyl Terminus of the Chaperone.” Journal of Biological Chemistry 275 (47): 37181–86. Marcu, Monica G., Theodore W. Schulte, and Leonard Neckers. 2000b. “Novobiocin and Related Coumarins and Depletion of Heat Shock Protein 90-Dependent Signaling Proteins.” JNCI: Journal of the National Cancer Institute 92 (3): 242– 48. Marionneau, Severine, Nathalie Ruvoën, Beatrice Le Moullac–Vaidye, Monique Clement, Anne Cailleau–Thomas, Guillermo Ruiz–Palacois, Pengwei Huang, Xi Jiang, and Jacques Le Pendu. 2002. “Norwalk Virus Binds to Histo-Blood Group Antigens Present on Gastroduodenal Epithelial Cells of Secretor Individuals.” Gastroenterology 122 (7): 1967–77. Martella, Vito, Eleonora Lorusso, Niccola Decaro, Gabriella Elia, Arianna Radogna, Maria D’Abramo, Costantina Desario, et al. 2008. “Detection and Molecular Characterization of a Canine Norovirus.” Emerging Infectious Diseases 14 (8): 1306–8. Marzec, Michal, Davide Eletto, and Yair Argon. 2012. “GRP94: An HSP90-like Protein Specialized for Protein Folding and Quality Control in the Endoplasmic Reticulum.” Biochimica et Biophysica Acta (BBA) - Molecular Cell Research 1823 (3): 774–87. Mascarenhas, J., T. I. Mughal, and S. Verstovsek. 2012. “Biology and Clinical Management of Myeloproliferative Neoplasms and Development of the JAK 140 Inhibitor Ruxolitinib.” Current Medicinal Chemistry 19 (26): 4399–4413. McCormick, Craig, and Denys A. Khaperskyy. 2017. “Translation Inhibition and Stress Granules in the Antiviral Immune Response.” Nature Reviews Immunology 17 (10): 647–60. McCune, Broc T., Wei Tang, Jia Lu, James B. Eaglesham, Lucy Thorne, Anne E. Mayer, Emily Condiff, et al. 2017. “Noroviruses Co-Opt the Function of Host Proteins VAPA and VAPB for Replication via a Phenylalanine–Phenylalanine- Acidic-Tract-Motif Mimic in Nonstructural Viral Protein NS1/2.” Edited by Terence S. Dermody. MBio 8 (4): e00668-17. Meyer, Philippe, Chrisostomos Prodromou, Chunyan Liao, Bin Hu, S Mark Roe, Cara K. Vaughan, Ignacija Vlasic, Barry Panaretou, Peter W. Piper, and Laurence H Pearl. 2004. “Structural Basis for Recruitment of the ATPase Activator Aha1 to the Hsp90 Chaperone Machinery.” The EMBO Journal 23 (3): 511–19. Miralpeix, Montserrat, Mercedes Camacho, Jesús López-Belmonte, Francesca Canalías, Jordi Beleta, José Ma Palacios, and Luis Vila. 1997. “Selective Induction of Cyclo-Oxygenase-2 Activity in the Permanent Human Endothelial Cell Line HUV-EC-C: Biochemical and Pharmacological Characterization.” British Journal of Pharmacology 121 (2): 171–80. Modi, Shanu, and Komal Jhaveri. 2015. “Ganetespib: Research and Clinical Development.” OncoTargets and Therapy 8 (July): 1849. Mordstein, Markus, Eva Neugebauer, Vanessa Ditt, Birthe Jessen, Toni Rieger, Valeria Falcone, Frederic Sorgeloos, Stephan Ehl, Daniel Mayer, Georg Kochs, Martin Schwemmle, S. Gunther, et al. 2010. “Lambda Interferon Renders Epithelial Cells of the Respiratory and Gastrointestinal Tracts Resistant to Viral 141 Infections.” Journal of Virology 84 (11): 5670–77. Mumphrey, Shannon M., Harish Changotra, Tara N. Moore, Ellen R. Heimann- Nichols, Christiane E. Wobus, Michael J. Reilly, Mana Moghadamfalahi, Deepti Shukla, and Stephanie M. Karst. 2007. “Murine Norovirus 1 Infection Is Associated with Histopathological Changes in Immunocompetent Hosts, but Clinical Disease Is Prevented by STAT1-Dependent Interferon Responses.” Journal of Virology 81 (7): 3251–63. Murata, Shigeo, Tomoki Chiba, and Keiji Tanaka. 2003. “CHIP: A Quality-Control E3 Ligase Collaborating with Molecular Chaperones.” The International Journal of Biochemistry & Cell Biology 35 (5): 572–78. Nagy, P.D., R.Y. Wang, J. Pogany, A. Hafren, and K. Makinen. 2011. “Emerging Picture of Host Chaperone and Cyclophilin Roles in RNA Virus Replication.” Virology 411 (2): 374–82. Naka, Kazuhito, Ken-ichi Abe, Kazunori Takemoto, Hiromichi Dansako, Masanori Ikeda, Kunitada Shimotohno, and Nobuyuki Kato. 2006. “Epigenetic Silencing of Interferon-Inducible Genes Is Implicated in Interferon Resistance of Hepatitis C Virus Replicon-Harboring Cells.” Journal of Hepatology 44 (5): 869–78. Nice, T. J., D. W. Strong, B. T. McCune, C. S. Pohl, and H. W. Virgin. 2013. “A Single- Amino-Acid Change in Murine Norovirus NS1/2 Is Sufficient for Colonic Tropism and Persistence.” Journal of Virology 87 (1): 327–34. Nice, Timothy J., Megan T. Baldridge, Broc T. McCune, Jason M. Norman, Helen M. Lazear, Maxim Artyomov, Michael S. Diamond, and Herbert W. Virgin. 2015. “Interferon-λ Cures Persistent Murine Norovirus Infection in the Absence of Adaptive Immunity.” Science 347 (6219): 269–73. 142 Odendall, Charlotte, Evelyn Dixit, Fabrizia Stavru, Helene Bierne, Kate M. Franz, Ann Fiegen Durbin, Steeve Boulant, Lee Gehrke, Pascale Cossart, and Jonathan C. Kagan. 2014. “Diverse Intracellular Pathogens Activate Type III Interferon Expression from Peroxisomes.” Nature Immunology 15 (8): 717–26. Oka, Tomoichiro, Hirotaka Takagi, and Yukinobu Tohya. 2014. “Development of a Novel Single Step Reverse Genetics System for Feline Calicivirus.” Journal of Virological Methods 207 (October): 178–81. Oliveira, L.M., R. Blawid, A.F. Orílio, B.Y.G. Andrade, A.C.A. Souza, and T. Nagata. 2018. “Development of an Infectious Clone and Replicon System of Norovirus GII.4.” Journal of Virological Methods 258 (August): 49–53. Ongrádi, J., A. Telekes, J. Farkas, I. Nász, and M. Bendinelli. 1994. “The Effect of Prostaglandins on the Replication of Adenovirus Wild Types and Temperature- Sensitive Mutants.” Acta Microbiologica et Immunologica Hungarica 41 (2): 173– 88. Orchard, Robert C., Meagan E. Sullender, Bria F. Dunlap, Dale R. Balce, John G. Doench, and Herbert W. Virgin. 2018. “Identification of Antinorovirus Genes in Human Cells Using Genome-Wide CRISPR Activation Screening.” Edited by Tom Gallagher. Journal of Virology 93 (1): e01324-18. Orchard, Robert C., Craig B. Wilen, John G. Doench, Megan T. Baldridge, Broc T. McCune, Y.-C. J. Lee, Sanghyun Lee, et al. 2016. “Discovery of a Proteinaceous Cellular Receptor for a Norovirus.” Science 353 (6302): 933–36. Papafragkou, Efstathia, Joanne Hewitt, Geun Woo Park, Gail Greening, and Jan Vinjé. 2013. “Challenges of Culturing Human Norovirus in Three-Dimensional Organoid Intestinal Cell Culture Models.” Edited by Amit Kapoor. PLoS ONE 8 (6): e63485. 143 Parrino, Thomas A., David S. Schreiber, Jerry S. Trier, Albert Z. Kapikian, and Neil R. Blacklow. 1977. “Clinical Immunity in Acute Gastroenteritis Caused by Norwalk Agent.” New England Journal of Medicine 297 (2): 86–89. Patel, M M, M A Widdowson, R I Glass, K Akazawa, J Vinje, and U D Parashar. 2008. “Systematic Literature Review of Role of Noroviruses in Sporadic Gastroenteritis.” Emerging Infectious Diseases 14 (8): 1224–31. Payne, Daniel C., Jan Vinjé, Peter G. Szilagyi, Kathryn M. Edwards, Mary Allen Staat, Geoffrey A. Weinberg, Caroline B. Hall, et al. 2013. “Norovirus and Medically Attended Gastroenteritis in U.S. Children.” New England Journal of Medicine 368 (12): 1121–30. Pearl, Laurence H., and Chrisostomos Prodromou. 2006. “Structure and Mechanism of the Hsp90 Molecular Chaperone Machinery.” Annual Review of Biochemistry 75 (1): 271–94. Perdue, Kathy A., Kim Y. Green, Michelle Copeland, Elyssa Barron, Myrna Mandel, Lawrence J. Faucette, Elizabeth M. Williams, Stanislav V. Sosnovtsev, William R. Elkins, and Jerrold M. Ward. 2007. “Naturally Occurring Murine Norovirus Infection in a Large Research Institution.” Journal of the American Association for Laboratory Animal Science 45(4): 39-45. Pervolaraki, Kalliopi, Megan L. Stanifer, Stephanie Münchau, Lynnsey A. Renn, Dorothee Albrecht, Stefan Kurzhals, Elena Senís, et al. 2017. “Type I and Type III Interferons Display Different Dependency on Mitogen-Activated Protein Kinases to Mount an Antiviral State in the Human Gut.” Frontiers in Immunology 8 (APR): 459. Pfeiffer, Julie K., and Karla Kirkegaard. 2005. “Increased Fidelity Reduces Poliovirus 144 Fitness and Virulence under Selective Pressure in Mice.” PLoS Pathogens 1 (2): e11. Pfister, Thomas, and Eckard Wimmer. 2001. “Polypeptide P41 of a Norwalk-Like Virus Is a Nucleic Acid-Independent Nucleoside Triphosphatase.” Journal of Virology 75 (4): 1611–19. Phillips, Gemma, Clarence C. Tam, Stefano Conti, Laura C. Rodrigues, David Brown, Miren Iturriza-Gomara, Jim Gray, and Ben Lopman. 2010. “Community Incidence of Norovirus-Associated Infectious Intestinal Disease in England: Improved Estimates Using Viral Load for Norovirus Diagnosis.” American Journal of Epidemiology 171 (9): 1014–22. Prasad, B. V. V. 1999. “X-Ray Crystallographic Structure of the Norwalk Virus Capsid.” Science 286 (5438): 287–90.. Prodromou, Chrisostomos. 2016. “Mechanisms of Hsp90 Regulation.” Biochemical Journal 473 (16): 2439–52. Pushko, Peter, Michael Parker, George V. Ludwig, Nancy L. Davis, Robert E. Johnston, and Jonathan F. Smith. 1997. “Replicon-Helper Systems from Attenuated Venezuelan Equine Encephalitis Virus: Expression of Heterologous Genesin Vitroand Immunization against Heterologous Pathogensin Vivo.” Virology 239 (2): 389–401. Qu, Lin, Kosuke Murakami, James R. Broughman, Margarita K. Lay, Susana Guix, Victoria R. Tenge, Robert L. Atmar, and Mary K. Estes. 2016. “Replication of Human Norovirus RNA in Mammalian Cells Reveals Lack of Interferon Response.” Journal of Virology 90 (19): 8906–23. 145 Rai, Devendra K., Paul Lawrence, Anna Kloc, Elizabeth Schafer, and Elizabeth Rieder. 2015. “Analysis of the Interaction between Host Factor Sam68 and Viral Elements during Foot-and-Mouth Disease Virus Infections.” Virology Journal 12 (1): 224. Ratzke, C., M. Mickler, B. Hellenkamp, J. Buchner, and T. Hugel. 2010. “Dynamics of Heat Shock Protein 90 C-Terminal Dimerization Is an Important Part of Its Conformational Cycle.” Proceedings of the National Academy of Sciences of the USA 107 (37): 16101–6. Ridgway, N. D., P. A. Dawson, Y. K. Ho, M. S. Brown, and J. L. Goldstein. 1992. “Translocation of Oxysterol Binding Protein to Golgi Apparatus Triggered by Ligand Binding.” The Journal of Cell Biology 116 (2): 307–19. Robinson, Bridget A., Jacob A. Van Winkle, Broc T. McCune, A. Mack Peters, and Timothy J. Nice. 2019. “Caspase-Mediated Cleavage of Murine Norovirus NS1/2 Potentiates Apoptosis and Is Required for Persistent Infection of Intestinal Epithelial Cells.” Edited by Christiane E. Wobus. PLOS Pathogens 15 (7): e1007940. Rocha-Pereira, J., D. Jochmans, K. Dallmeier, P. Leyssen, R. Cunha, I. Costa, M.S.J. Nascimento, and J. Neyts. 2012. “Inhibition of Norovirus Replication by the Nucleoside Analogue 2′-C-Methylcytidine.” Biochemical and Biophysical Research Communications 427 (4): 796–800. Rocha-Pereira, J., D. Jochmans, Y. Debing, E. Verbeken, M. S. J. Nascimento, and J. Neyts. 2013. “The Viral Polymerase Inhibitor 2’-C-Methylcytidine Inhibits Norwalk Virus Replication and Protects against Norovirus-Induced Diarrhea and Mortality in a Mouse Model.” Journal of Virology 87 (21): 11798–805. 146 Rocha-Pereira, J., D. Jochmans, and J. Neyts. 2015. “Prophylactic Treatment with the Nucleoside Analogue 2’-C-Methylcytidine Completely Prevents Transmission of Norovirus.” Journal of Antimicrobial Chemotherapy 70 (1): 190–97. Rocha-Pereira, J, M S Nascimento, Q Ma, R Hilgenfeld, J Neyts, and D Jochmans. 2014. “The Enterovirus Protease Inhibitor Rupintrivir Exerts Cross-Genotypic Anti-Norovirus Activity and Clears Cells from the Norovirus Replicon.” Antimicrobial Agents and Chemotherapy 58 (8): 4675–81. Rocha-Pereira, Joana, Sophie Jacobs, Sam Noppen, Eric Verbeken, Thomas Michiels, and Johan Neyts. 2018a. “Interferon Lambda (IFN-λ) Efficiently Blocks Norovirus Transmission in a Mouse Model.” Antiviral Research 149 (October 2017): 7–15. Rohayem, J., I. Robel, K. Jager, U. Scheffler, and W. Rudolph. 2006. “Protein-Primed and De Novo Initiation of RNA Synthesis by Norovirus 3Dpol.” Journal of Virology 80 (14): 7060–69. Rossen, John W. A., Janneke Bouma, Rolien H. C. Raatgeep, Hans A. Büller, and Alexandra W. C. Einerhand. 2004. “Inhibition of Cyclooxygenase Activity Reduces Rotavirus Infection at a Postbinding Step.” Journal of Virology 78 (18): 9721–30. Rossmann, Michael G. 1984. “Constraints on the Assembly of Spherical Virus Particles.” Virology 134 (1): 1–11. Rott, David, Jianhui Zhu, Mary Susan Burnett, Yi Fu Zhou, Alexandra Zalles-Ganley, Jibike Ogunmakinwa, and Stephen E. Epstein. 2003. “Effects of MF-Tricyclic, a Selective Cyclooxygenase-2 Inhibitor, on Atherosclerosis Progression and Susceptibility to Cytomegalovirus Replication in Apolipoprotein-E Knockout Mice.” Journal of the American College of Cardiology 41 (10): 1812–19. 147 Saito, Akiko, Takashi Yamashita, Yukiyasu Mariko, Yasuhito Nosaka, Katsutoshi Tsuchiya, Tomoyuki Ando, Tsuneji Suzuki, Takashi Tsuruo, and Osamu Nakanishi. 1999. “A Synthetic Inhibitor of Histone Deacetylase, MS-27-275, with Marked in Vivo Antitumor Activity against Human Tumors.” Proceedings of the National Academy of Sciences of the USA 96 (8): 4592–97. Sander, Willem J., Hester Gertruida O’Neill, and Carolina H. Pohl. 2017. “Prostaglandin E2 As a Modulator of Viral Infections.” Frontiers in Physiology 8 (February): 89. Santer, Deanna M., Gillian E. S. Minty, Dominic P. Golec, Julia Lu, Julia May, Afshin Namdar, Juhi Shah, et al. 2020. “Differential Expression of Interferon-Lambda Receptor 1 Splice Variants Determines the Magnitude of the Antiviral Response Induced by Interferon-Lambda 3 in Human Immune Cells.” Edited by Jacob S. Yount. PLOS Pathogens 16 (4): e1008515. Sato, Saori, Naoya Fujita, and Takashi Tsuruo. 2000. “Modulation of Akt Kinase Activity by Binding to Hsp90.” Proceedings of the National Academy of Sciences of the USA 97 (20): 10832–37. Scheufler, Clemens, Achim Brinker, Gleb Bourenkov, Stefano Pegoraro, Luis Moroder, Hans Bartunik, F.Ulrich Hartl, and Ismail Moarefi. 2000. “Structure of TPR Domain–Peptide Complexes.” Cell 101 (2): 199–210. Schmittgen, Thomas D, and Kenneth J Livak. 2008. “Analyzing Real-Time PCR Data by the Comparative CT Method.” Nature Protocols 3 (6): 1101–8. Schoggins, John W., Sam J. Wilson, Maryline Panis, Mary Y. Murphy, Christopher T. Jones, Paul Bieniasz, and Charles M. Rice. 2011. “A Diverse Range of Gene Products Are Effectors of the Type I Interferon Antiviral Response.” Nature 472 148 (7344): 481–85. Schoof, Nils, Frederike von Bonin, Lorenz Trümper, and Dieter Kube. 2009. “HSP90 Is Essential for Jak-STAT Signaling in Classical Hodgkin Lymphoma Cells.” Cell Communication and Signaling 7 (1): 17. Schroer, J., and Thomas Shenk. 2008. “Inhibition of Cyclooxygenase Activity Blocks Cell-to-Cell Spread of Human Cytomegalovirus.” Proceedings of the National Academy of Sciences of the USA 105 (49): 19468–73. Seah, E. L., J. A. Marshall, and P. J. Wright. 2003. “Trans Activity of the Norovirus Camberwell Proteinase and Cleavage of the N-Terminal Protein Encoded by ORF1.” Journal of Virology 77 (12): 7150–55. Seah, Ee Ling, John A. Marshall, and Peter J. Wright. 1999. “Open Reading Frame 1 of the Norwalk-Like Virus Camberwell: Completion of Sequence and Expression in Mammalian Cells.” Journal of Virology 73 (12): 10531–35. Sen, Ganes C. 2001. “Viruses and Interferons.” Annual Review of Microbiology 55 (1): 255–81. Sharp, Swee, Keith Jones, and Paul Workman. 2014. “Exploiting Cancer Dependence on Molecular Chaperones.” In Cancer Drug Design and Discovery, 239–74. Shelby, Bryan D., Anne Nelson, and Cindy Morris. 2005. “γ-Herpesvirus Neoplasia: A Growing Role for COX-2.” Microscopy Research and Technique 68 (3–4): 120– 29. Sheppard, Paul, Wayne Kindsvogel, Wenfeng Xu, Katherine Henderson, Stacy Schlutsmeyer, Theodore E. Whitmore, Rolf Kuestner, et al. 2003. “IL-28, IL-29 and Their Class II Cytokine Receptor IL-28R.” Nature Immunology 4 (1): 63–68. 149 Silver, L L, and K A Bostian. 1993. “Discovery and Development of New Antibiotics: The Problem of Antibiotic Resistance.” Antimicrobial Agents and Chemotherapy 37 (3): 377. Smith, A W, D O Matson, D A Stein, D E Skilling, A D Kroeker, T Berke, and P L Iversen. 2002. “Antisense Treatment of Caliciviridae: An Emerging Disease Agent of Animals and Humans.” Current Opinion in Molecular Therapeutics 4 (2): 177– 84. Smith, Christopher J., Yan Zhang, Carol M. Koboldt, Jerry Muhammad, Ben S. Zweifel, Alex Shaffer, John J. Talley, Jaime L. Masferrer, Karen Seibert, and Peter C. Isakson. 1998. “Pharmacological Analysis of Cyclooxygenase-1 in Inflammation.” Proceedings of the National Academy of Sciences of the USA 95 (22): 13313–18. Smith, William L., David L. DeWitt, and R. Michael Garavito. 2000. “Cyclooxygenases: Structural, Cellular, and Molecular Biology.” Annual Review of Biochemistry 69 (1): 145–82. Someya, Yuichi, Naokazu Takeda, and Tatsuo Miyamura. 2000. “Complete Nucleotide Sequence of the Chiba Virus Genome and Functional Expression of the 3C-Like Protease in Escherichia Coli.” Virology 278 (2): 490–500. Sommereyns, Caroline, Sophie Paul, Peter Staeheli, and Thomas Michiels. 2008. “IFN-Lambda (IFN-λ) Is Expressed in a Tissue-Dependent Fashion and Primarily Acts on Epithelial Cells In Vivo.” Edited by Michael J. Buchmeier. PLoS Pathogens 4 (3): e1000017. Son, Kyung-No, Zhiguo Liang, and Howard L. Lipton. 2015. “Double-Stranded RNA Is Detected by Immunofluorescence Analysis in RNA and DNA Virus Infections, Including Those by Negative-Stranded RNA Viruses.” Edited by S. Perlman. 150 Journal of Virology 89 (18): 9383–92. Sosnovtsev, S V, G Belliot, K O Chang, V G Prikhodko, L B Thackray, C E Wobus, S M Karst, H W Virgin, and K Y Green. 2006. “Cleavage Map and Proteolytic Processing of the Murine Norovirus Nonstructural Polyprotein in Infected Cells.” Journal of Virology 80 (16): 7816–31. Souza, M., M. S. P. Azevedo, K. Jung, S. Cheetham, and L. J. Saif. 2008. “Pathogenesis and Immune Responses in Gnotobiotic Calves after Infection with the Genogroup II.4-HS66 Strain of Human Norovirus.” Journal of Virology 82 (4): 1777–86. Stark, George R., and James E. Darnell. 2012. “The JAK-STAT Pathway at Twenty.” Immunity 36 (4): 503–14. Strasfeld, Lynne, and Sunwen Chou. 2010. “Antiviral Drug Resistance: Mechanisms and Clinical Implications.” Infectious Disease Clinics of North America 24 (3): 809–33. Straub, Timothy M., Rachel A. Bartholomew, Catherine O. Valdez, Nancy B. Valentine, Alice Dohnalkova, Richard M. Ozanich, Cynthia J. Bruckner-Lea, and Douglas R. Call. 2011. “Human Norovirus Infection of Caco-2 Cells Grown as a Three-Dimensional Tissue Structure.” Journal of Water and Health 9 (2): 225–40. Subba-Reddy, C V, M A Yunus, I G Goodfellow, and C C Kao. 2012. “Norovirus RNA Synthesis Is Modulated by an Interaction between the Viral RNA-Dependent RNA Polymerase and the Major Capsid Protein, VP1.” Journal of Virology 86 (18): 10138–49. Sumpter, Rhea, Yueh-Ming Loo, Eileen Foy, Kui Li, Mitsutoshi Yoneyama, Takashi 151 Fujita, Stanley M. Lemon, and Michael Gale. 2005. “Regulating Intracellular Antiviral Defense and Permissiveness to Hepatitis C Virus RNA Replication through a Cellular RNA Helicase, RIG-I.” Journal of Virology 79 (5): 2689–99. Syedbasha, Mohammedyaseen, and Adrian Egli. 2017. “Interferon Lambda: Modulating Immunity in Infectious Diseases.” Frontiers in Immunology 8: 119. Taipale, Mikko, Daniel F. Jarosz, and Susan Lindquist. 2010. “HSP90 at the Hub of Protein Homeostasis: Emerging Mechanistic Insights.” Nature Reviews Molecular Cell Biology 11 (7): 515–28. Takanashi, Sayaka, Linda J. Saif, John H. Hughes, Tea Meulia, Kwonil Jung, Kelly A. Scheuer, and Qiuhong Wang. 2014. “Failure of Propagation of Human Norovirus in Intestinal Epithelial Cells with Microvilli Grown in Three-Dimensional Cultures.” Archives of Virology 159 (2): 257–66. Thackray, L. B., E. Duan, H. M. Lazear, A. Kambal, R. D. Schreiber, M. S. Diamond, and H. W. Virgin. 2012. “Critical Role for Interferon Regulatory Factor 3 (IRF-3) and IRF-7 in Type I Interferon-Mediated Control of Murine Norovirus Replication.” Journal of Virology 86 (24): 13515–23. Theodoraki, Maria A., Mary Kunjappu, David W. Sternberg, and Avrom J. Caplan. 2007. “Akt Shows Variable Sensitivity to an Hsp90 Inhibitor Depending on Cell Context.” Experimental Cell Research 313 (18): 3851–58. Thompson, Mikayla R., John J. Kaminski, Evelyn A. Kurt-Jones, and Katherine A. Fitzgerald. 2011. “Pattern Recognition Receptors and the Innate Immune Response to Viral Infection.” Viruses 3 (6): 920–40. Thorne, Lucy, Armando Arias, and Ian Goodfellow. 2016. “Advances toward a 152 Norovirus Antiviral: From Classical Inhibitors to Lethal Mutagenesis.” Journal of Infectious Diseases 213 (suppl 1): S27–31. Thorne, Lucy G, and Ian G Goodfellow. 2014. “Norovirus Gene Expression and Replication.” Journal of General Virology 95 (2): 278–91. Tung, Wei-Hsuan, Hsi-Lung Hsieh, and Chuen-Mao Yang. 2010a. “Enterovirus 71 Induces COX-2 Expression via MAPKs, NF-ΚB, and AP-1 in SK–N–SH Cells: Role of PGE2 in Viral Replication.” Cellular Signalling 22 (2): 234–46. Tung, Wei-Hsuan, I-Ta Lee, Hsi-Lung Hsieh, and Chuen-Mao Yang. 2010b. “EV71 Induces COX-2 Expression via c-Src/PDGFR/PI3K/Akt/P42/P44 MAPK/AP-1 and NF-ΚB in Rat Brain Astrocytes.” Journal of Cellular Physiology 224 (2): 376–86. Vagnozzi, A, D A Stein, P L Iversen, and E Rieder. 2007. “Inhibition of Foot-and-Mouth Disease Virus Infections in Cell Cultures with Antisense Morpholino Oligomers.” Journal of Virology 81 (21): 11669–80. Vane, J. R., Y. S. Bakhle, and R. M. Botting. 1998. “Cyclooxygenases 1 and 2.” Annual Review of Pharmacology and Toxicology 38 (1): 97–120. Vashist, S, L Urena, Y Chaudhry, and I Goodfellow. 2012. “Identification of RNA- Protein Interaction Networks Involved in the Norovirus Life Cycle.” Journal of Virology 86 (22): 11977–90. Vashist, Surender, Dalan Bailey, Akos Putics, and Ian Goodfellow. 2009. “Model Systems for the Study of Human Norovirus Biology.” Future Virology 4 (4): 353– 67. Vashist, Surender, Luis Urena, Mariam B. Gonzalez-Hernandez, Jayoung Choi, Alexis de Rougemont, Joana Rocha-Pereira, Johan Neyts, Seungmin Hwang, 153 Christiane E. Wobus, and Ian Goodfellow. 2015a. “Molecular Chaperone Hsp90 Is a Therapeutic Target for Noroviruses.” Edited by S. López. Journal of Virology 89 (12): 6352–63. Vidalain, Pierre-Olivier, and Frédéric Tangy. 2010. “Virus-Host Protein Interactions in RNA Viruses.” Microbes and Infection 12 (14–15): 1134–43. Vinjé, Jan, Mary K. Estes, Pedro Esteves, Kim Y. Green, Kazuhiko Katayama, Nick J. Knowles, Yvan L’Homme, Vito Martella, Harry Vennema, and Peter A. White. 2019. “ICTV Virus Taxonomy Profile: Caliciviridae.” Journal of General Virology 100 (11): 1469–70. Vongpunsawad, S., B. V. Venkataram Prasad, and M. K. Estes. 2013. “Norwalk Virus Minor Capsid Protein VP2 Associates within the VP1 Shell Domain.” Journal of Virology 87 (9): 4818–25. Wang, Chunfu, Michael Gale, Brian C. Keller, Hua Huang, Michael S. Brown, Joseph L. Goldstein, and Jin Ye. 2005. “Identification of FBL2 As a Geranylgeranylated Cellular Protein Required for Hepatitis C Virus RNA Replication.” Molecular Cell 18 (4): 425–34. Wang, Huiqiang, Dajun Zhang, Miao Ge, Zhuorong Li, Jiandong Jiang, and Yuhuan Li. 2015. “Formononetin Inhibits Enterovirus 71 Replication by Regulating COX- 2/PGE2 Expression.” Virology Journal 12 (1): 35. Ward, V K, C J McCormick, I N Clarke, O Salim, C E Wobus, L B Thackray, H W Virgin 4th, and P R Lambden. 2007. “Recovery of Infectious Murine Norovirus Using Pol II-Driven Expression of Full-Length CDNA.” Proceedings of the National Academy of Sciences of the USA 104 (26): 11050–55. 154 Waris, Gulam, James Turkson, Tarek Hassanein, and Aleem Siddiqui. 2005. “Hepatitis C Virus (HCV) Constitutively Activates STAT-3 via Oxidative Stress: Role of STAT-3 in HCV Replication.” Journal of Virology 79 (3): 1569–80. Weber, Friedemann, Valentina Wagner, Simon B. Rasmussen, Rune Hartmann, and Søren R. Paludan. 2006. “Double-Stranded RNA Is Produced by Positive-Strand RNA Viruses and DNA Viruses but Not in Detectable Amounts by Negative- Strand RNA Viruses.” Journal of Virology 80 (10): 5059–64. Weerd, Nicole A. de, Shamith A. Samarajiwa, and Paul J. Hertzog. 2007. “Type I Interferon Receptors: Biochemistry and Biological Functions.” Journal of Biological Chemistry 282 (28): 20053–57. Wilen, Craig B., Sanghyun Lee, Leon L. Hsieh, Robert C. Orchard, Chandni Desai, Barry L. Hykes, Michael R. McAllaster, et al. 2018. “Tropism for Tuft Cells Determines Immune Promotion of Norovirus Pathogenesis.” Science 360 (6385): 204–8. Williams, Christopher S., Moss Mann, and Raymond N. DuBois. 1999. “The Role of Cyclooxygenases in Inflammation, Cancer, and Development.” Oncogene 18 (55): 7908–16. Witte, K., G. Gruetz, H-D Volk, A. C. Looman, K. Asadullah, W. Sterry, R. Sabat, and K. Wolk. 2009. “Despite IFN-λ Receptor Expression, Blood Immune Cells, but Not Keratinocytes or Melanocytes, Have an Impaired Response to Type III Interferons: Implications for Therapeutic Applications of These Cytokines.” Genes & Immunity 10 (8): 702–14. Wobus, Christiane E., Stephanie M. Karst, Larissa B. Thackray, Kyeong-Ok Ok Chang, Stanislav V. Sosnovtsev, Gaël Belliot, Anne Krug, et al. 2004. “Replication 155 of Norovirus in Cell Culture Reveals a Tropism for Dendritic Cells and Macrophages.” PLoS Biol 2 (12): e432. Wolf, Sandro, Wendy Williamson, Joanne Hewitt, Susan Lin, Malet Rivera-Aban, Andrew Ball, Paula Scholes, Marion Savill, and Gail E. Greening. 2009. “Molecular Detection of Norovirus in Sheep and Pigs in New Zealand Farms.” Veterinary Microbiology 133 (1–2): 184–89. Woode, G. N., and J. C. Bridger. 1978. “Isolation of Small Viruses Resembling Astroviruses and Caliciviruses from Acute Enteritis Of Calves.” Journal of Medical Microbiology 11 (4): 441–52. Workman, Paul. 2004. “Combinatorial Attack on Multistep Oncogenesis by Inhibiting the Hsp90 Molecular Chaperone.” Cancer Letters 206 (2): 149–57. Xia, Hongjie, Peipei Wang, Guang-Chuan Wang, Jie Yang, Xianlin Sun, Wenzhe Wu, Yang Qiu, et al. 2015. “Human Enterovirus Nonstructural Protein 2CATPase Functions as Both an RNA Helicase and ATP-Independent RNA Chaperone.” Edited by Bert L. Semler. PLOS Pathogens 11 (7): e1005067. Yamashiro, Yuichiro, Toshiaki Shimizu, Satoshi Oguchi, and Mitsuyoshi Sato. 1989. “Prostaglandins in the Plasma and Stool of Children with Rotavirus Gastroenteritis.” Journal of Pediatric Gastroenterology and Nutrition 9 (3): 322– 27. Yang, Kai, Hexin Shi, Rong Qi, Shaogang Sun, Yujie Tang, Bianhong Zhang, and Chen Wang. 2006. “Hsp90 Regulates Activation of Interferon Regulatory Factor 3 and TBK-1 Stabilization in Sendai Virus-Infected Cells.” Molecular Biology of the Cell 17 (3): 1461–71. 156 Ye, Jin, Chunfu Wang, Rhea Sumpter, Michael S. Brown, Joseph L. Goldstein, and Michael Gale. 2003. “Disruption of Hepatitis C Virus RNA Replication through Inhibition of Host Protein Geranylgeranylation.” Proceedings of the National Academy of Sciences of the USA 100 (26): 15865–70. Ying, Weiwen, Zhenjian Du, Lijun Sun, Kevin P. Foley, David A. Proia, Ronald K. Blackman, Dan Zhou, et al. 2012. “Ganetespib, a Unique Triazolone-Containing Hsp90 Inhibitor, Exhibits Potent Antitumor Activity and a Superior Safety Profile for Cancer Therapy.” Molecular Cancer Therapeutics 11 (2): 475–84. Yoshida, Takafumi, Toshikatsu Hanada, Takeshi Tokuhisa, Ken-ichiro Kosai, Michio Sata, Michinori Kohara, and Akihiko Yoshimura. 2002. “Activation of STAT3 by the Hepatitis C Virus Core Protein Leads to Cellular Transformation.” Journal of Experimental Medicine 196 (5): 641–53. Young, Jason C., Vishwas R. Agashe, Katja Siegers, and F. Ulrich Hartl. 2004. “Pathways of Chaperone-Mediated Protein Folding in the Cytosol.” Nature Reviews Molecular Cell Biology 5 (10): 781–91. Yumiketa, Yo, Takanori Narita, Yosuke Inoue, Go Sato, Wataru Kamitani, Tomoichiro Oka, Kazuhiko Katayama, Takemasa Sakaguchi, and Yukinobu Tohya. 2016. “Nonstructural Protein P39 of Feline Calicivirus Suppresses Host Innate Immune Response by Preventing IRF-3 Activation.” Veterinary Microbiology 185 (March): 62–67. Yun, Bo-Geon, Wenjun Huang, Natalie Leach, Steven D. Hartson, and Robert L. Matts. 2004. “Novobiocin Induces a Distinct Conformation of Hsp90 and Alters Hsp90−Cochaperone−Client Interactions †.” Biochemistry 43 (25): 8217–29. Yunus, Muhammad Amir, Liliane Man Wah Chung, Yasmin Chaudhry, Dalan Bailey, 157 and Ian Goodfellow. 2010. “Development of an Optimized RNA-Based Murine Norovirus Reverse Genetics System.” Journal of Virological Methods 169 (1): 112–18. Yunus, Muhammad Amir, Xiaoyan Lin, Dalan Bailey, Ioannis Karakasiliotis, Yasmin Chaudhry, Surender Vashist, Guo Zhang, Lucy Thorne, C. Cheng Kao, and Ian Goodfellow. 2015. “The Murine Norovirus Core Subgenomic RNA Promoter Consists of a Stable Stem-Loop That Can Direct Accurate Initiation of RNA Synthesis.” Journal of Virology 89(2): 1218-1229. Zarate-Perez, Francisco, Martino Bardelli, John W. Burgner, Maria Villamil-Jarauta, Kanni Das, Demet Kekilli, Jorge Mansilla-Soto, R. Michael Linden, and Carlos R. Escalante. 2012. “The Interdomain Linker of AAV-2 Rep68 Is an Integral Part of Its Oligomerization Domain: Role of a Conserved SF3 Helicase Residue in Oligomerization.” Edited by Craig Meyers. PLoS Pathogens 8 (6): e1002764. Zebardast, Tannaz, Afshin Zarghi, Bahram Daraie, Mehdi Hedayati, and Orkideh G. Dadrass. 2009. “Design and Synthesis of 3-Alkyl-2-Aryl-1,3-Thiazinan-4-One Derivatives as Selective Cyclooxygenase (COX-2) Inhibitors.” Bioorganic & Medicinal Chemistry Letters 19 (12): 3162–65. Zheng, Du-Ping, Tamie Ando, Rebecca L Fankhauser, R Suzanne Beard, Roger I Glass, and Stephan S Monroe. 2006. “Norovirus Classification and Proposed Strain Nomenclature.” Virology 346 (2): 312–23. Zhu, Hua, Jian-Ping Cong, Deborah Yu, Wade A. Bresnahan, and Thomas E. Shenk. 2002. “Inhibition of Cyclooxygenase 2 Blocks Human Cytomegalovirus Replication.” Proceedings of the National Academy of Sciences of the USA 99 (6): 3932–37. 158